ABSTRACT
Fungal infections caused by Candida albicans have posed a persistent threat to human health. Existing clinical antifungal drugs are constrained by issues such as drug resistance and side effects. Compounds containing maleimide rings have been verified to possess antifungal properties, although the specific molecular mechanisms by which they exert this activity have yet to be fully understood. A total of 40 compounds containing maleimide rings were synthesised in the present study, and 12 derivatives that possessed antifungal properties were subsequently identified. The maleimide compound 5 (MPD) with the most potent activity demonstrated fungicidal action at a concentration that was twice as potent as the minimal inhibitory concentration and effectively prevented the formation of biofilms. Furthermore, the mechanistic studies revealed that MPD interfered with iron ion homoeostasis by reducing intracellular iron concentration inside cells, which led to the inhibition of ergosterol biosynthesis and increased cell membrane permeability, resulting in the leakage of intracellular trehalose. In addition, MPD was observed to perturb cell wall biosynthesis by reducing the activity of chitin synthase. Moreover, MPD was found to demonstrate therapeutical efficacy in vivo when assessed using a Caenorhabditis elegans-C. albicans infection model.
KEYWORDS: Maleimide derivatives, Candida albicans, cell membrane, iron ion homoeostasis, antifungal activity
1. Introduction
Fungal infections are prevalent clinical infections in humans, encompassing both superficial infections, as well as severe, life-threatening systemic complications (Brown et al. 2012). The prevalence of invasive fungal infections has significantly risen in recent years due to the indiscriminate utilisation of broad-spectrum antibiotics, the application of transplantation procedures, and the increased use of central venous catheters (Millsop and Fazel 2016; McCarty et al. 2021). Global estimates indicate that over 250,000 patients are diagnosed with invasive candidiasis annually, with a mortality rate exceeding 40% (Arendrup and Patterson 2017). Invasive candidiasis is characterised by its high morbidity, mortality, and high medical costs. In China, Invasive candidiasis has been strongly correlated with 40%–50% of mortality cases in intensive care units (Li et al. 2016). Correspondingly, candidemia ranks as the fourth most prevalent nosocomial bloodstream infection in the United States (Wisplinghoff et al. 2004; Cervera 2012).
Currently, the drugs utilised in clinical antifungal therapy primarily consist of polyenes, echinocandins, and azoles (Choi et al. 2021). Azoles and echinocandins can inhibit the synthesis of the fungal cell membrane or cell wall components. On the other hand, polyenes can directly bind to the cell membrane, which results in the formation of transmembrane pores that subsequently cause the leakage of fungal intracellular components (Koselny et al. 2016). However, these antifungal drugs possess notable disadvantages such as drug resistance, toxicity, and limited bioavailability (Wu et al. 2017). For instance, the clinical use of polyenes, such as amphotericin B (AMB), results in a range of toxic side effects, including nephrotoxicity and infusion-related reactions, such as chest pain, dyspnoea, hypoxia, facial flushing, and urticaria (Marena et al. 2022). Correspondingly, azoles, such as fluconazole (FLC), isavuconazole, itraconazole, posaconazole, voriconazole, and others, have been extensively utilised as antifungal agents due to their safety profile and wide availability. However, the rampant use of azoles increases the likelihood of developing azole resistance, particularly in Candida species (Leonardelli et al. 2016). When compared to azole antifungal drugs, echinocandins exhibit a more favourable safety profile and clinical efficacy. However, the high molecular weight limits their oral efficacy and gastrointestinal absorption, thereby necessitating intravenous administration (Kojima et al. 2020). Thus, the development of novel antifungal agents is crucial for effectively treating fungal infections.
