Abstract
Transforming growth factor‐β1 (TGF‐β1) is one of critical cytokines in radiation‐induced liver injury. Hepatic stellate cells (HSC) are activated in the early stage of radiation‐induced liver injury. However, it is currently unclear whether phosphatidylinositol 3‐kinase (PI3K/Akt) signal pathway is activated in radiation‐induced liver injury. Herein, male Sprague‐Dawley rats were irradiated with 6 MV X‐rays (30 Gy) on the right liver. Next, Hematoxylin and eosin staining, Masson staining, and electron microscopy were performed to examine pathological changes. Immunohistochemistry was performed to assess the expression of TGF‐β1, α‐SMA, and p‐Akt (S473) in liver tissues. In vitro, rat HSC cell line HSC‐T6 cells were given different doses of 6 MV X‐ray irradiation (10 and 20 Gy) and treated with LY294002. The expression of α‐SMA and p‐Akt in mRNA and protein levels were measured by reverse transcription‐polymerase chain reactioin (RT‐PCR) and Western blot. TGF‐β1 expression was detected by enzyme‐linked immuno sorbent assay (ELISA). After irradiation, the liver tissues showed obvious pathological changes, indicating the establishment of the radiation‐induced liver injury. Expression levels of TGF‐β1, α‐SMA, and p‐Akt (S473) protein in liver tissues were significantly increased after irradiation, and this increase was in a time‐dependent manner, suggesting the activation of HSC and PI3K/Akt signal pathway. in vitro experiments showed that the TGF‐β1 secreted by HSCs, and the expression of Akt and α‐SMA at mRNA and protein levels were significantly increased in irradiation groups. However, the expression of TGF‐β1, Akt, and α‐SMA were significantly decreased in PI3K/Akt signal pathway inhibitor LY294002‐treated group. Our results suggest that during radiation‐induced liver injury, HSCs are activated by TGF‐β1‐mediated PI3K/Akt signal pathway.
Keywords: hepatic stellate cells, PI3K/Akt pathway, radiation‐induced liver injury, TGF‐β1
1. INTRODUCTION
Hepatocellular carcinoma is featured with the third highest death rate globally and its incidence ranks the sixth among malignant tumors. 1 Due to the development of precise radiation therapies, including intensity‐modulated radiation therapy and stereotactic body radiation therapy, radiotherapy is playing an increasingly important role as a noninvasive treatment for hepatocellular carcinoma. 2 , 3 , 4 , 5
However, severe radiation‐induced liver injury is the most serious life‐threatening complication during liver cancer radiotherapy. 6 The liver function deteriorates rapidly when radiation‐induced liver injury occurs. The molecular mechanism of radiation‐induced liver injury remains unknown and no effective treatment is available. 7
Radiation‐induced liver injury ultimately leads to liver fibrosis. 8 Hepatic stellate cell (HSC) activation is the central link of liver fibrosis. 9 Transforming growth factor‐β1 (TGF‐β1) is a critical cytokine in the development of liver fibrosis. 10 In tissues with delayed radiation‐induced liver fibrosis, TGF‐β1 is significantly upregulated and its expression is closely related to the extent of radiation‐induced liver fibrosis. 11 , 12 However, the specific mechanism through which TGF‐β1 is involved in radiation‐induced liver injury and the relationship between radiation‐induced liver injury and HSC activation are still unknown.
Our previous study suggests that TGF‐β exerts biological effects by activating the TGF‐β/smad signaling pathway. 9 TGF‐β1 also activates other pathways, such as phosphatidylinositol 3‐kinase (PI3K/Akt signaling), to exert biological effects. 10 , 11 , 12
In this study, to fully understand the mechanism of radiation‐induced liver injury, we mainly focused on the role of PI3K/Akt signaling pathway in HSC activation during radiation‐induced liver injury by in vivo and in vitro experiments. We identified that X‐ray irradiation led to HSC activation and apoptosis by activating the PI3K/Akt signaling pathway, in which TGF‐β1 played an important role. Our findings may provide potential molecular intervention targets for the prevention and treatment of radiation‐induced liver injury.
2. MATERIALS AND METHODS
2.1. Cell culture
Rat liver HSC‐T6 cells were purchased from Nanjing K.G.I. Company (Jiangsu, China). Cells were cultured in Dulbecco's modified Eagle's medium (high glucose) supplemented with 10% fetal bovine serum, and incubated at 37°C in a humidified atmosphere (5% CO2).
