Skip to main content
NCBI home page
The Kaohsiung Journal of Medical Sciences logoLink to The Kaohsiung Journal of Medical Sciences
. 2021 Feb 8;37(3):172–180. doi: 10.1002/kjm2.12363

LncRNA UCA1 negatively regulates NF‐kB activity in psoriatic keratinocytes through the miR125a‐A20 axis

Xiao‐Lei Ma 1,✉, Guang‐Dong Wen 2, Cong Yu 2, Zheng Zhao 1, Na Gao 1, Zheng‐Yi Liu 1
PMCID: PMC11896314  PMID: 33554442

Abstract

Psoriasis is one of the most common chronic inflammatory skin diseases that affects approximately 3% of the world's population. Hyper proliferation, infiltration of inflammatory cells and aberrant differentiation of keratinocytes are the three most important characteristics of psoriasis. Previous reports showed that NF‐κBis the crucial mediator linking psoriatic keratinocytes and immune cell states through its effects on chemokine and cytokine production. To identify the role of NF‐κB in psoriasis, we conducted ELISA assay to detect the activity of NF‐κB in lesional skin and nonlesional skin of patients with psoriasis. Mounting evidence suggests that the interaction between long noncoding RNAs (lncRNAs) and microRNAs plays important role in the regulation of the initiation and development of various diseases. In this article, we identified that lncRNA UCA1 was down‐regulated in lesional skin of patients with psoriasis. Further studies showed that lncRNA UCA1 could promote the expression of A20 by inhibitingmiR125a, and up‐regulated A20 decreased the activity of NF‐κB through its ubiquitin editing function. Taken together, we identified and demonstrated that lncRNA UCA1 negatively regulated NF‐κB activity in psoriasis through the miR125a‐A20 axis.

Keywords: A20, lncRNA UCA1, miR125a, NF‐κB, psoriasis

1. INTRODUCTION

Psoriasis is a chronic, relapsing, and immune‐mediated inflammatory disease of the skin that affects approximately 3% of the world's population. 1 , 2 Originally, psoriasis is regarded as a primary disorder of epidermal hyperproliferation, and environmental factors such as obesity and diets are involved in the pathogenesis and advance of psoriasis. 3 , 4 However, recent research and clinical practice have demonstrated that psoriasis is caused by a genetically programmed pathologic interaction among resident epidermal cells, infiltrating immunocytes, and plentiful pro‐inflammatory cytokines, growth factors, and chemokines secreted by these immunocytes. 5 Although psoriasis is closely related to the dysregulation of innate immunity and adaptive immunity triggered by genetic and environmental stimuli, the regulatory mechanism is not fully understood.

As a protein transcription factor, NF‐κB is activated in many different cell lines and serves as a key regulator of inflammation and other complex biological processes. 6 , 7 Previous studies have shown that the level of activated NF‐κB is significantly elevated in lesional skin compared to nonlesional skin of patients with psoriasis. 8 The existing research results demonstrate that NF‐κB dysfunction in multiple cell types is strongly linked to psoriatic phenotype. 9 Knockout IκBα in both keratinocytes and lymphocytes can result in a psoriatic phenotype including a mixed inflammatory infiltrate, diminished granular layers and parakeratosis. In fact, previous target therapies including TNFα inhibitor (etanercept) and IL‐12/23 inhibitor (ustekinumab)treat psoriasis mainly through inhibiting NF‐κB signaling, 10 , 11 and in more recent reports, secukinumab 12 and risankizumab 13 (inhibitors of IL‐17 and IL‐23, respectively) which target the crucial IL‐23/Th17 axis showed higher efficacy in treating psoriasis skin lesions. Genome‐wide association studies (GWAS) have revealed several mediators of the NF‐κB signaling pathway involved in the pathology of psoriasis. 14 , 15 CARD14 (caspase recruitment domain family member 14), encoding a scaffolding protein involved in the NF‐κB activation, is the most well‐studied gene implicated in psoriasis. 16 , 17 Patients with an Arg820Trp mutation in CARD14 usually have a better response to tumor necrosis factor (TNF) inhibitor. 18 In addition, the cytoplasmic zinc finger protein A20 (TNFAIP3, TNFα induced protein 3) usually acts as a negative NF‐κB regulator through its deubiquitinating activity. 19

