Abstract
Bladder cancer (BC) is a familiar malignancy with high morbidity and mortality. The effect of treatment is unsatisfactory after the metastasis and invasion of BC. Hence, more studies should be carried out to explore the metastasis of BC. RT‐qPCR or/and western blot was conducted to evaluate miR‐494‐3p, KLF9, and RGS2 expression. Cell proliferation and invasion were estimated by MTT assay and transwell assay, respectively. Cell migration was tested by wound healing assay and transwell assay. Dual‐luciferase reporter gene assay was employed to validate the interplay between miR‐494‐3p and KLF9 mRNA. The interaction between KLF9 and RGS2 promoter was verified using dual‐luciferase reporter gene assay and chromatin immunoprecipitation (ChIP) assay. miR‐494‐3p expression was upregulated, whereas KLF9 and RGS2 were downregulated in BC cells. miR‐494‐3p inhibition was competent to limit the growth of BC cells. KLF9 knockdown abolished the miR‐494‐3p depletion‐mediated inhibitory growth of BC cells. Mechanistically, we found that KLF9 was a downstream gene of miR‐494‐3p and could bind to the promoter region of RGS2 to promote the expression of RGS2. Moreover, RGS2 knockdown abrogated the suppressive effects of miR‐494‐3p knockdown on the proliferation, migration, and invasion of BC cells. Notably, miR‐494‐3p inhibition obstructed the tumor growth in nude mice. miR‐494‐3p silencing inhibited the progression of BC by regulating the KLF9/RGS2 axis in vitro and in vivo, which laid the foundation for experiments of miR‐494‐3p in BC and provided therapeutic targets for BC.
Keywords: bladder cancer, cell migration, KLF9, miR‐494‐3p, RGS2
1. INTRODUCTION
Bladder cancer (BC) is a type of cancer of the urinary system, which is a malignant tumor occurring on the mucosa of the bladder. BC mainly occurs in the elderly, and its peak diagnosis is between 70 and 84 years old. 1 The incidence of BC in men is approximately four times that of women. 2 Approximately 70%–80% of patients suffering from BC belong to nonmuscle‐invasive cancer types, so transurethral surgery is sufficient to remove the tumor. 3 However, some patients with BC may still have the risk of tumor recurrence and metastasis. The malignant growth and invasion of cancer cells could deep into the depth of bladder layers such as the detrusor muscle, surrounding and even extra‐bladder tissues. 4 The treatments for BC have made great progress worldwide in recent years. Focusing on BC that metastasizes and invades other tissues, in addition to traditional surgical resection, chemotherapy, and radiotherapy, immunotherapy is a promising treatment for BC. 5 Even with multiple treatments, postoperative recurrence and distant metastasis make the 5‐year survival rate of advanced BC relatively low. 6 A deeper exploration of the occurrence and malignancy of BC is of great significance for its treatment.
MicroRNA (miRNA) is deemed to serve as a type of noncoding RNA with approximately 22 nucleotides, which is implicated in the occurrence and development of BC. 7 , 8 For instance, miR‐186‐5p is a suppressor factor and restrains the growth and invasion of BC. 9 According to previous reports, miR‐494‐3p was risen and expedited the progress of BC, 10 implying that miR‐494‐3p exerted as oncogene in BC. However, its underlying mechanism in BC is obscure.
Krüppel‐like factor 9 (KLF9), which belongs to the KLF transcriptional factor family, is defined as a transcription factor, which is widely reported in the process of cancer proliferation, migration, and invasion. 11 , 12 KLF9 expression is downregulated in BC, and KLF9 abundance can inhibit BC cell proliferation, indicating that KLF9 functions as a tumor suppressor and is involved in the progression of BC. 13 However, the specific mechanism of KLF9 in BC remains to be further explored. It is well known that miRNAs are widely involved in posttranscriptional gene silencing. 14 The Starbase website (https://starbase.sysu.edu.cn/) predicted that there exists a binding site between miR‐494‐3p and KLF9 mRNA. Moreover, the connection between miR‐494‐3p and KLF9 has not been reported in BC.
G‐protein signaling protein 2 (RGS2) belongs to a subfamily of RGS protein that has been extensively investigated in multiple cancer types. 15 , 16 Previous studies have demonstrated that RGS2 level is downregulated in BC and the depletion of RGS2 promotes the developmental progress of BC. 17 , 18 The JASPAR database (https://jaspar.genereg.net/) predicted that KLF9 has a potential binding site in the promoter region of RGS2. Therefore, the direct combination of KLF9 and RGS2 promoter may play a key role in BC development and is worthy of further study.