2.2. Cells radiation and inhibitor treatment
Cells were irradiated with different doses of X‐rays using a Varian Clinac CX accelerator (Varian Medical Systems, Inc., Palo Alto, California) at a dose rate of 3 Gy/min. The one‐time total dose of irradiation was 10 and 20 Gy. Cells were divided into the following groups: control group (no irradiation, no inhibitor), LY294002 group (20 μmol/L LY294002 only), 10 Gy group (10 Gy irradiation), 10 Gy + LY294002 group (10 Gy irradiation +20 μmol/L LY294002), 20 Gy group (20 Gy irradiation), and 20 Gy + LY294002 group (20 Gy irradiation+20 μmol/L LY294002). Cells were harvested for 48 hours after irradiation or LY294002 treatment. LY294002 was from Sigma and was added before irradiation.
2.3. ELISA
The culture supernatant was collected and centrifuged at 1000g for 20 minutes. TGF‐β1 level was detected with TGF‐β1 enzyme‐linked immuno sorbent assay (ELISA) kit (R&D, Minnesota). Briefly, 100 μL of TGF‐β1 standard or sample was added to 96‐well flat‐bottom microplates, respectively. The plates were incubated for 90 minutes at 37°C. After discarding the supernatant, 100 μL of monoclonal anti‐goat IgG‐peroxidase was added and incubated for 1 hour at 37°C. After washing, 100 μL of enzyme‐conjugated working fluid was added and incubated for 30 minutes at 37°C. For color development, 90 μL of 1‐Step Ultra TMB‐ELISA substrate (34 028, Thermo Scientific) was added and incubated for 15 minutes at 37°C. The reaction was stopped by 50 μL of termination solution. Eventually, absorbance at 450 nm was read using a microplate reader (Bio‐Rad Model 680 microplate reader, Bio‐Rad, Hercules, California).
2.4. RT‐PCR
Trizol reagent (Roche Diagnostics, Basel, Switzerland) was used to extract the total RNA of HSC‐T6 cells. Reverse transcription‐polymerase chain reactioin (RT‐PCR) was performed using RT‐PCR kit (Sangong Biotech Co., Ltd, Shanghai, China.). The primers used were as follows:
β‐actin forward 5′‐TAAGGCCAACCGTGAAAAGATG‐3′, reverse 5′‐AGAGGCATACAGGGACAACACA‐3′; Akt forward 5′‐ATGGACTTCCGGTCAGGTTCA‐3′, reverse 5′‐GCCCTTGCCCAGTAGCTTCA‐3′; and α‐SMA forward 5′‐ATCCTGACCCTGAAGTATCCGATA‐3′, reverse 5′‐CCACGCGAAGCTCGTTATAGA‐3′.
The PCR procedure was performed at 95°C for 5 minutes, 40 cycles of 95°C for 30 seconds, 55°C for 30 seconds, and 65°C for 30 seconds, and final extension at 65°C for 10 minutes. The relative expression was determined using the 2−△△CT method and data were normalized for Akt and α‐SMA levels. β‐actin was used as loading control. The experiment was repeated three times.
2.5. Western blot
Total proteins were extracted from HSC‐T6 cells using RIPA lysis buffer (Thermo Fisher Scientific, Inc., Rockford, Illinois) containing 1% protease inhibitor cocktail and 1% PhosSTOP (Roche, Basel, Switzerland). Protein concentration was assayed using the bicinchoninic acid protein assay kit (Thermo Fisher Scientific, Inc.). The proteins were fractionated by 10% sodium dodecyl sulfate‐polyacrylamide gel electrophoresis and transferred onto polyvinylidene fluoride membranes (Roche Diagnostics). After blocking with 5% nonfat milk for 1 hour at room temperature, the following primary antibodies of anti‐p‐Akt antibody (1:5000) (Thermo Fisher Scientific, Inc.), anti‐α‐SMA antibody (1:2000) (cell signaling), and anti‐β‐actin antibody (1:1000) (Boster Co., Ltd.) were added and incubated at 4°C overnight. Thereafter, the membrane was incubated with secondary antibody (1:10 000) (cell signaling) for 2 hours at room temperature. The protein bands were detected using a chemiluminescence detection system (WesternBreeze; Invitrogen Life Technologies, Carlsbad, California) and autoradiography film (Biomax XAR film; Kodak, Shenzhen, China). The experiment was repeated three times.
2.6. Animals
Male Sprague‐Dawley rats (6 weeksold, weighing 220 ± 10 g, n = 48) were purchased from Experimental Animal Center of Xinjiang Medical University. They were maintained in a 12 hours light‐dark cycle at a constant temperature and humidity. The laboratory animals were cared and used based on the Guidelines and Regulations for the Use and Care of Animals, which was provided by the Ministry of Science and Technology of the People's Republic of China. All experiments were conducted in accordance with the Principles of Laboratory Animal Care (NIH publication No. 85‐23, revised 1985), the Office for Protection from Research Risks Public Health Service Policy on the Humane Care and Use of Laboratory Animals (revised 1986) and the US Animal Welfare Act. The experimental procedures were approved by the ethics committee of Xinjiang Medical University (approval no. XJZZQ (XK) 200301).