MicroRNAs (miRNAs), the small noncoding RNAs that participate in diverse biological processes, usually regulate target mRNAs expression through binding to the 3′‐untranslated region. MiRNA‐125 family, which consists of miR125a and miR125b, has been significantly investigated. Many regulatory mechanisms, such as RNA methylation, 20 histone modifications, 21 chromosome translocation, 22 transcription factors, 23 single nucleotide polymorphisms (SNPs), 24 and lncRNAs (long noncoding RNAs), participate in the up‐ or down‐regulation of the level and function of miR‐125. LncRNAs are a type of noncoding RNAs with a length of more than 200 nucleotides. 25 , 26 LncRNA UCA1 (urothelial carcinoma‐associated 1) was first identified to be highly expressed and served as an oncogenic lncRNA in bladder cancer cells. 27 Subsequent studies reported that lncRNA UCA1 was overexpressed in a wide range of tumors, such as breastcancer, 28 nonsmall cell lung cancer, 29 liver cancer, 30 and gastric cancer 31 and played a crucial regulatory role in the pathogenesis of cancer progression. A recent report showed that lncRNAUCA1 functioned as a ceRNA (competitive endogenous RNA) of miR125a by directly binding and inhibiting miR125a expression in acute myeloid leukemia (AML). 32 Although the role of lncRNA UCA1 in cancer has been heavily investigated, whether lncRNA UCA1 was involved in psoriasis remained to be explored.

In the present study, we compared the expression level of lncRNA UCA1 and NF‐κB activity in lesional skin and nonlesional skin of patients with psoriasis. The results showed that NF‐κB activity had a negative correlation with the expression level of lncRNA UCA1. Further studies found that miR125a and its down‐stream protein A20 also play an important role in NF‐κB activity regulation. In brief, lncRNA UCA1 negatively regulated NF‐κB activity through the miR125a‐A20 axis.

2. MATERIALS AND METHODS

2.1. Sample collection

Twenty psoriasis patients (Table 1) were recruited from Peking University People's Hospital and Peking University International Hospital from April 2019 to November 2019. Patients did not receive phototherapy or drugs treatment during the last 1 month prior to sample collection. Psoriatic samples were collected from lesional skin of patients and normal control samples were collected from nonlesional parts around lesional skin (perilesional skin of psoriatic area). Before recruitment in the present study, all patients have signed the consent forms. The study was approved by the Medical Ethics Committee of the Peking University People's Hospital and Peking University International Hospital and the research was carried out following the World Medical Association Declaration of Helsinki.

TABLE 1.

Demographic and clinical characteristics

Patient Age (years) Sex Weight (kg) DP (years) PASI DLQI BSA (%)
Erythrodermic psoriasis 1 55 Female 57 11 28.7 11 4
2 57 Female 51 23 35.4 13 7
3 68 Female 55 9 21.5 10 6
4 39 Female 61 27 19.8 12 8
5 42 Female 49 3 5.4 7 11
6 35 Male 38 25 7.9 5 6
7 31 Male 25 4 15.3 9 18.9
8 65 Male 30 12 21.4 8 21
9 29 Male 66 31 18.9 15 15.4
10 37 Male 41 16 28.5 14 20
11 49 Male 53 12 38.9 18 28
12 53 Male 69 27 45.6 18 24.5
Pustular psoriasis 13 61 Female 58 15 27.8 12 22
14 47 Female 60 12 26.5 15 15
15 41 Female 45 19 15.7 17 11
16 32 Male 63 27 40.6 23 26.4
17 39 Male 65 30 27.5 21 15.2
18 57 Male 69 38 24.6 14 18
19 38 Male 41 19 30.5 24 21
20 29 Male 53 25 40.8 27 25.4
Open in a new tab

Note: All samples were collected from limbs of patients.

Abbreviations: BSA, body surface area; DLQI, dermatology life quality index; LDP, duration of psoriasis; PASI, psoriasis area and severity index.

2.2. Cell culture

Human immortalized keratinocyte cell line HaCat and normal human epidermal keratinocyte cell line NHEK were purchased from ATCC (Manassas, VA) and cultured in DMEM (SH30022.01, HyClone, South Logan, UT) supplemented with 10% fetal bovine serum (FBS, FB25015, Clark，Richmond, VA) and 1% streptomycin and penicillin (SV30010, Hyclone) at 37°C in humidified air of 5% CO2. To mimic psoriasis, HaCatand NHEK cells in good logarithmic growth state were incubated with 50 μg/L TNFα (rcyc‐htnfs, Invivo Gene, Hong Kong, China) for 24 h before designated treatment.