Natural compounds containing maleimide rings comprise a group of secondary metabolites synthesised by marine microorganisms. These compounds exhibit diverse biological properties, including antibacterial, antifungal, and anticancer activities (Hara et al. 2013; Nanda and Lorsch 2014; Haralampiev et al. 2015; Ali et al. 2017; Orozco et al. 2021). The basic structure of the maleimide ring is comprised of the ”-CO-N(R)-CO-” linkage, which serves as the key link for exerting antifungal activity (Sortino et al. 2011). In light of the extensive biological activity exhibited by alkaloid compounds containing a maleimide moiety, the present study involved the construction of a small molecule library consisting of N-substituted maleimide and its derivatives to systematically evaluate their antifungal properties. Based on the initial screening results, compounds harbouring high antifungal efficiency were selected for subsequent experiments. Accordingly, the objective of the present study was to elucidate the precise mechanism of action of MPD against C. albicans and to establish a stronger empirical and theoretical foundation for the advancement of maleimide derivatives as innovative antifungal drugs.
2. Materials and methods
2.1. Strains
Clinical isolates were kindly provided by the Affiliated Hospital of Xuzhou Medical University (Xuzhou, China). Saccharomyces cerevisiae and heterozygous diploid deletions were obtained from the yeast S. cerevisiae gene-knockout collection (YKOC), which was purchased from Invitrogen in 2014. All strains were stored at ‒80 °C in a preservation solution containing 20% glycerol. Before the experiment, the strains were inoculated twice on YPD solid plates (yeast extract 1%, peptone 2%, glucose 2%, and agar 2%) and incubated at 30 °C. Single colonies were inoculated into the liquid YPD broth (2% tryptone, 1% yeast extract, and 2% glucose) and cultured overnight at 30 °C, 200 r/min. Wild-type Caenorhabditis elegans strain N2 was obtained from the Caenorhabditis Genetics Center, USA.
2.2. Chemicals
A small molecule library consisting of 40 compounds, specifically N-substituted maleimide and its derivatives were initially screened in this study. Among them, 12 maleimides, each with a distinct N-protection group, were synthesised using ring-opening and ring-closing reactions involving various amines and maleic anhydride. Additionally, a set of 28 new Lamellarin analogs containing a maleimide ring structure were synthesised using an oxidative [3 + 2] cycloaddition aromatisation cascade strategy (Xie et al. 2020). The purity of all compounds was determined to be above 98%, as analysed through high-performance liquid chromatography (HPLC). AMB, FLC, propidium iodide (PI), 1,6-Diphenyl-1,3,5-hexatriene (DPH), ferrous sulphate (FeSO4), and sorbitol were all purchased from Sigma (St Louis, MO, USA). Maleimide compounds, AMB, FLC, and DPH were dissolved in Dimethyl sulphoxide (DMSO). In each test, it was ensured that DMSO content was less than 1%. PI, CFW, sorbitol, and FeSO4 were dissolved in sterile water at a concentration of 10 mg/mL and kept frozen at ‒20 °C until use. The rest reagents and solvents are produced in China (Sangon Biotech Co., Ltd., Shanghai, China).
2.3. Determination of minimum inhibitory concentration (MIC)
The minimal inhibitory concentration (MIC) of the compound was determined by the broth microdilution method, which was in line with the guidelines outlined by the Clinical and Laboratory Standards Institute for yeasts (M27-A3) (Alexander et al. 2007). Accordingly, 96-well plates containing cells that were treated with maleimide compounds or FLC were incubated for 24 h at 35 °C, and subsequently, the MICs were determined through visual examination.
2.4. Time-killing assay against C. albicans
The suspension of C. albicans SC5314 cells, which had been cultured overnight, was diluted to a concentration of 1 × 105 CFU/mL using a synthetic medium plus dextrose (SD) medium. MPD was added at final concentrations of 0.5, 1, 2, 4, and 8 µg/mL. The positive controls consisted of FLC and AMB at concentrations of 2 μg/mL each, while the negative control group did not contain MPD. A 100 µL sample was collected at 0, 2, 4, 6, 8, 10, 12, and 24 h following incubation at 30 °C. The number of living cells was determined using the flat colony counting method, which involved ten-fold serial dilutions on YPD agar plates.
2.5. Examination of MPD’s ability to inhibit biofilm formation in mixed cultures of C. albicans and non-albicans Candida
Following overnight incubation in YPD medium, cells of strains SC5314, CT171221301, CG171122302, and CP18092240 were diluted to a concentration of 1 × 106 cells/mL using RPMI 1640 medium. SC5314 and other non-albicans strains were distributed evenly into a plate, with different concentrations of MPD. The plate was placed in a stationary culture and kept at a temperature of 37 °C for 24 h. The suspended fungus was eliminated through three rinses using sterile phosphate-buffered saline (PBS). The quantification of viable cells was performed using the XTT Cell Proliferation Kit (BestBio, Shanghai, China), while the visualisation of biofilms was achieved through bright-field imaging using an Olympus microscope.