2.7. Radiation‐induced liver injury model
Rats were divided into model group and control group randomly (24 rats in each group). The rats were anesthetized by intraperitoneal injection of anesthetics (75 mg/100 g; 2 mL of ketamine injection, 1 mL of diazepam injection, and 2 mL of atropine injection were mixed and diluted into 10 mL; Jiangsu Henrui Medicine Co., Ltd, Lianyungang, China). A Varian Clinac CX accelerator (Varian Medical Systems, Inc., Palo Alto, California) was used to irradiate the rats with 6 MV photons at a dose of 30 Gy, 300 cGy/min in one fraction to the right upper quadrant of the abdomen (2 × 2 cm). At 3, 5, and 10 days after irradiation, respectively, the rats were sacrificed by cervical dislocation. At each time point, six rats in model group and control group were sacrificed and the liver tissues and blood samples were collected for analysis. The weights of the rats were monitored at each time point.
2.8. Electron microscope observation
The liver tissues were fixed in 2.5% glutaric dialdehyde for 24 hours. After rinsing, the tissues were subjected to incubation with 2% osmium tetroxide for 2 hours. After dehydration with graded acetone, tissues were incubated in acetone/resin (1:1) at 37°C for 24 hours, embedded in Epon, polymerized in a 60°C oven for 24 hours, and cut into semi‐thin sections (1 μm). Then semi‐thin sections were cut into untra‐thin sections (500 Å) by a LKB III ultramicrotome (LKB, Bromma, Sweden), which were then stained with lead nitrate uranyl acetate and observed under a transmission electron microscope H7500 (Hitachi, Tokyo, Japan).
2.9. Blood biochemical analysis
The serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), total bilirubin (TB), and direct bilirubin (DB) were measured on COBAS 400 Automatic Biochemical Analyzer (Roche) to assess liver function (Table 1).
TABLE 1.
Changes of serum AST, ALT, ALP, TB, and DB after 30 Gy irradiation (μmol/L)
| Group | n | AST | ALT | ALP | TB | DB |
|---|---|---|---|---|---|---|
| Control | 6 | 37.93 ± 1.66 | 30.00 ± 3.85 | 74.00 ± 2.36 | 1.41 ± 0.55 | 0.10 ± 0.05 |
| 3 days | 6 | 106.06 ± 2.95 a | 59.23 ± 9.34 a | 180.33 ± 36.02 a | 3.30 ± 0.56 a | 1.96 ± 0.80 a |
| 5 days | 6 | 179.50 ± 67.18 a , b | 75.76 ± 11.95 a , b | 294.33 ± 63.28 a , b | 5.20 ± 0.45 a , b | 4.30 ± 0.87 a , b |
| 10 days | 6 | 270.30 ± 20.57 a , b , c | 93.63 ± 4.85 a , b , c | 451.46 ± 83.84 a , b , c | 8.03 ± 1.75 a , b , c | 6.20 ± 1.15 a , b , c |
Abbreviations: ALP, alkaline phosphatase; ALT, alanine aminotransferase; AST, aspartate aminotransferase; DB, direct bilirubin; TB, total bilirubin.
Compared with the control group, P < .05.
Compared with the 3 days group, P < .05.
Compared with the 5 days group, P < .05.
2.10. Histological analysis
Hematoxylin and eosin (H&E; Tianjing Zhiyuan Chemical Agents Co., Ltd, Tianjing, China) and Masson's trichrome (cat. no. MST‐8003/8004; Maixin Biotech Co., Ltd., Fuzhou, China) staining was used to demonstrate the level of liver fibrosis. The extent of liver fibrosis and the histological features were assessed by two pathologists in a blinded‐manner.
2.11. Immunohistochemistry
After antigen retrieval and blocking, the liver tissue sections were incubated with the primary antibodies against TGF‐β1, α‐SMA, and p‐Akt (S473) at 4°C overnight. They were all purchased from Boster Co., Ltd (Wuhan, China). Thereafter, the tissues were incubated with secondary antibodies (cat. no. PV‐6001/6002; ZSGB‐BIO, Beijing, China). DAB (cat. no. ZLI‐9017/9018/9019; ZSGB‐BIO) was then used for color development. After counterstaining with hematoxylin, images were captured using a Leica DM300 microscope and Leica Application Suite V3. 35.0 (Leica, Mannheim, Germany). The Image‐Pro plus software (Media Cybernetics, Bethesda, Maryland) was used to quantify the positive staining areas.
2.12. Statistical analysis
All statistical analyses were carried out using SPSS version 11.5. Data were expressed as mean ± SD. The student t test was used for comparison between two independent groups. Differences among various groups were tested with ANOVA followed by Dunnett's post hoc test. Chi‐square test was used for analyzing enumeration data. Linear regression analysis was used for correlation analysis. P < .05 was considered to indicate a statistically significant difference.