2.3. RNA isolation and real‐time PCR

TRIzol reagent (Invitrogen, Carlsbad, CA) was used to isolate total RNA from cells and tissues. After isolation, the quality and quantity of RNA were measured by nanodrop 2000 (1011 U, Nanodrop, Wilmington, DE). cDNA was acquired by the Primer Script RT reagent kit (Takara Bio, Dalian, China) according to the manufacturer's instructions. The SYBR Premix ExTaqTM II kit (Takara Bio, China) was used to perform the real‐time PCR. The primers used for lncRNA UCA1 and miR125a were listed as follows: lncRNA UCA1 forward:5′‐CTCTCCATTGGGTTCACCATTC‐3′, lncRNA UCA1 reverse:5′‐GCGGCAGGTCTTAAGAGATGAG‐3′; miR125a forward: 5′‐CGTAGACAGGTGAGGTTCTTC‐3′; miR125a reverse: 5′‐GCAGGGTCCGAGGTATTC‐3′; GAPDH forward:5′‐AAGGTCATCCCAGAGCTGAA‐3′, GAPDH reverse:5′‐GCCATGAGGTCCACCACCCT‐3′. The expression level was calculated based on 2–ΔΔCt method and was normalized to GAPDH.

2.4. Cell transfection

Specific siRNA targeting UCA1 (sh‐UCA1) and scrambled control (sh‐NC) were obtained from GenePharma (Shanghai, China). The sequences were listed as follows: sh‐UCA1 sense: 5′‐TGGTAATGTATCATCGGCTTAGTTCAAGAGACTAAGCCGATGATACATTACCTTTTTTC‐3′, sh‐UCA1 anti‐sense: 5′‐TCGAGAAAAAAGGTAATGTATCATCGGCTTAGTCTCTTGAACTAAGCCGATGATACATTACCA‐3′; sh‐NC sense:5′‐TTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAATTTTTTC‐3′, sh‐NC anti‐sense: 5′‐TCGAGAAAAAATTCTCCGAACGTGTCACGTTCTCTTGAAACGTGACACGTTCGGAGAAA‐3′. To overexpress lncRNA UCA1, the full length of UCA1 cDNA was amplified and cloned into the pcDNA vector and identified by sequencing. After 24 h stimulation with 50 μg/L TNFα, cells were seeded and cultured for further 24 h. Cell transfection was conducted with Lipofectamine 2000 (Invitrogen) according to instruction.

2.5. MTT assay

MTT assay was used to measure the proliferation of cells. Cells were seeded into 96‐well plates, and until the confluence reached 30–40%, 50 μg/L TNFα was added to incubate for 24 h. Then MTT reagent (Sigma, St. Louis, MO) was added. Four‐hours later, the optical density at 450 nm was detected.

2.6. NF‐κB activity

DNA binding activity of p65 was used to represent the activity of NF‐κB. Protein extracts of tissues and cells were obtained by RIPA lysis buffer (50 mM Tris, pH 7.4, 1% Triton X‐100, 1% sodium deoxycholate, 150 mM NaCl,0.1% SDS) with cocktail. The activity was measured according to the manufacturer's instructions (Trans AM p65 kit; Active Motif ).

2.7. Western blotting

RIPA lysis buffer (50 mM Tris, pH 7.4, 1% Triton X‐100, 1% sodium deoxycholate, 150 mM NaCl, 0.1% SDS) with cocktail was used to obtain the protein extracts and the concentration of protein was determined with a BCA Protein Assay Kit (P0011, Beyotime, Shanghai, China). After denatured by loading buffer, samples were separated by SDS‐PAGE and transferred into PVDF membranes followed by blocking with 5% skim milk for 2 h. Then anti‐A20 (5630, Cell Signaling Technology, Beverly, MA) antibody and HRP‐linked rabbit antibody (7074, Cell Signaling Technology) were used to show the expression level of the target protein.

2.8. ELISA assay for IL‐6, IL‐8 and IFN‐γ

IL‐6 (SEKH‐0013), IL‐8 (SEKH‐0016), and IFN‐γ (SEKH‐0046) were quantified in cell culture supernatants by ELISA kit (Solarbio life sciences, Beijing, China). Samples were analyzed in triplicate following the manufacturer's protocol.

2.9. Statistical analysis

Data was shown as the mean ± SD, and Student's t‐test was used to calculate the statistically significant difference. p > 0.05 was considered not significant(ns). *p < 0.05, **p < 0.01, ***p < 0.001.