On the basis of the above background, this work was to probe the function and underlying molecular mechanism of miR‐494‐3p in BC. We hope that our findings will provide potential diagnostic markers and therapeutic targets for BC.
2. METHODS
2.1. Cell culture
The immortalized human bladder epithelial cell (SV‐HUC‐1), BC cells (5637, SW780, UM‐UC‐3, RT4, T24, and J82), and 293T cell were purchased from ATCC (Manassas, VA). The SV‐HUC‐1 cell was cultured in F‐12 K medium, the 5637, SW780, UM‐UC‐3, T24, and J82 cells were maintained in RPMI 1640, and the RT4 cells were maintained in McCoy's 5A at 37°C with 5% CO2. Cell medium (Thermo Fisher Scientific, Waltham, MA) was supplied with 10% FBS (Gibco, Gaithersburg, MD), 1% penicillin and streptomycin (Beyotime Biotechnology, China).
2.2. Cell transfection
miR‐494‐3p mimics/inhibitor, sh‐KLF9, sh‐RGS2, and OE‐KLF9, as well as their negative control groups (miR NC, sh‐NC, and pcDNA3.1), were acquired from GenePharma (China). Briefly, the 5637 and T24 cells were planted onto six‐well plates (1 × 105 cells/well). Then, cells with 50% confluence were transfected with miR‐494‐3p inhibitor or miR‐494‐3p mimics, sh‐KLF9, sh‐RGS2, and their corresponding negative control groups using Lipofectamine™ 3000 (Invitrogen, Waltham, MA) according to the manufacturer's instructions.
2.3. Animal experiment
Ten BALB/c nude mice aged 5–6 weeks (male, 15–20 g) were obtained from Hunan SJA Laboratory Animal Co., Ltd., China. The mice were housed at 25°C ± 2°C under 12‐h light/12‐h dark cycles in a specific pathogen‐free facility. Lentivirus carrying anti‐miR‐494‐3p and its negative control (anti‐NC) were obtained from GenePharma. T24 cells were infected with anti‐miR‐494‐3p or anti‐NC. To investigate the influence of miR‐494‐3p silencing on tumor growth in vivo, T24 cells with anti‐miR‐494‐3p or anti‐NC transfection were subcutaneously injected into the mice (n = 5). Tumor volume was measured using a caliper from 1 to 4 weeks postinjection. The mice were euthanized, and tumor tissues were collected for RT‐qPCR after 4 weeks. This animal study was approved by The Ethics Committee of the First People's Hospital of Chenzhou.
2.4. RNA isolation, reverse transcription, and RT‐qPCR
Total RNA was obtained from the immortalized human bladder epithelial cell, BC cells, and tumor in mice with TRIzol reagent (Invitrogen). A PrimeScript Reverse Transcription Reagent Kit (TaKaRa, Japan) was used to synthesize cDNA, and a SYBR Premix Ex Taq II Kit (Takara, Japan) was used in qPCR. The primers for individual genes were listed in Table 1. All data were calculated using the 2−ΔΔt formula. GAPDH or U6 was regarded as a reference gene.
TABLE 1.
The primers for individual genes
| Primer name | Sequence |
|---|---|
| miR‐494‐3p (F) | CGGCTGAAACATACACGGGA |
| miR‐494‐3p (R) |
GTCGTATCCAGTGCAGGGTCCGAGGT ATTCGCACTGGATACGACGAGGTT |
| KLF9 (F) | AACACGCCTCCGAAAAGAGG |
| KLF9 (R) | TCGTCTGAGCGGGAGAACTT |
| RGS2 (F) | ACTCCTGGGAAGCCCAAAAC |
| RGS2 (R) | AAGCCCTGAATGCAGCAAGA |
| GAPDH (F) | CCAGGTGGTCTCCTCTGA |
| GAPDH (R) | GCTGTAGCCAAATCGTTGT |
| U6 (F) | CTCGCTTCGGCAGCACA |
| U6 (R) | AACGCTTCACGAATTTGCGT |
2.5. Western blot
Total protein was obtained from the immortalized human bladder epithelial cell, BC cells, and tumor in mice with RIPA lysis buffer (Beyotime Biotechnology, China). The concentration of total protein was determined using a BCA Assay Kit (Beyotime Biotechnology, China). SDS‐PAGE was employed to separate the proteins and then the proteins were transferred onto PVDF membranes. Skimmed milk (5%) blocked PVDF membranes and primary antibodies of KLF9 (1:1000, Absin, #abs117726, China), RGS2 (1:1000, Absin, #abs136141, China), and GAPDH (1:5000, Absin, #abs132004, China) were applied to incubate the PVDF membranes overnight at 4°C. Subsequently, HRP‐conjugated secondary antibodies (Beyotime Biotechnology, China) were added to incubate the membranes for 1 h, and an ECL chemiluminescent reagent (Beyotime Biotechnology, China) was applied to react with proteins in membranes. Finally, the images of protein bands were captured with the Odyssey Clx Imaging System (Licor Biosciences, Lincoln, NE) and quantitatively analyzed using ImageJ.