3. RESULTS
3.1. The rat radiation‐induced liver injury model is established successfully
H&E staining, Masson staining, and electron microscope observation were performed to observe the morphological changes. In our pilot experiment, we found that after 10 and 20 Gy irradiation, the pathological changes were not obvious (Figure S1) and the biochemical results of liver function were not significant, compared to control (Table S1,S2). Thus, single irradiation of 10 and 20 Gy cannot establish a stable model of radiation‐induced liver injury. In this study, we used a single irradiation of 30 Gy to induce liver injury in vivo. H&E staining showed that at day 3, 5, and 10 after 30 Gy irradiation, hepatic lobule gradually formed fibrous septa and the hyperplastic liver fibrous tissues were featured with expanded interval range and widened hepatic portal area gradually (Figure 1). Masson staining found that, with the extension of time, the portal areas and the proliferation of intercellular collagen fibers was increased. Electron microscope observation showed that at day 3 and day 5 after irradiation, there was mild edema of the hepatic vascular endothelial cells and the cells were unevenly arranged. There were large vesicular structures in liver cells. At day 10 after irradiation, hyperplasia of fat‐storing cells was observed in the interstitial space.
FIGURE 1.
Morphological changes of liver after 30 Gy irradiation. H&E staining, Masson staining, and electron microscope observation were used to observe the morphological changes of liver tissues. Representative images are shown. H&E, hematoxylin and eosin
In addition, the concentrations of liver function indexes AST, ALT, ALP, TB, and DB in serum were increased with the extension of time and significantly different from control group (Table 2).
TABLE 2.
Relative expression of TGF‐β1, α‐SMA, and p‐Akt (S473)
| Group | n | TGF‐β1 | α‐SMA | p‐Akt (S473) |
|---|---|---|---|---|
| Control | 10 | 0.0000 ± 0.0000 | 0.0000 ± 0.0000 | 0.0000 ± 0.0000 |
| 3 days | 10 | 0.0101 ± 0.0003 a | 0.0104 ± 0.0001 a | 0.0164 ± 0.0053 a |
| 5 days | 10 | 0.0367 ± 0.0035 a , b | 0.0467 ± 0.0066 a , b | 0.0434 ± 0.0080 a , b |
| 10 days | 10 | 0.0825 ± 0.0095 a , b , c | 0.0891 ± 0.0038 a , b , c | 0.0758 ± 0.0107 a , b , c |
Abbreviation: TGF‐β1, transforming growth factor‐β1.
Compared with control group, P < .05.
Compared with 3 days group, P < .05.
Compared with 5 days group, P < .05.
The above results indicate that the rat radiation‐induced liver injury model is established successfully.
3.2. The expressions of TGF‐β1, α‐SMA, and p‐Akt (S473) are increased in radiation‐induced injured liver tissues
To detect the expression of TGF‐β1, α‐SMA, and p‐Akt (S473) in the injured liver tissues, immunohistochemical staining was performed. As shown in Figure 2, the expressions of TGF‐β1, α‐SMA, and p‐Akt (S473) increased with the extension of time. We found that TGF‐β1 was expressed mainly in central vein and portal area and α‐SMA and p‐Akt (S473) were mainly positive around the central vein cells. The p‐Akt (S473) was also expressed in vascular endothelial cells, portal fibroblasts, and fiber spacer. Subsequently, we used the Image‐Pro plus software to quantitatively analyze the immunohistochemical staining results. We found that the relative expression levels of TGF‐β1, α‐SMA, and p‐Akt (S473) after radiation were significantly higher than those in control group (P < .05) (Table 2). Additionally, their levels significantly increased with the extension of time. Their peak levels were observed at 10 days after radiation.
FIGURE 2.
Analysis of TGF‐β1, α‐SMA, and p‐Akt (S473) protein expression after 30 Gy irradiation. Immunohistochemical staining was performed to analyze TGF‐β1, α‐SMA, and p‐Akt (S473) protein expression in liver tissues. Positive expression was stained brown. TGF‐β1, transforming growth factor‐β1
3.3. HSCs are activated by X‐ray via PI3K/Akt signaling pathway
The α‐SMA has been used as a marker for HSC activation. 13 In our pilot experiment, we found that after 30 Gy irradiation, some cells were died. Additionally, the changes of α‐SMA and p‐Akt mRNA levels were not as obvious as that at 10 and 20 Gy irradiation (Figure S2). Thus, we used 10 and 20 Gy irradiation for in vitro experiments. In order to demonstrate that HSCs were activated by X‐ray, the expression levels of α‐SMA and p‐Akt in each group were detected by RT‐PCR and Western blot in HSC‐T6 cells after 10 and 20 Gy irradiation with or without LY294002 treatment. As shown in Figure 3A,B, the expression of α‐SMA in LY294002 group had no statistical significance (P > .05) compared with the control group, but increased in the 10 Gy group (P < .05). It was worthy to note that PI3K/Akt pathway inhibitor LY294002 could inhibit the expression of α‐SMA in 10 Gy + LY294002 group (P < .05) as well as in 20 Gy + LY294002 group (P < .05) (Figure 3). Furthermore, Akt mRNA and p‐Akt protein expression were also increased in 10 Gy and 20 Gy groups (P < .05) and inhibited by LY294002 markedly (P < .05) (Figure 3C,D). Therefore, X‐ray may activate HSCs via PI3K/Akt pathway.