2.6. RNA extraction, library construction, and sequencing
C. albicans SC5314 cells were diluted in an SD medium to achieve a concentration of 5 × 106 cells/mL. Subsequently, the cells were subjected to incubation at a temperature of 30 °C for a duration of 12 h, either in the presence or absence of 1 μg/mL of MPD. RNA-seq experiments were conducted using three distinct cultures. The total RNA was extracted using the hot phenol method (Li et al. 2015), and the samples were sequenced on the BGISEQ-500 platform. The library was constructed and sequenced by BGI, a company based in Shenzhen, China.
The original image data acquired through sequencing is transformed into raw reads via base calling and saved in the fastq file format, which includes both the read sequence and information on sequencing quality. To obtain clean reads, we eliminated reads with low quality, linker pollution, and excessive content of unknown nucleotides. Utilise Bowtie2 to conduct a comparative analysis between the clean reads and the reference gene sequence. Subsequently, employ RSEM to compute the expression level of both genes and transcripts. The gene expression level was normalised by the Fragments Per Kilobase of transcript per Million mapped reads (FPKM) method. Additionally, the DESeq2 package was used to identify differentially expressed genes (DEGs) between different samples. Genes with log2 Fold Change > 1 and P value < 0.05 were considered DEGs.
2.7. Growth analysis of wild-type and mutant S. cerevisiae strains
S. cerevisiae strains were cultivated and preserved following the outlined methods (Dymond 2013). The suspensions that had been cultured overnight were diluted to an optical density of approximately 0.05 at a wavelength of 600 nm. These diluted suspensions were then cultivated in a YPD medium, either with the addition of 0.5 µg/mL of MPD or without it. The alteration in OD600 of both the wild-type (S. cerevisiae BY4743) and mutant strains (aft2 Δ/Δ) was observed using a Bio-Rad Model 680 microplate reader at specified time intervals over 28 h (Thangamani et al. 2017).
2.8. Detection of intracellular Fe2+content
FeRhonox-1, a fluorescent probe specifically binding Fe2+, was used to determine the change in intracellular Fe2+ content. C. albicans SC5314 cells that were cultured overnight were diluted in RPMI 1640 medium to achieve a concentration of approximately 1 × 106 cells/mL. These cells were then exposed to 2 μg/mL of MPD at a temperature of 30 °C for a duration of 10 h. The cells were subsequently treated with 4% paraformaldehyde for a duration of 1 hour and subsequently rinsed three times with PBS. Following the introduction of 5 μmol/L of FeRhonox-1, the cells were subjected to staining in a lightless environment for 20 min. The cellular images were acquired using a fluorescence microscope (Olympus BX53F, Olympus, Tokyo, Japan).
2.9. Evaluation of antifungal activity of MPD in the presence of iron
The growth inhibitory activity of the combination of MPD and FeSO4 against C. albicans was assessed using the chequerboard microdilution method. The MPD concentrations were 0, 0.5, 1, and 2 μg/mL, while the FeSO4 concentrations were 0, 50, 100, 200, and 400 μmol/L. The inhibition ratios were determined by measuring the OD600 after incubating for 24 h at 30 °C.
2.10. Detection of gene expression by RT-qPCR
RT-qPCR was employed to ascertain the impact of MPD on the expression of associated genes (Wu et al. 2008). The SC5314 cells were diluted with SD medium to a concentration of 5 × 106 cells/mL. Subsequently, the cells were subjected to treatment with or without 2 μg/mL of MPD and placed in an incubator at a temperature of 30 °C for a duration of 12 h. The total RNAs were extracted using the hot phenol method, and cDNA was synthesised using the RT-qPCR kit (Toyobo Co, Osaka, Japan). The qPCR was conducted using an Eppendorf Mastercycler Real-Time PCR System. The primer sequences, reaction systems, and conditions were established according to previous specifications (Sun et al. 2010). The internal reference gene used for calculations was the housekeeping gene 18S rRNA. The data was computed using the formula 2−∆∆CT. The samples were collected from three separate experiments conducted in triplicate. The gene-specific primers utilised in this investigation are displayed in (Table 1).