2.6. MTT assay
BC cells were seeded onto 96‐well plates (1 × 103 cells/well) overnight and treated with plasmids for 48 h. BC cells were incubated in 20 μl of MTT solution (Beyotime Institute of Biotechnology, China) for another 4 h. Then, the supernatant was discarded, and the formazan crystals were dissolved with dimethyl sulfoxide. The absorbance at 490 nm was measured using a microplate reader (Thermo Fisher Scientific, Germany).
2.7. Wound healing assay
BC cells were seeded onto six‐well plates (1 × 103 cells/well) and were scratched a line with the tips of pipette heads when cell density reached 80%–90%. Then, cells were cultured in serum‐free medium for 24 h. The scratched widths were observed and recorded at 0 and 24 h.
2.8. Transwell assay
A 24‐well transwell insert system (Corning, Corning, NY) was used to test the migration and invasion of BC cells. For the evaluation of the capacity to cell migration, cells (1 × 106 cells/ml) were seeded onto the upper chamber containing serum‐free DMEM at 37°C with 5% CO2 and the lower chamber was added with DMEM and 10% FBS. After 24 h, the migrating cells on the below side of chamber were fixed with 95% alcohol. Then, 1% crystal violet (Sigma‐Aldrich, USA) was used to stain the migrated cells for 5 min. Finally, five random visual fields were observed under an inverted microscope (Olympus, Japan).
For the measurement of the capacity to cell invasion, the top transwell chamber was completely covered with Matrigel (Becton Dickinson Biosciences, Hercules, CA). Other steps are consistent with migration assay.
2.9. Dual‐luciferase reporter gene assay
The sequences of 3′‐UTR of KLF9 combined with miR‐494‐3p were cloned into psiChECK2 vectors (Ke Lei Biological Technology Co., Ltd., China) for constructing reporter vectors KLF9 (WT/MUT). miR‐494‐3p mimics were transfected in 293T cells together with KLF9 (WT/MUT) by Lipofectamine™ 3000 (Invitrogen). The fragment of RGS2 promoter (WT/MUT) were cloned into psiChECK2 vector for constructing reporter vectors RGS2 (WT/MUT). Then, 293T cells underwent co‐transfection with psiChECK2‐RGS2 plasmids (WT/MUT) and OE‐KLF9 or empty vectors by Lipofectamine™ 3000 (Invitrogen). Luciferase activity was assessed with a dual‐luciferase reporter assay system (Promega, Madison, WI) based on the standard protocol after cultivated for 48 h.
2.10. Chromatin immunoprecipitation assay
A chromatin immunoprecipitation (ChIP) kit (Beyotime, China) was used to evaluate the relationship between KLF9 and RGS2. Briefly, cells were fixed with 1% formaldehyde solution for 10 min. Then, 125 mM glycine disposed cells for 5 min. Subsequently, ultrasonic treatment was used to fragment DNA into segments of 200–500 bp in length. Cell lysate was incubated with anti‐KLF9 (1:400, #ab227920, Abcam) or anti‐IgG (1:1000, #ab171870, Abcam) at 4°C overnight. Then, dynabeads protein G (Invitrogen) was supplied to precipitate the DNA complex. The immunoprecipitated DNAs were evaluated using qPCR assay.
2.11. Statistical analysis
All tests were repeated at least three times and gathered three independent data. All data were presented as means ± standard deviation (SD). GraphPad Prism 6 was used to calculate the data. Only the results of two groups were analyzed with Student's t‐test, and more than two groups were analyzed with one‐way analysis of variance. p < 0.05 was considered a statistically significant difference.