FIGURE 3.
Analysis of α‐SMA and Akt (p‐Akt) expression after 10 and 20 Gy irradiation. RT‐qPCR and Western blot were used to detect the mRNA and protein expression of α‐SMA and Akt (p‐Akt). A, α‐SMA mRNA expression in each group. B, α‐SMA protein expression in each group. C, Akt mRNA expression in each group. D, p‐Akt protein expression in each group. *P < 0.05
3.4. TGF‐β1 expression increase in injured stellate cells is related with the PI3K/Akt signaling pathway
In order to further understand the relationship between TGF‐β1 and PI3K/Akt signaling pathway, we detected the concentration of TGF‐β1 in different groups of HSC‐T6 cells by ELISA. The expression of TGF‐β1 in irradiated groups (10 and 20 Gy) was significantly increased compared with control group, but decreased after LY294002 treatment (Table 3) (P < .05). This result indicates that the TGF‐β1 expression increased in irradiated HSCs is associated with the PI3K/Akt signaling pathway.
TABLE 3.
Comparison of the concentration of TGF‐β1 in the supernatant of each group
| Group | TGF‐β1(ng/mL) |
|---|---|
| Control | 4.600 ± 0.188 |
| Ly294002 | 5.194 ± 0.594 |
| 10Gy | 7.385 ± 0.152 a |
| 10 Gy + LY294002 | 5.121 ± 0.334 b |
| 20Gy | 8.635 ± 0.098 a |
| 20 Gy + LY294002 | 7.556 ± 0.044 c |
Abbreviation: TGF‐β1, transforming growth factor‐β1.
Compared with control group, P < .05.
Compared with 10 Gy group, P < .05.
Compared with 20 Gy group, P < .05.
4. DISCUSSION
Nonparenchymal cells, including HSCs, liver sinusoidal endothelial cells, Kupffer cells, and biliary epithelial cells, 14 play important roles during radiation‐induced liver injury and fibrosis. 15 , 16 These cells secrete a variety of cytokines that is involved in liver injury and repair, wherein HSC activation is the main link to hepatic fibrosis. 17 Therefore, we hypothesize that a similar mechanism might be involved in radiation‐induced liver injury.
HSC activation is a complex process that involves many cytokines, wherein TGF‐β plays a critical role. 18 TGF‐β, with complex biological functions, is mainly involved in the regulation of cell differentiation, proliferation, and apoptosis and the formation of the extracellular matrix. It is currently known to be the most potent pro‐fibrosis cytokine. 19 Numerous studies have shown that TGF‐β plays an important role in radiation‐induced liver fibrosis and inhibition of its secretion could inhibit the activation of HSCs. 8 , 20 , 21 Furthermore, Zong et al showed that inhibition of TGF‐β significantly reduced radiation‐induced liver injury. 22 Hence, studies on the specific mechanisms of TGF‐β‐mediated HSC activation after radiation‐induced liver injury may facilitate the research on potential molecular intervention targets and provide the necessary theoretical support for the prevention and treatment of radiation‐induced liver injury.
Previous studies suggest that TGF‐β increases extracellular matrix secretion in liver cells and collagen synthesis by activating the TGF‐β/Smad signaling pathway in HSCs, ultimately leading to liver fibrosis. 23 , 24 , 25 However, recent studies have shown that in addition to activating the Smad signaling pathway, TGF‐β also activates other pathways including PI3K/Akt, NF‐κB, Wnt/β‐catenin, and mitogen‐activated protein kinase pathways. 26 , 27 , 28 , 29 Our study showed that during single high‐dose radiation‐induced liver injury, TGF‐β expression was significantly increased and continued to increase overtime. Moreover, after radiation‐induced liver injury, the expression of p‐Akt (S473), a phosphorylated molecule in the PI3K/Akt signaling pathway, was significantly increased in the early stage, suggesting that radiation‐induced liver injury might increase p‐Akt (S473) expression by increasing TGF‐β secretion, which activates the PI3K/Akt signaling pathway in turn.