Table 1.
Gene-specific primers used for real-time RT-PCR.
| Primers | Sequences (5’–3’) |
|---|---|
| FTR1-F | GCCGGTATCGTTGTTGGTGCAT |
| FTR1-R | TGGTTTCGAAATACCAAATACC |
| FTR2-F | AATTTGTGGTCTTGCAGTGG |
| FTR2-R | TTGATAACTCTCAAAGAACC |
| FTH1-F | GTTCGGGATACTTGAATAAC |
| FTH1-R | TCCGATGACAGCTATTGCTT |
| FET34-F | CTCGAGTGACATCATCCCTTCA |
| FET34-R | ACCAACATTAACAATTCTAACC |
| FET99-F | TCAAAGGACTTGATGCCAGGA |
| FET99-R | ATTGGCAATTCTCAAAAGGTAT |
| ERG1-F | TGGATAGTGATTCCACATTG |
| ERG1-R | TGTTAGGATCCAGAGGATCA |
| ERG3-F | TTTCATTGTGGCTTACTTATC |
| ERG3-R | AGGAAGGAATACCCATTTAAT |
| ERG6-F | ACAAGCTACTGCTAGACAT |
| ERG6-R | ATCTTGTGATTTCTCTACCAG |
| ERG9-F | TAGAAAGTAGAACATTACCAG |
| ERG9-R | CATACTGGAGGTAAAGC |
| ERG24-F | ATTACTTGTTACCTGGCAAG |
| ERG24-R | TAATATTCAAGAGAGCTGTCG |
| ERG25-F | AGTGATAAAGAACAATGGGAATGT |
| ERG25-R | TACTGCCCATTGAATCAACATA |
| ERG26-F | TGTAATTGTTCATTCAGCTTC |
| ERG26-R | CATTAAATATCACACCAGCTG |
| CHS1-F | TGGAGTGTGGGCTCTTGTC |
| CHS1-R | ATCGGGCGCGGTATATCT |
| CHS2-F | CCACAACAAGAAGTCCGTTC |
| CHS2-R | CATCAGCAACAGGACAATCA |
| CHS3-F | CGTCAATTCGCTTGGAGAGA |
| CHS3-R | GGTTCTGACACTGACTCGAA |
| CHS8-F | AATGTTGCTGGTGCTTGTGG |
| CHS8-R | TGTGCTGCACTAACGGATT |
| 18S rRNA-F | AATTACCCAATCCCGACAC |
| 18S rRNA-R | TGCAACAACTTTAATATACGC |
2.11. Determination of ergosterol content
The ethanol-KOH method was used to extract the total sterols of C. albicans following MPD treatment, as described previously (Arthington-Skaggs et al. 1999). The SC5314 cell concentration was adjusted to 1 × 106 cells/mL using an SD medium. Various concentrations of Compound MPD (0, 0.5, 1, and 2 μg/mL) were introduced and subjected to incubation at 30 °C for a duration of 12 h. The positive control was set at a concentration of 2 μg/mL for FLC. The sterol extract was analysed using a spectrophotometer (Shimadzu UV-2450, Kyoto, Japan). The analysis was conducted by scanning the extract between 240 and 300 nm. The ergosterol content was determined using the following equations:
F: The factor for dilution.