3. RESULTS

3.1. LncRNA UCA1 is down‐regulated in psoriatic keratinocytes

To identify whether LncRNA UCA1 played a role in psoriasis, we recruited 20 patients with psoriasis (Table 1). As shown in Figure 1(A), the level of lncRNA UCA1 is significantly lower in the lesional skin areas than nonlesional skin (perilesional skin of psoriatic area). To further investigate the role of lncRNA UCA1, we treated HaCat and NHEK cells with 50 μg/L TNFα for 24 h to mimic psoriatic cells. MTT assay (Figure 1(B),(C)) was applied to confirm the different proliferation rate between HaCat and activated‐HaCat, NHEK and activated‐NHEK. The results showed that activated cells had higher proliferation rate. Previous reports have demonstrated that the serum levels of IL‐6, IL‐8, and IFN‐γ were much higher in lesional skin than nonlesional skin control of patients with psoriasis. 33 In line with this, the concentrations of IL‐6, IL‐8, and IFN‐γ were increased significantly inactivated‐HaCat and activated‐NHEK cells (Figure 1(D),(E)). Then we detected the level of lncRNA UCA1 in HaCat, NHEK, activated‐HaCat, and activated‐NHEK cells by RT‐qPCR. Consistent with psoriatic skin samples, lncRNA UCA1 levels were significantly down‐regulated in activated‐HaCat and activated‐NHEK cells (Figure 1(F),(G)). Therefore, the psoriasis model has the same characteristics as psoriatic keratinocytes, and the expression level of lncRNA UCA1 was down‐regulated in both psoriasis models and keratinocytes.

FIGURE 1.

FIGURE 1

Open in a new tab

LncRNA UCA1 is down‐regulated in psoriatic keratinocytes. (A) Real‐time PCR analysis of lncRNA UCA1 level in normal controls and psoriatic skin samples from 20 patients with psoriasis. (B, C) the proliferation rates of HaCat, activated‐HaCat, NHEK and activated‐NHEK cells were measured by MTT assay. (D, E) the level of IL‐6, IL‐8, and IFN‐γ produced by HaCat, activated‐HaCat, NHEK, and activated‐NHEK were detected by ELISA assay. (F, G) expression levels of lncRNA UCA1 in HaCat, activated‐HaCat, NHEK and activated‐NHEK cells were measured by real‐time PCR analysis. Data were shown as mean ± SD. LncRNA, long noncoding RNAs. * p < 0.05, ** p < 0.01, *** p < 0.001

3.2. NF‐κB is activated in psoriatic keratinocytes

NF‐κB is thought to be the crucial mediator that links psoriatic keratinocytes and immune cell states through its effects on chemokine and cytokine secretion. 34 Therefore, we measured the activity of NF‐κB in psoriatic lesional skin cells. As shown in Figure 2(A), the activity of NF‐κB was significantly higher in the lesional skin compared to the nonlesional skin of patients with psoriasis. To further verify, we detected the activity of NF‐κB in psoriatic models. In accordance with clinical samples, the activity levels of NF‐κB were much higher in both activated‐HaCat and activated‐NHEK cells (Figure 2(B),(C)).

FIGURE 2.

FIGURE 2

Open in a new tab

NF‐κB is activated in psoriatic keratinocytes. (A) NF‐κB activity of patients with psoriasis, (B) activated‐HaCat, and (C) activated‐NHEK cells were measured by Elisa assay. Data were shown as mean ± SD. *p < 0.05, **p < 0.01, ***p < 0.001

3.3. LncRNA UCA1 negatively regulates NF‐κB activity in psoriatic keratinocytes

Next, we evaluated the correlation between lncRNA UCA1 and NF‐κB. For this purpose, we respectively transfected small interfering RNA of lncRNA UCA1 (sh‐UCA1) and pcDNA‐UCA1 into activated‐HaCat and activated‐NHEK cells to knockdown or overexpress lncRNA UCA1 (Figure 3(A),(B)). After lncRNA UCA1 knocked‐down or overexpressed, we detected the activity of NF‐κB. As shown in Figure 3(C),(D), lncRNA UCA1 knockdown significantly increased the activity of NF‐κB while overexpressed lncRNA UCA1inhibited NF‐κB activity. We then measured the level of IL‐6, IL‐8, and IFN‐γ in sh‐UCA1 or pcDNA‐UCA1 transfected activated‐HaCat and activated‐NHEK cells. LncRNA UCA1 knockdown enhanced the production of IL‐6, IL‐8, and IFN‐γ more than doubles (Figure 3(E),(F)). Similarly, overexpression of lncRNA UCA1 dramatically inhibited the level of IL‐6, IL‐8, and IFN‐γ (Figure 3(E),(F)). Therefore, we demonstrated that there existed a negative regulatory relationship between lncRNA UCA1 and NF‐κB activity, and lncRNA UCA1may be the potent target to control the inflammation of psoriasis.

FIGURE 3.