Inhibition of the PI3K/Akt signaling pathway can effectively inhibit the proliferation of HSCs. 30 For example, LY294002 or rapamycin significantly inhibited the proliferation of HSCs mediated by the platelet‐derived growth factor/PI3K/Akt signaling pathway. 31 In this study, HSCs were irradiated with different doses of 6 MV X‐rays (0, 10, and 20 Gy) and treated with LY294002. The expression levels of TGF‐β1, α‐SMA, and p‐Akt were higher in the radiation groups than in the control group, whereas LY294002 reduced the expression levels. Taken together, these results suggest that X‐ray irradiation leads to HSC activation by activating the PI3K/Akt signaling pathway. LY294002 specifically inhibited the PI3K/Akt signaling pathway, and HSC activation. This finding suggests that the PI3K/Akt pathway is an important pathway for HSC activation and that inhibition of the PI3K/Akt pathway leads to reduction of HSC activation.
TGF‐β1 is known to stimulate fibroblasts. 32 The α‐SMA is a biomarker for activated HSCs, the activation of which is the main link to hepatic fibrosis. 33 Notably, the TGF‐β1 level was significantly higher at 20 Gy than that of 10 Gy in this study. In theory, higher TGF‐β1 indicates higher level of activated HSCs and higher level of α‐SMA by HSCs. Inconsistently, the α‐SMA mRNA and Akt mRNA levels were significantly higher at 10 Gy and significantly lower at 20 Gy. This may be because that radiation‐induced fibrosis is a dynamic process. There may be not a strict one‐to‐one quantitative relationship between TGF‐β1 level and HSCs activation or between HSCs activation and α‐SMA/Akt level. Further studies are needed to investigate the underlying mechanisms.
To sum up, radiation‐induced liver injury induced high expression of α‐SMA, indicating the activation of HSCs. Meanwhile, TGF‐β1 and p‐Akt levels were also increased after radiation. And, after inhibiting PI3K/Akt signaling pathway by LY294002, TGF‐β1 level was decreased. Our results suggest that during radiation‐induced liver injury, HSCs may be activated by TGF‐β1‐mediated PI3K/Akt signal pathway.
CONFLICT OF INTEREST
The authors declare no potential conflict of interest.
Supporting information
Supplementary Figure 1 Morphological changes of liver after 10 Gy and 20 Gy irradiation. H&E staining was used to observe the morphological changes of liver tissues. Representative images were shown.
Supplementary Figure 2 Analysis of α‐SMA and Akt (p‐Akt) expression after 30 Gy irradiation. RT‐qPCR was used to detect the mRNA of α‐SMA and Akt (p‐Akt). (A) α‐SMA mRNA expression in each group. (B) Akt mRNA expression in each group. *P < 0.05.
Supplementary Table 1 Changes of serum AST, ALT, ALP, TB, and DB after 10Gy irradiation (μmol/L).
Supplementary Table 2. Changes of serum AST, ALT, ALP, TB, and DB after 20Gy irradiation (μmol/L).
Xiao L, Zhang H, Yang X, et al. Role of phosphatidylinositol 3‐kinase signaling pathway in radiation‐induced liver injury. Kaohsiung J Med Sci. 2020;36:990–997. 10.1002/kjm2.12279
Funding information Regional Fund of National Natural Science Foundation of China, Grant/Award Number: 81760543
REFERENCES
- 1. Torre LA, Bray F, Siegel RL, Ferlay J, Lortet‐Tieulent J, Jemal A. Global cancer statistics, 2012. CA Cancer J Clin. 2015;65(2):87–108. [DOI] [PubMed] [Google Scholar]
- 2. Rio E, Mornex F, Peiffert D, Huertas A. Hepatic tumors and radiotherapy. Cancer Radiother. 2016;20:S174–S178. [DOI] [PubMed] [Google Scholar]
- 3. Swaminath A, Knox JJ, Brierley JD, Dinniwell R, Wong R, Kassam Z, et al. Changes in liver volume observed following sorafenib and liver radiation therapy. Int J Radiat Oncol Biol Phys. 2016;94(4):729–737. [DOI] [PubMed] [Google Scholar]