3. RESULTS
3.1. miR‐494‐3p silencing impeded the proliferation, migration, and invasion of BC cells
To clarify the biological functions of miR‐494‐3p in BC, miR‐494‐3p expression in six cell lines of BC (5637, SW780, UM‐UC‐3, RT4, T24, and J82) were investigated. miR‐494‐3p expression was found to be higher in BC cells in comparison with SV‐HUC‐1 cells, which belong to immortalized human bladder epithelial cells (Figure 1A). miR‐494‐3p level decreased in both 5637 and T24 cells by miR‐494‐3p inhibitor transfection and were upregulated by miR‐494‐3p mimic transfection (Figure 1B). The results from the MTT, wound healing, and transwell experiments showed that cell proliferation, migration, and invasion abilities were strikingly stimulated in cells overexpressing miR‐494‐3p and markedly impaired in cells when miR‐494‐3p was knocked down (Figure 1C–F). These consequences clarified that miR‐494‐3p expression was risen and could promote the growth of BC cells.
FIGURE 1.
miR‐494‐3p silencing impeded the proliferation, migration and invasion of BC cells. (A) RT‐qPCR for measurement of the miR‐494‐3p level in SV‐HUC‐1 and BC cells. The 5637 and T24 cells went through miR‐494‐3p mimic/inhibitor transfection. (B) RT‐qPCR for evaluation of the miR‐494‐3p expression. (C) MTT assay for detection of the cell proliferation. (D–F) Wound healing and transwell assays for assessment of the cell migration and invasion. Scale bar: 100 μm. *p < 0.05, **p < 0.01, and ***p < 0.001
3.2. miR‐494‐3p directly targeted KLF9
To substantiate the relationship between miR‐494‐3p and KLF9, we noticed that the mRNA and protein expression of KLF9 significantly declined in BC cells (Figure 2A,B). The Starbase website predicted that there is a binding site between miR‐494‐3p and KLF9 (Figure 2C). Moreover, the miR‐494‐3p mimic repressed the luciferase activity in the KLF9‐WT group, whereas the KLF9‐MUT group was found to have no impact on luciferase activity (Figure 2D). Meanwhile, the miR‐494‐3p mimic could hinder both mRNA and protein expression of KLF9, whereas miR‐494‐3p absence could elevate its expression (Figure 2E,F). In total, miR‐494‐3p interplay with KLF9 and mediated its expression.
FIGURE 2.
miR‐494‐3p directly targeted KLF9. (A and B) RT‐qPCR and western blot for examination of the KLF9 mRNA and protein expression in SV‐HUC‐1 and BC cells. (C) Starbase for prediction of the binding site between miR‐494‐3p and KLF9. (D) Dual‐luciferase assay for validation of the combination between miR‐494‐3p and KLF9 in 293T cells. The 5637 and T24 cells suffered from miR‐494‐3p mimic/inhibitor transfection for culturing 48 h. (E and F) RT‐qPCR and western blot for investigation of the KLF9 mRNA and protein expression in SV‐HUC‐1 and BC cells. *p < 0.05, **p < 0.01, and ***p < 0.001
3.3. miR‐494‐3p strengthened cell growth of BC by regulating KLF9
To illustrate whether KLF9 affects miR‐494‐3p‐mediated functions in BC, 5637 and T24 cells were subjected to miR‐494‐3p inhibitor transfection alone or coupled with sh‐KLF9 transfection. The mRNA and protein levels of KLF9 were markedly enhanced by miR‐494‐3p silencing, and the promotion effects were counteracted in the group that co‐transfected with sh‐KLF9 (Figure 3A,B). miR‐494‐3p knockdown restrained the capacities of growth of BC cells, whereas KLF9 knockdown offset the suppression impacts of the miR‐494‐3p inhibitor on cell proliferation, migration, and invasion (Figure 3C–F). Therefore, miR‐494‐3p mediated with KLF9 and promoted the growth of BC cells.
FIGURE 3.