FIGURE 3

Open in a new tab

LncRNA UCA1 negatively regulates NF‐κB activity in psoriatic keratinocytes. (A, B) sh‐UCA1 or pcDNA‐UCA1 was transfected into activated‐HaCat (A) and activated‐NHEK (B) cells. The transfection efficiency was determined by real‐time PCR analysis. (C, D) NF‐κB activity of lncRNA UCA1 knockdown or overexpressed activated‐HaCat (C) and activated‐NHEK (D) cells was detected by ELISA assay. (E, F) the levels of IL‐6, IL‐8 and IFN‐γ secreted by lncRNA UCA1 knockdown or overexpressed activated‐HaCat (E) and activated‐NHEK (F) were detected by Elisa assay. LncRNA, long noncoding RNAs

3.4. LncRNA UCA1 inhibits the expression of miR125ain psoriatic keratinocytes

To examine whether lncRNA UCA1 exerted its function in psoriatic keratinocytes through the ceRNA (competitive endogenous RNA) regulatory network, we employed microRNA.org and miRBase to analyze the potential targets of lncRNA UCA1. As shown in Figure 4(A), miR125a was the candidate target. And previous reports 32 have demonstrated that lncRNA UCA1 could directly bind miR125a to suppress its expression in AML cells. We then tested the miR125a expression level in psoriasis patients. Compared to nonlesional skin cells, psoriatic keratinocytes showed a higher expression level of miR125a (Figure 4(B)). To further confirm the regulatory relationship between lncRNA UCA1 and miR125a, we respectively transfected sh‐UCA1 and pcDNA‐UCA1 into activated‐HaCat and activated‐NHEK cells to decrease or increase the expression of lncRNA UCA1. The results of RT‐qPCR showed that lncRNA UCA1 knockdown strikingly increased the expression level of miR125a (Figure 4(C),(D)). Meanwhile, pcDNA‐UCA1 transfection conspicuously suppressed the expression of miR125a. Taken together, these results indicated that lncRNA UCA1 could directly bind miR125a to inhibit its expression in psoriatic keratinocytes.

FIGURE 4.

FIGURE 4

Open in a new tab

LncRNA UCA1 inhibits the expression of miR125a in psoriatic keratinocytes. (A) the interaction region between lncRNA UCA1 andmiR125a was predicted by microRNA.org and miRBase. (B–D) MiR125aexpression levels of patients with psoriasis (B), and lncRNA UCA1 knockdown or overexpressed activated‐HaCat (C) and activated‐NHEK (D) cells were determined by real‐time PCR analysis. Data were shown as mean ± SD. LncRNA, long noncoding RNAs. *p < 0.05, **p < 0.01, ***p < 0.001

3.5. LncRNA UCA1 positively regulates the expression level of A20in psoriatic keratinocytes

LncRNA UCA1 could inhibit the activity of NF‐κB and promote the expression level of A20 in psoriatic keratinocytes; however, the relationship between lncRNA UCA1‐miR125a and NF‐κB activity is still unknown. Kim et al. 19 demonstrated that miR125a could constitutively activate the NF‐κB signaling pathway by targeting A20. We first detected the expression of A20 in psoriasis samples, compared to normal control skin samples, lesional psoriatic samples had a much lower level of A20 protein (Figure 5(A),(D)). Then sh‐UCA1 (Figure 5(B),(E)) and pcDNA‐UCA1 (Figure 5(C),(F)) were respectively transfected into activated‐HaCat and activated‐NHEK cells. The results of western blotting showed that the expression level of A20 had a positive correlation with lncRNA UCA1. Taken together, lncRNA UCA1 negatively regulated the activity of NF‐κB through lncRNA UCA1‐miR125a‐A20‐NF‐κB signaling pathway.

FIGURE 5.

FIGURE 5

Open in a new tab

LncRNA UCA1 positively regulated the expression level of A20in psoriatic keratinocytes. The protein level of A20 in patients with psoriasis (A, D), lncRNA UCA1 knockdown (B, E) or overexpressed (C, F) activated‐HaCat and activated‐NHEK cells was detected by western blotting (D–F). Numbers indicated the ratio of the optical density of the A20 band to the β‐Actin band were obtained from three independent assays by using ImageJ software. LncRNA, long noncoding RNAs

4. DISCUSSION

In the present study, we found that lncRNA UCA1 was down‐regulated in lesional psoriatic skin cells whereas the activity of NF‐κB was up‐regulated. To further clarify the role of lncRNA UCA1 in psoriasis, we simulated psoriatic cells by treating keratinocytes HaCat and NHEK with 50 μg/L TNFα for 24 h. Using these two models, we demonstrated that NF‐κB activity had a negative correlation with the expression level of lncRNA UCA1. LncRNA UCA1 could directly bind miR125a to suppress its expression and then the reduced level of miR125a promoted the expression of A20andconsequently inhibited NF‐κB activity.