- 4. Veronese I, De Martin E, Martinotti AS, Fumagalli ML, Vite C, Redaelli I, et al. Multi‐institutional application of failure mode and effects analysis (FMEA) to CyberKnife stereotactic body radiation therapy (SBRT). Radiat Oncol. 2015;10:132. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Weiner AA, Olsen J, Ma D, Dyk P, DeWees T, Myerson RJ, et al. Stereotactic body radiotherapy for primary hepatic malignancies‐Report of a phase I/II institutional study. Radiother Oncol. 2016;121(1):79–85. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Toesca DAS, Ibragimov B, Koong AJ, Xing L, Koong AC, Chang DT. Strategies for prediction and mitigation of radiation‐induced liver toxicity. J Radiat Res. 2018;59(Suppl 1):i40–i49. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Kim J, Jung Y. Radiation‐induced liver disease: Current understanding and future perspectives. Exp Mol Med. 2017;49(7):e359. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Du SS, Qiang M, Zeng ZC, Zhou J, Tan YS, Zhang ZY, et al. Radiation‐induced liver fibrosis is mitigated by gene therapy inhibiting transforming growth factor‐beta signaling in the rat. Int J Radiat Oncol Biol Phys. 2010;78(5):1513–1523. [DOI] [PubMed] [Google Scholar]
- 9. Cheng W, Xiao L, Ainiwaer A, Wang Y, Wu G, Mao R, et al. Molecular responses of radiation‐induced liver damage in rats. Mol Med Rep. 2015;11(4):2592–2600. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Petiti JP, Sosa Ldel V, Sabatino ME, Vaca AM, Gutierrez S, De Paul AL, et al. Involvement of MEK/ERK1/2 and PI3K/Akt pathways in the refractory behavior of GH3B6 pituitary tumor cells to the inhibitory effect of TGFbeta1. Endocrinology. 2015;156(2):534–547. [DOI] [PubMed] [Google Scholar]
- 11. Singha PK, Pandeswara S, Geng H, Lan R, Venkatachalam MA, Saikumar P. TGF‐beta induced TMEPAI/PMEPA1 inhibits canonical Smad signaling through R‐Smad sequestration and promotes non‐canonical PI3K/Akt signaling by reducing PTEN in triple negative breast cancer. Genes Cancer. 2014;5(9–10):320–336. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Wang J, Chu ES, Chen HY, Man K, Go MY, Huang XR, et al. microRNA‐29b prevents liver fibrosis by attenuating hepatic stellate cell activation and inducing apoptosis through targeting PI3K/AKT pathway. Oncotarget. 2015;6(9):7325–7338. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Li YH, Choi DH, Lee EH, Seo SR, Lee S, Cho EH. Sirtuin 3 (SIRT3) regulates alpha‐smooth muscle Actin (alpha‐SMA) production through the succinate dehydrogenase‐G protein‐coupled receptor 91 (GPR91) pathway in hepatic stellate cells. J Biol Chem. 2016;291(19):10277–10292. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Bale SS, Geerts S, Jindal R, Yarmush ML. Isolation and co‐culture of rat parenchymal and non‐parenchymal liver cells to evaluate cellular interactions and response. Sci Rep. 2016;6:25329. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Dong Y, Shen X, He M, Wu Z, Zheng Q, Wang Y, et al. Activation of the JNK‐c‐Jun pathway in response to irradiation facilitates Fas ligand secretion in hepatoma cells and increases hepatocyte injury. J Exp Clin Cancer Res. 2016;35(1):114. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Furuta T, Yamaguchi M, Nakagami R, Akahane M, Minami M, Ohtomo K, et al. Delayed hepatic signal recovery on ferucarbotran‐enhanced magnetic resonance images: An experimental study in rat livers with gadolinium chloride‐induced Kupffer cell damage. MAGMA. 2013;26(3):313–324. [DOI] [PubMed] [Google Scholar]
- 17. Bai G, Yan G, Wang G, Wan P, Zhang R. Anti‐hepatic fibrosis effects of a novel turtle shell decoction by inhibiting hepatic stellate cell proliferation and blocking TGF‐beta1/Smad signaling pathway in rats. Oncol Rep. 2016;36(5):2902–2910. [DOI] [PubMed] [Google Scholar]
- 18. Ding N, Yu RT, Subramaniam N, Sherman MH, Wilson C, Rao R, et al. A vitamin D receptor/SMAD genomic circuit gates hepatic fibrotic response. Cell. 2013;153(3):601–613. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Yang AT, Hu DD, Wang P, Cong M, Liu TH, Zhang D, et al. TGF‐beta1 induces the dual regulation of hepatic progenitor cells with both anti‐ and Proliver fibrosis. Stem Cells Int. 2016;2016:1492694. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Chen YX, Zeng ZC, Sun J, Zeng HY, Huang Y, Zhang ZY. Mesenchymal stem cell‐conditioned medium prevents radiation‐induced liver injury by inhibiting inflammation and protecting sinusoidal endothelial cells. J Radiat Res. 2015;56(4):700–708. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Li C, Wang Q, Wang JF. Transforming growth factor‐beta (TGF‐beta) induces the expression of chondrogenesis‐related genes through TGF‐beta receptor II (TGFRII)‐AKT‐mTOR signaling in primary cultured mouse precartilaginous stem cells. Biochem Biophys Res Commun. 2014;450(1):646–651. [DOI] [PubMed] [Google Scholar]