miR‐494‐3p strengthened cell growth of BC by regulating KLF9. The 5637 and T24 cells underwent miR NC, miR‐494‐3p inhibitor, miR‐494‐3p inhibitor + sh‐NC, and miR‐494‐3p inhibitor + sh‐KLF9 transfection. (A and B) RT‐qPCR and western blot for detection of the KLF9 mRNA and protein expressions. (C) MTT assay for evaluation of the cell proliferation. (D–F) Wound healing and transwell assays for examination of the cell migration and invasion. Scale bar: 100 μm. *p < 0.05, **p < 0.01, and ***p < 0.001
3.4. KLF9 directly binds to the RGS2 promoter and activates its transcription
RGS2 has been reported to be related to the development of BC. 17 We detected RGS2 expression in six cell lines of BC, and the outcomes displayed that RGS2 level was downregulated in BC cells (Figure 4A,B). KLF9 as a transcription factor has been found to combine with gene promoters to adjust gene expression and engage in disease progression. 19 The JASPAR database predicted a harbor binding site for KLF9 in the upstream promoter region of RGS2 (Figure 4C). Meanwhile, dual‐luciferase assay displayed that KLF9 overexpression could increase the luciferase activity in wild‐type RGS2 promoter, but it had no impact on mutant RGS2 promoter (Figure 4D). The data from the ChIP assay showed that anti‐KLF9 significantly precipitated the RGS2 promoter region compared with the anti‐IgG group, and RGS2 promoter region precipitation was more obvious when KLF9 was overexpressed (Figure 4E). These results indicated that KLF9 could interplay with the upstream promoter region of RGS2 to motivate RGS2 expression. Subsequently, 5637 and T24 cells were transfected with empty vector or OE‐KLF9. KLF9 mRNA and protein levels were upregulated when KLF9 was overexpressed. RGS2 levels were elevated by KLF9 overexpression, indicating that RGS2 was positively regulated by KLF9 (Figure 4F–H). Briefly, KLF9 could enhance RGS2 expression and directly combined with the promoter region of RGS2 in BC cells.
FIGURE 4.
KLF9 directly binds to the RGS2 promoter and activates its transcription. (A and B) RT‐qPCR and western blot for assessment of the RGS2 mRNA and protein expression in SV‐HUC‐1 and BC cells. (C–E) JASPAR database, dual‐luciferase, and ChIP assays for validation of the relationship between KLF9 and RGS2. Empty vector or OE‐KLF9 was transfected into 5637 and T24 cells. (F–H) RT‐qPCR and western blot for detection of the KLF9 and RGS2 mRNA as well as their protein expression. *p < 0.05, **p < 0.01, and ***p < 0.001
3.5. miR‐494‐3p promoted cell growth of BC by negatively regulating the KLF9/RGS2 axis
At first, we transfected 5637 and T24 cells with the miR‐494‐3p inhibitor or co‐transfected with the miR‐494‐3p inhibitor and sh‐RGS2, respectively, to reveal the effects of RGS2 on the miR‐494‐3p‐mediated biological impacts of BC. miR‐494‐3p inhibitor transfection declined miR‐494‐3p expression but raised KLF9 and RGS2 levels. The induced effect of miR‐494‐3p silencing on RGS2 was restrained after co‐transfection with sh‐RGS2, but miR‐494‐3p and KLF9 levels were not affected by RGS2 knockdown (Figure 5A–D). The results of a series of cell biology experiments showed that the miR‐494‐3p inhibitor hindered cell viability, proliferation, migration, and invasion. However, the inhibitory effects of the miR‐494‐3p inhibitor were antagonized by RGS2 knockdown (Figure 5E–H). Therefore, miR‐494‐3p could accelerate BC progression by mediating the KLF9/RGS2 axis.
FIGURE 5.
miR‐494‐3p promotes cell growth of BC by negatively regulating the KLF9/RGS2 axis. The 5637 and T24 cells went through miR NC, miR‐494‐3p inhibitor, miR‐494‐3p inhibitor + sh‐NC, and miR‐494‐3p inhibitor + sh‐RGS2 transfection. (A–C) RT‐qPCR for investigation of the miR‐494‐3p, KLF9, and RGS2 expression. (D) Western blot for assessment of the KLF9 and RGS2 expression. (E) MTT assay for evaluation of the cell proliferation. (F–H) Wound healing and transwell assays for detection of the cell migration and invasion. Scale bar: 100 μm. *p < 0.05, **p < 0.01, and ***p < 0.001
3.6. miR‐494‐3p inhibition suppressed tumor growth in vivo
To validate the promoting effects of miR‐494‐3p on tumor growth in vivo, we employed T24 cells transfected with anti‐miR‐NC or anti‐miR‐494‐3p to inject into nude mice subcutaneously. The study results showed that the expression of miR‐494‐3p was dramatically reduced in the anti‐miR‐494‐3p mice group compared to the anti‐miR‐NC mice group (Figure 6A). Anti‐miR‐494‐3p observably decreased tumor volume and weight compared to the anti‐miR‐NC mice group (Figure 6B–D). The expression of KLF9 and RGS2 was found to be increased by anti‐miR‐494‐3p as detected by western blot (Figure 6E). These results indicated that miR‐494‐3p inhibition suppressed the growth of tumor in vivo.