Psoriasis is one of the most frequent chronic inflammatory skin diseases. Various stimuli could trigger psoriasis through the interaction among skin cells, immunocytes, and numerous biologic signaling molecules. Up to now, the exact pathogenesis of psoriasis is still unknown. Originally, the disorder of epidermal hyperproliferation was thought to be responsible for psoriasis. However, a recent report 5 demonstrated that the dysregulation of immunity and subsequent inflammation was the primary cause of the inflammatory infiltrate characteristic of psoriasis. NF‐κB was thought to be the key mediator responsible for linking altered keratinocyte and immune cell state. 34 As NF‐κB signaling was involved in the two essential cytokines (IL‐17 and TNFα) in the TH‐17/IL‐23 and TNF pathways, anti‐psoriatic therapies targeted NF‐κB was thought to be effective. 35 In this study, we found that NF‐κB was significantly activated in lesional skin of patients with psoriasis.

Recently, more and more evidence demonstrated that lncRNA involved in drug resistance in numerous tumors. 36 LncRNA UCA1 was thought to be related to the regulation of chemoresistance in various tumors. 37 LncRNA UCA1 was first identified in bladder cancer 27 and mainly participated in the regulation of cell growth and apoptosis. The expression of lncRNA UCA1was regulated by transcription factors (Ets‐2, C/EBPa, HIF‐1α, SATB1) and transcriptional complexes (TAZ/YAP/TEAD/SMAD2/3, CAPER/TBX3), and even regulated at the post‐transcriptional levelby miR‐1. 37 Because of its clinical significance, we detected the level of lncRNA UCA1 in psoriatic keratinocytes. But, unexpectedly, lncRNA UCA1 was down‐regulated in lesional skin cells of patients with psoriasis. Usually, lncRNAs functioned as ceRNAs to regulate their target miRNAs. 38 Therefore, we searched the target miRNAs of lncRNA UCA1 through microRNA.org and miRBase. Our results showed that lncRNA UCA1 could directly bind miR125a to suppress its expression.

The previous report has demonstrated that miR125a could promote the degradation of A20 to activate the NF‐κB signaling pathway. 19 A20 was a ubiquitin editing enzyme which participated in the regulation of NF‐κB signaling pathway. A20 could block the interactions between E2 ubiquitin‐conjugating enzymes and E3 ligase to promote K48‐linked ubiquitination and subsequent proteasome‐dependent degradation, whereas inhibiting K63‐linked ubiquitination. 39 In this study, we found that the expression level of A20 showed a positive correlation with lncRNA UCA1. Changes in A20 expression level would then regulate the activity of NF‐κB through its impact on the K63‐linked ubiquitination of RIP1 and TRAF2, IκBα degradation and p65 nuclear accumulation. 19

In conclusion, we identified and characterized lncRNA UCA1 was the upstream regulator of miR125a and A20 expression, and consequently NF‐κB activation. Our results were helpful to better understanding the underlying molecular mechanism of psoriasis, and more importantly, lncRNA UCA1‐miR125a‐A20‐NF‐κB axis may be a potential therapeutic target in the treatment of psoriasis.

CONFLICT OF INTEREST

All authors declare no conflict of interest.

Ma X‐L, Wen G‐D, Yu C, Zhao Z, Gao N, Liu Z‐Y. LncRNA UCA1 negatively regulates NF‐kB activity in psoriatic keratinocytes through the miR125a‐A20 axis. Kaohsiung J Med Sci. 2021;37:172–180. 10.1002/kjm2.12363

Funding information Grant from Peking University International Hospital, Grant/Award Number: YN2018QN04; National Natural Science Foundation of China, Grant/Award Number: 81773311