- 22. Zong C, Zhang X, Xie Y, Cheng J. Transforming growth factor‐beta inhibits IQ motif containing guanosine triphosphatase activating protein 1 expression in lung fibroblasts via the nuclear factor‐kappaB signaling pathway. Mol Med Rep. 2015;12(1):442–448. [DOI] [PubMed] [Google Scholar]
- 23. Li A, Wang J, Wu M, Zhang X, Zhang H. The inhibition of activated hepatic stellate cells proliferation by arctigenin through G0/G1 phase cell cycle arrest: Persistent p27(Kip1) induction by interfering with PI3K/Akt/FOXO3a signaling pathway. Eur J Pharmacol. 2015;747:71–87. [DOI] [PubMed] [Google Scholar]
- 24. Lu GQ, Wu ZB, Chu XY, Bi ZG, Fan WX. An investigation of crosstalk between Wnt/beta‐catenin and transforming growth factor‐beta signaling in androgenetic alopecia. Medicine (Baltimore). 2016;95(30):e4297. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Shah R, Reyes‐Gordillo K, Arellanes‐Robledo J, Lechuga CG, Hernandez‐Nazara Z, Cotty A, et al. TGF‐beta1 up‐regulates the expression of PDGF‐beta receptor mRNA and induces a delayed PI3K‐, AKT‐, and p70(S6K) ‐dependent proliferative response in activated hepatic stellate cells. Alcohol Clin Exp Res. 2013;37(11):1838–1848. [DOI] [PubMed] [Google Scholar]
- 26. Cai J, Fang L, Huang Y, Li R, Xu X, Hu Z, et al. Simultaneous overactivation of Wnt/beta‐catenin and TGFbeta signalling by miR‐128‐3p confers chemoresistance‐associated metastasis in NSCLC. Nat Commun. 2017;8:15870. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Freudlsperger C, Bian Y, Contag Wise S, Burnett J, Coupar J, Yang X, et al. TGF‐beta and NF‐kappaB signal pathway cross‐talk is mediated through TAK1 and SMAD7 in a subset of head and neck cancers. Oncogene. 2013;32(12):1549–1559. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Hamidi A, Song J, Thakur N, Itoh S, Marcusson A, Bergh A, et al. TGF‐beta promotes PI3K‐AKT signaling and prostate cancer cell migration through the TRAF6‐mediated ubiquitylation of p85alpha. Sci Signal. 2017;10(486):eaal4186. [DOI] [PubMed] [Google Scholar]
- 29. Rodriguez‐Garcia A, Samso P, Fontova P, Simon‐Molas H, Manzano A, Castano E, et al. TGF‐beta1 targets Smad, p38 MAPK, and PI3K/Akt signaling pathways to induce PFKFB3 gene expression and glycolysis in glioblastoma cells. FEBS J. 2017;284(20):3437–3454. [DOI] [PubMed] [Google Scholar]
- 30. Zhu L, Cheng M, Liu Y, Yao Y, Zhu Z, Zhang B, et al. Thymosin‐beta4 inhibits proliferation and induces apoptosis of hepatic stellate cells through PI3K/AKT pathway. Oncotarget. 2017;8(40):68847–68853. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Sun X, Gao X, Zhou L, Sun L, Lu C. PDGF‐BB‐induced MT1‐MMP expression regulates proliferation and invasion of mesenchymal stem cells in 3‐dimensional collagen via MEK/ERK1/2 and PI3K/AKT signaling. Cell Signal. 2013;25(5):1279–1287. [DOI] [PubMed] [Google Scholar]
- 32. Segal‐Salto M, Barashi N, Katav A, Edelshtein V, Aharon A, Hashmueli S, et al. A blocking monoclonal antibody to CCL24 alleviates liver fibrosis and inflammation in experimental models of liver damage. JHEP Rep. 2020;2(1):100064. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Shi MJ, Yan XL, Dong BS, Yang WN, Su SB, Zhang H. A network pharmacology approach to investigating the mechanism of Tanshinone IIA for the treatment of liver fibrosis. J Ethnopharmacol. 2020;253:112689. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Supplementary Figure 1 Morphological changes of liver after 10 Gy and 20 Gy irradiation. H&E staining was used to observe the morphological changes of liver tissues. Representative images were shown.
Supplementary Figure 2 Analysis of α‐SMA and Akt (p‐Akt) expression after 30 Gy irradiation. RT‐qPCR was used to detect the mRNA of α‐SMA and Akt (p‐Akt). (A) α‐SMA mRNA expression in each group. (B) Akt mRNA expression in each group. *P < 0.05.
Supplementary Table 1 Changes of serum AST, ALT, ALP, TB, and DB after 10Gy irradiation (μmol/L).
Supplementary Table 2. Changes of serum AST, ALT, ALP, TB, and DB after 20Gy irradiation (μmol/L).