FIGURE 6.
miR‐494‐3p inhibition suppressed tumor growth in vivo. T24 cells with anti‐miR‐NC or anti‐miR‐494‐3p transfection were injected into nude mice subcutaneously. (A) RT‐qPCR for investigation of the miR‐494‐3p. (B) Tumor photographs. (C) Tumor volumes. (D) Tumor weight. (E) Western blot for assessment of the KLF9 and RGS2 expression. *p < 0.05, **p < 0.01, and ***p < 0.001
4. DISCUSSION
Muscle‐invasive BC with the characteristics of strong invasion ability seriously threatens human life. 5 Muscle‐invasive BC accounts for approximately 25% of newly diagnosed cases of BC. 20 With the progress of BC, even after surgical treatment of nonmuscle‐invasive BC, a small number of patients inevitably suffer from recurrence and metastasis. 4 Thus, more treatments are urgently needed to overcome BC metastasis and the aggressive type of BC. In recent years, the significance of miRNA in BC has been increasingly studied. It was found that miR‐1290 and miR‐516a could accelerate BC cell proliferation, migration, and invasion and could impede apoptosis, 21 , 22 suggesting that the role of miRNA in BC and its mechanism are extremely important. Here we observed that miR‐494‐3p level was aberrantly enhanced in BC cells. Moreover, miR‐494‐3p knockdown suppressed BC growth in vitro and in vivo. On the basis of the analysis of other experimental results, miR‐494‐3p may affect BC progression by regulating the KLF9/RGS2 axis.
Research on miRNA is involved in almost all disease types. Growing evidence has demonstrated that miR‐494‐3p plays pivotal roles in multiple cancers combining with diversified targets of proteins. For instance, miR‐494‐3p suppressed PTEN to promote nonsmall cell lung cancer. 23 Moreover, miR‐494 could silence PTEN and could activate the migration, invasion, and proliferation of BC cells. 24 miRNA usually possesses the capacity of binding multiple target genes. 25 In mammalian cells, it is universally acknowledged that miRNAs are at least partially complementary to the 3′‐UTR of the target mRNA molecule to mediate the target gene expression at the posttranscriptional level. 26 KLF9 belongs to the KLF transcriptional factor family, and it was reported to participate in the progression of ovarian cancer and BC. 27 , 28 Yang et al. reported that KLF9 had lower expression in BC and was a targeted gene of miR‐17‐5p. 28 In this study, we found that in BC cells, KLF9 expression was reduced consistently. We first unearthed that miR‐494‐3p interacted with the site in the 3′‐UTR of KLF9 to silence KLF9 expression. Furthermore, we discovered for the first time that miR‐494‐3p was equipped to facilitate the growth of BC by reducing the KLF9 level in vitro and in vivo.
RGS2 is one of the most studied members of the RGS family. Accumulating evidence has confirmed that RGS2 could regulate tumor growth, proliferation, migration, and invasion. 29 , 30 As previously reported, RGS2 played a beneficial role in BC. 17 , 18 This study results showed that RGS2 was aberrantly low expression of BC cells. Occasionally, it was noticed that in the JASPAR database, KLF9 could bind to the promoter region of RGS2. The overexpression of KLF9 enhanced the RGS2 level. Moreover, dual‐luciferase reporter assay and ChIP assay verified that KLF9 could directly interact with the promoter region of RGS2 and could activate the expression of RGS2. Finally, it was confirmed that KLF9 could directly interact with the RGS2 promoter to elevate RGS2 expression, thereby inhibiting the growth of BC cells.
These study findings elucidated miR‐494‐3p expression and its impacts on the biological functions of BC. The outcomes of the study showed that miR‐494‐3p motivated the growth of BC in vitro and in vivo by downregulating the KLF9/RGS2 axis, which suggested that the miR‐494‐3p/KLF9/RGS2 axis may become markers or therapeutic targets for BC. However, this study lacks results from clinical samples. Therefore, in near future, we will collect clinical samples from BC patients to verify the expression of miR‐494‐3p, KLF9, and RGS2 in BC, which will provide more comprehensive evidence.
CONFLICT OF INTEREST
The authors declare no conflict of interest.