REFERENCES

  • 1. Guinea‐Viniegra J, Jiménez M, Schonthaler HB, Navarro R, Delgado Y, Concha‐Garzón MJ, et al. Targeting miR‐21 to treat psoriasis. Sci Transl Med. 2014;6(225):225re1. [DOI] [PubMed] [Google Scholar]
  • 2. Chiu HY, Wang TS, Chen PH, Hsu SH, Tsai YC, Tsai TF. Psoriasis in Taiwan: From epidemiology to new treatments. Dermatologica Sinica. 2018;36(3):115–123. [Google Scholar]
  • 3. Yu S, Wu X, Zhou Y, Sheng L, Jena PK, Han D, et al. A western diet, but not a high‐fat and low‐sugar diet, predisposes mice to enhanced susceptibility to imiquimod‐induced psoriasiform dermatitis. J Invest Dermatol. 2019;139(6):1404–1407. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Yu S, Wu X, Shi Z, Huynh M, Jena PK, Sheng L, et al. Diet‐induced obesity exacerbates imiquimod‐mediated psoriasiform dermatitis in anti‐PD‐1 antibody‐treated mice: implications for patients being treated with checkpoint inhibitors for cancer. J Dermatol Sci. 2020;97(3):194–200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Hugh JM, Weinberg JM. Update on the pathophysiology of psoriasis. Cutis. 2018;102(5s):6–12. [PubMed] [Google Scholar]
  • 6. Baltimore D. Discovering NF‐kappaB. Cold Spring Harb Perspect Biol. 2009;1(1):a000026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Lawrence T, Gilroy DW, Willoughby DA. Possible new role for NF‐kappaB in the resolution of inflammation. Nat Med. 2001;7(12):1291–1297. [DOI] [PubMed] [Google Scholar]
  • 8. Lizzul PF, Aphale A, Malaviya R, Sun Y, Masud S, Dombrovskiy V, et al. Differential expression of phosphorylated NF‐kappaB/RelA in normal and psoriatic epidermis and downregulation of NF‐kappaB in response to treatment with etanercept. J Invest Dermatol. 2005;124(6):1275–1283. [DOI] [PubMed] [Google Scholar]
  • 9. Rebholz B, Haase I, Eckelt B, Paxian S, Flaig MJ, Ghoreschi K, et al. Crosstalk between keratinocytes and adaptive immune cells in an IkappaBalpha protein‐mediated inflammatory disease of the skin. Immunity. 2007;27(2):296–307. [DOI] [PubMed] [Google Scholar]
  • 10. Hayden MS, Ghosh S. Shared principles in NF‐kappaB signaling. Cell. 2008;132(3):344–362. [DOI] [PubMed] [Google Scholar]
  • 11. Johansen C, Riis JL, Gedebjerg A, Kragballe K, Iversen L. Tumor necrosis factor α‐mediated induction of interleukin 17C in human keratinocytes is controlled by nuclear factor κB. J Biol Chem. 2011;286(29):25487–25494. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Bissonnette R, Luger T, Thaçi D, Toth D, Lacombe A, Xia S, et al. Secukinumab demonstrates high sustained efficacy and a favourable safety profile in patients with moderate‐to‐severe psoriasis through 5 years of treatment (SCULPTURE extension study). J Eur Acad Dermatol Venereol. 2018;32(9):1507–1514. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Gordon KB, Strober B, Lebwohl M, Augustin M, Blauvelt A, Poulin Y, et al. Efficacy and safety of risankizumab in moderate‐to‐severe plaque psoriasis (UltIMMa‐1 and UltIMMa‐2): Results from two double‐blind, randomised, placebo‐controlled and ustekinumab‐controlled phase 3 trials. Lancet. 2018;392(10148):650–661. [DOI] [PubMed] [Google Scholar]
  • 14. Nair RP, Duffin KC, Helms C, Ding J, Stuart PE, Goldgar D, et al. Genome‐wide scan reveals association of psoriasis with IL‐23 and NF‐kappaB pathways. Nat Genet. 2009;41(2):199–204. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Stuart PE, Nair RP, Ellinghaus E, Ding J, Tejasvi T, Gudjonsson JE, et al. Genome‐wide association analysis identifies three psoriasis susceptibility loci. Nat Genet. 2010;42(11):1000–1004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Tomfohrde J, Silverman A, Barnes R, Fernandez‐Vina MA, Young M, Lory D, et al. Gene for familial psoriasis susceptibility mapped to the distal end of human chromosome 17q. Science. 1994;264(5162):1141–1145. [DOI] [PubMed] [Google Scholar]
  • 17. Blonska M, Lin X. NF‐κB signaling pathways regulated by CARMA family of scaffold proteins. Cell Res. 2011;21(1):55–70. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Coto‐Segura P, González‐Fernández D, Batalla A, Gómez J, González‐Lara L, Queiro R, et al. Common and rare CARD14 gene variants affect the antitumour necrosis factor response among patients with psoriasis. Br J Dermatol. 2016;175(1):134–141. [DOI] [PubMed] [Google Scholar]