Supporting information
FIGURE S1 The knockdown efficiency of KLF9 and RGS2. (A) RT‐qPCR for detection of KLF9 the expression in T24 cells with sh‐NC, sh‐KLF9‐1, sh‐KLF9‐2, and sh‐KLF9‐3 transfection. (B) RT‐qPCR for detection of the RGS2 expression in T24 cells with sh‐NC, sh‐RGS2‐1, sh‐RGS2‐2, and sh‐RGS2‐3 transfection. *p < 0.05, **p < 0.01, and ***p < 0.001
ACKNOWLEDGMENT
We would like to give our sincere gratitude to the reviewers for their constructive comments.
Xu X‐H, Sun J‐M, Chen X‐F, Zeng X‐Y, Zhou H‐Z. MicroRNA‐494‐3p facilitates the progression of bladder cancer by mediating the KLF9/RGS2 axis. Kaohsiung J Med Sci. 2022;38(11):1070–1079. 10.1002/kjm2.12588
REFERENCES
- 1. Shariat SF, Sfakianos JP, Droller MJ, Karakiewicz PI, Meryn S, Bochner BH. The effect of age and gender on bladder cancer: a critical review of the literature. BJU Int. 2010;105(3):300–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Dobruch J, Daneshmand S, Fisch M, Lotan Y, Noon AP, Resnick MJ, et al. Gender and bladder cancer: a collaborative review of etiology, biology, and outcomes. Eur Urol. 2016;69(2):300–10. [DOI] [PubMed] [Google Scholar]
- 3. Wirth M, Plattner VE, Gabor F. Strategies to improve drug delivery in bladder cancer therapy. Expert Opin Drug Deliv. 2009;6(7):727–44. [DOI] [PubMed] [Google Scholar]
- 4. Oliveira PA, Arantes‐Rodrigues R, Vasconcelos‐Nóbrega C. Animal models of urinary bladder cancer and their application to novel drug discovery. Expert Opin Drug Discov. 2014;9(5):485–503. [DOI] [PubMed] [Google Scholar]
- 5. Lobo N, Mount C, Omar K, Nair R, Thurairaja R, Khan MS. Landmarks in the treatment of muscle‐invasive bladder cancer. Nat Rev Urol. 2017;14(9):565–74. [DOI] [PubMed] [Google Scholar]
- 6. Nadal R, Bellmunt J. Management of metastatic bladder cancer. Cancer Treat Rev. 2019;76:10–21. [DOI] [PubMed] [Google Scholar]
- 7. Hammouz RY, Kołat D, Kałuzińska Ż, Płuciennik E, Bednarek AK. MicroRNAs: their role in metastasis, angiogenesis, and the potential for biomarker utility in bladder carcinomas. Cancers (Basel). 2021;13(4):891. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Liu B, Li J, Cairns MJ. Identifying miRNAs, targets and functions. Brief Bioinform. 2014;15(1):1–19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Zhang Q, Hao L, Shen Z, Wang F, Han C. MiR‐186‐5p suppresses cell migration, invasion, and epithelial mesenchymal transition in bladder cancer by targeting RAB27A/B. Environ Toxicol. 2021;36(11):2174–85. [DOI] [PubMed] [Google Scholar]
- 10. Shan G, Tang T, Xia Y, Qian HJ. MEG3 interacted with miR‐494 to repress bladder cancer progression through targeting PTEN. J Cell Physiol. 2020;235(2):1120–8. [DOI] [PubMed] [Google Scholar]
- 11. Bai X, Jiang X, Liu Y, Wang Y, Jiang X, Song G, et al. Krüppel‐like factor 9 upregulates E‐cadherin transcription and represses breast cancer invasion and metastasis. Am J Cancer Res. 2021;11(7):3660–73. [PMC free article] [PubMed] [Google Scholar]
- 12. Simmen RC, Pabona JM, Velarde MC, Simmons C, Rahal O, Simmen FA. The emerging role of Krüppel‐like factors in endocrine‐responsive cancers of female reproductive tissues. J Endocrinol. 2010;204(3):223–31. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. He Q, Huang L, Yan D, Bi J, Yang M, Huang J, et al. CircPTPRA acts as a tumor suppressor in bladder cancer by sponging miR‐636 and upregulating KLF9. Aging (Albany, NY). 2019;11(23):11314–28. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Tan H, Huang S, Zhang Z, Qian X, Sun P, Zhou X. Pan‐cancer analysis on microRNA‐associated gene activation. EBioMedicine. 2019;43:82–97. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Cho J, Min HY, Lee HJ, Hyun SY, Sim JY, Noh M, et al. RGS2‐mediated translational control mediates cancer cell dormancy and tumor relapse. J Clin Invest. 2021;131(1):e136779. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Yang T, Wang P, Yin X, Zhang J, Huo M, Gao J, et al. The histone deacetylase inhibitor PCI‐24781 impairs calcium influx and inhibits proliferation and metastasis in breast cancer. Theranostics. 2021;11(5):2058–76. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Deng M, Wei W, Duan J, Chen R, Wang N, He L, et al. ZHX3 promotes the progression of urothelial carcinoma of the bladder via repressing of RGS2 and is a novel substrate of TRIM21. Cancer Sci. 2021;112(5):1758–71. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Ying L, Lin J, Qiu F, Cao M, Chen H, Liu Z, et al. Epigenetic repression of regulator of G‐protein signaling 2 by ubiquitin‐like with PHD and ring‐finger domain 1 promotes bladder cancer progression. FEBS J. 2015;282(1):174–82. [DOI] [PubMed] [Google Scholar]
- 19. Ma L, Li Z, Li W, Ai J, Chen X. MicroRNA‐142‐3p suppresses endometriosis by regulating KLF9‐mediated autophagy in vitro and in vivo. RNA Biol. 2019;16(12):1733–48. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Kaufman DS, Shipley WU, Feldman AS. Bladder cancer. Lancet. 2009;374(9685):239–49. [DOI] [PubMed] [Google Scholar]
- 21. Chang Y, Jin H, Li H, Ma J, Zheng Z, Sun B, et al. MiRNA‐516a promotes bladder cancer metastasis by inhibiting MMP9 protein degradation via the AKT/FOXO3A/SMURF1 axis. Clin Transl Med. 2020;10(8):e263. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Wang J, Luo J, Wu X, Gao Z. Circular RNA_0000629 suppresses bladder cancer progression mediating microRNA‐1290/CDC73. Cancer Manag Res. 2021;13:2701–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Wu C, Yang J, Li R, Lin X, Wu J, Wu J. LncRNA WT1‐AS/miR‐494‐3p regulates cell proliferation, apoptosis, migration and invasion via PTEN/PI3K/AKT signaling pathway in non‐small cell lung cancer. Onco Targets Ther. 2021;14:891–904. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- 24. Lu Q, Liu T, Feng H, Yang R, Zhao X, Chen W, et al. Circular RNA circSLC8A1 acts as a sponge of miR‐130b/miR‐494 in suppressing bladder cancer progression via regulating PTEN. Mol Cancer. 2019;18(1):111. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Inoue J, Inazawa J. Cancer‐associated miRNAs and their therapeutic potential. J Hum Genet. 2021;66(9):937–45. [DOI] [PubMed] [Google Scholar]
- 26. Loras A, Segovia C, Ruiz‐Cerdá JL. Epigenomic and metabolomic integration reveals dynamic metabolic regulation in bladder cancer. Cancers (Basel). 2021;13(11):2719. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Shan L, Song P, Zhao Y, An N, Xia Y, Qi Y, et al. miR‐600 promotes ovarian cancer cells stemness, proliferation and metastasis via targeting KLF9. J Ovarian Res. 2022;15(1):52. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Yang X, Wei X, Yi C, Yang Y, Fang Z, Dai Y, et al. Long noncoding RNA HAND2‐AS1 suppresses cell proliferation, migration, and invasion of bladder cancer via miR‐17‐5p/KLF9 Axis. DNA Cell Biol. 2022;41(2):179–89. [DOI] [PubMed] [Google Scholar]
- 29. Luessen DJ, Hinshaw TP, Sun H, Howlett AC, Marrs G, McCool BA, et al. RGS2 modulates the activity and internalization of dopamine D2 receptors in neuroblastoma N2A cells. Neuropharmacology. 2016;110(Pt A):297–307. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Linder A, Larsson K, Welén K, Damber JE. RGS2 is prognostic for development of castration resistance and cancer‐specific survival in castration‐resistant prostate cancer. Prostate. 2020;80(11):799–810. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
FIGURE S1 The knockdown efficiency of KLF9 and RGS2. (A) RT‐qPCR for detection of KLF9 the expression in T24 cells with sh‐NC, sh‐KLF9‐1, sh‐KLF9‐2, and sh‐KLF9‐3 transfection. (B) RT‐qPCR for detection of the RGS2 expression in T24 cells with sh‐NC, sh‐RGS2‐1, sh‐RGS2‐2, and sh‐RGS2‐3 transfection. *p < 0.05, **p < 0.01, and ***p < 0.001