  • 19. Kim SW, Ramasamy K, Bouamar H, Lin AP, Jiang D, Aguiar RC. MicroRNAs miR‐125a and miR‐125b constitutively activate the NF‐κB pathway by targeting the tumor necrosis factor alpha‐induced protein 3 (TNFAIP3, A20). Proc Natl Acad Sci U S A. 2012;109(20):7865–7870. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Yuan S, Tang H, Xing J, Fan X, Cai X, Li Q, et al. Methylation by NSun2 represses the levels and function of microRNA 125b. Mol Cell Biol. 2014;34(19):3630–3641. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Li G, So AY, Sookram R, Wong S, Wang JK, Ouyang Y, et al. Epigenetic silencing of miR‐125b is required for normal B‐cell development. Blood. 2018;131(17):1920–1930. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Chapiro E, Russell LJ, Struski S, Cavé H, Radford‐Weiss I, Valle VD, et al. A new recurrent translocation t(11;14)(q24;q32) involving IGH@ and miR‐125b‐1 in B‐cell progenitor acute lymphoblastic leukemia. Leukemia. 2010;24(7):1362–1364. [DOI] [PubMed] [Google Scholar]
  • 23. Shaham L, Binder V, Gefen N, Borkhardt A, Izraeli S. MiR‐125 in normal and malignant hematopoiesis. Leukemia. 2012;26(9):2011–2018. [DOI] [PubMed] [Google Scholar]
  • 24. Lehmann TP, Korski K, Ibbs M, Zawierucha P, Grodecka‐Gazdecka S, Jagodziński PP. rs12976445 variant in the pri‐miR‐125a correlates with a lower level of hsa‐miR‐125a and ERBB2 overexpression in breast cancer patients. Oncol Lett. 2013;5(2):569–573. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Esteller M. Non‐coding RNAs in human disease. Nat Rev Genet. 2011;12(12):861–874. [DOI] [PubMed] [Google Scholar]
  • 26. The ENCODE Project Consortium . An integrated encyclopedia of DNA elements in the human genome. Nature. 2012;489(7414):57–74. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Li HJ, Li X, Pang H, Pan JJ, Xie XJ, Chen W. Long non‐coding RNA UCA1 promotes glutamine metabolism by targeting miR‐16 in human bladder cancer. Jpn J Clin Oncol. 2015;45(11):1055–1063. [DOI] [PubMed] [Google Scholar]
  • 28. Liu H, Wang G, Yang L, Qu J, Yang Z, Zhou X. Knockdown of long non‐coding RNA UCA1 increases the tamoxifen sensitivity of breast cancer cells through inhibition of Wnt/β‐catenin pathway. PLoS One. 2016;11(12):e0168406. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Wu H, Zhou C. Long non‐coding RNA UCA1 promotes lung cancer cell proliferation and migration via microRNA‐193a/HMGB1 axis. Biochem Biophys Res Commun. 2018;496(2):738–745. [DOI] [PubMed] [Google Scholar]
  • 30. Hu ML, Wang XY, Chen WM. TGF‐β1 upregulates the expression of lncRNA UCA1 and its downstream HXK2 to promote the growth of hepatocellular carcinoma. Eur Rev Med Pharmacol Sci. 2018;22(15):4846–4854. [DOI] [PubMed] [Google Scholar]
  • 31. Gu L, Lu LS, Zhou DL, Liu ZC. UCA1 promotes cell proliferation and invasion of gastric cancer by targeting CREB1 sponging to miR‐590‐3p. 2018;7(4):1253–1263. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Zhang Y, Liu Y, Xu X. Knockdown of LncRNA‐UCA1 suppresses chemoresistance of pediatric AML by inhibiting glycolysis through the microRNA‐125a/hexokinase 2 pathway. J Cell Biochem. 2018;119(7):6296–6308. [DOI] [PubMed] [Google Scholar]
  • 33. Elneam AIA, Al‐Dhubaibi MS, Alrheam A. Angiotensin‐converting enzyme (ACE) D allele as a risk factor for increase serum interleukin‐6 and interleukin‐8 in psoriasis patients. Open Access Maced J Med Sci. 2018;6(5):772–776. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Tsuruta D. NF‐kappaB links keratinocytes and lymphocytes in the pathogenesis of psoriasis. Recent Pat Inflamm Allergy Drug Discov. 2009;3(1):40–48. [DOI] [PubMed] [Google Scholar]
  • 35. Heenen M, Simonart T. Biological agents and psoriatic epidermis: What are we ultimately targeting? Dermatology. 2006;212(4):321–323. [DOI] [PubMed] [Google Scholar]
  • 36. Xia H, Hui KM. Mechanism of cancer drug resistance and the involvement of noncoding RNAs. Curr Med Chem. 2014;21(26):3029–3041. [DOI] [PubMed] [Google Scholar]
  • 37. Wang H, Guan Z, He K, Qian J, Cao J, Teng L. LncRNA UCA1 in anti‐cancer drug resistance. Oncotarget. 2017;8(38):64638–64650. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Militello G, Weirick T, John D, Döring C, Dimmeler S, Uchida S. Screening and validation of lncRNAs and circRNAs as miRNA sponges. Brief Bioinform. 2017;18(5):780–788. [DOI] [PubMed] [Google Scholar]
  • 39. Hymowitz SG, Wertz IE. A20: From ubiquitin editing to tumour suppression. Nat Rev Cancer. 2010;10(5):332–341. [DOI] [PubMed] [Google Scholar]

Articles from The Kaohsiung Journal of Medical Sciences are provided here courtesy of Kaohsiung Medical University and John Wiley & Sons Australia, Ltd

RESOURCES