2.12. Detection of cell membrane permeability and dynamics
PI and DPH were employed to identify the cellular membrane damage caused by MPD (Li et al. 2015). The SC5314 cells in the logarithmic growth phase were diluted to a concentration of 5 × 106 cells/mL using an SD medium. The compound MPD was introduced at varying concentrations of 0, 0.5, 1, 2, 4, and 8 μg/mL, and then kept at a temperature of 30 °C for 12 h. The cells were exposed to different concentrations of MPD (0, 2, 4, and 8 μg/mL) and then stained with 5 μmol/L of PI for 10 min in the absence of light. The stained cells were subsequently visualised using an Olympus fluorescence microscope to determine the proportion of stained cells. Meanwhile, cells exposed to varying concentrations of MPD (0, 0.5, 1, and 2 μg/mL) were immobilised, rinsed, and rapidly frozen. The cells were stained with 100 μmol/L of DPH at a temperature of 30 °C for 45 min. The relative fluorescence intensity was determined by measuring the absorbance at 350 nm excitation light and 425 nm absorption light using a multi-function microplate reader (Berthold Biotechnologies, Stuttgart, Germany).
2.13. Determination of intracellular and extracellular trehalose content
SC5314 cells (5 × 106 cells/mL in SD medium) were subjected to treatment with varying concentrations of MPD (0, 0.5, 1, and 2 μg/mL) at a temperature of 30 °C for 12 h. The objective was to assess the alteration in intracellular and extracellular trehalose content, following a previously described method with certain modifications (Hwang et al. 2011). Cells were harvested through centrifugation and their wet weight was measured. The concentration of trehalose within the cell and outside the cell was measured using a trehalose content kit (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China).
2.14. Determination of the chitin synthase activity
Chitin constitutes the primary constituent of the fungal cell wall (Chaudhary et al. 2013). Chitin biosynthesis is facilitated by an enzyme called chitin synthase (CHS), which utilises uridine diphosphoryl l-N-acetyl-D-glucosamine (UDP-GlcNAc) as the substrate donor to produce GlcNAc (Li et al. 2019). The impact of MPD on chitin biosynthesis was assessed by measuring the alteration in chitin synthase activity. Building upon the previous approach (Ge et al. 2016), SC5314 cells weighing approximately 2 g were gathered by centrifuging at 1,500 × g for 20 min at 4 °C and subsequently rinsed three times. The precipitate was then dissolved in 20 mL of 50 mmol/L Tris-HCl solution having pH 7.0. Next, 40 μL of a fungal protease inhibitor was added, and the sample was subjected to ultrasonic treatment at a temperature of 4 °C for a duration of 90 min. The supernatant was then combined with a 10% sucrose solution (double volume of supernatant), and centrifuged at 55,000 × g for 2 h at 4 °C. After centrifugation, the supernatant was discarded, the precipitate was stored in 40% glycerol at ‒80 °C. The supernatant was used as CHS samples.
Subsequently, 200 μL of wheat germ agglutinin (20 μg/mL) was added to each well of a 96-well plate, and incubated at room temperature for a duration of 16 h. After incubation, the solution in the wells was discarded and the plate was rinsed with distilled water, repeating this process at least three times. Each well was then supplemented with 300 μL of bovine serum albumin solution, which had a concentration of 3 mg/mL, in a Tris-HCl buffer solution with a concentration of 50 mmol/L. The mixture was then incubated at a temperature of 37 °C for 2 h. The solution was then removed and the wells were subsequently washed three times with a Tris-HCl solution. A 50 μL solution containing 80 mmol/L GlcNAc and 4 mmol/L UDP-GlcNAc, along with 50 μL of MPD at different concentrations (0, 0.5, 1, 2, and 4 μg/mL), and 50 μL of CHS sample were combined in a well. The total volume was brought to 200 μL by adding a 50 mmol/L Tris-HCl buffer solution. The 96-well plates were placed in an incubator and kept at a temperature of 25 °C for 1 hour. Subsequently, the unattached elements were extracted and rinsed thrice with distilled water.
200 μL of a solution containing wheat germ agglutinin Horse Reddish Peroxidase at a concentration of 1 μg/mL in 50 mmol/L Tris-HCl at pH 7.5 was added to each well. Following a gentle shaking for a duration of 10 min, the 96-well plates were subsequently incubated at a temperature of 37 °C for a period of 15 min, and subsequently subjected to 5 washes using distilled water. Subsequently, a volume of 150 μL of peroxidase substrate buffer solution was introduced, and the mixtures underwent a reaction in a light-protected environment for 30 min at a temperature of 37 °C. The reaction was terminated using 50 μL of a 2 mol/L H2SO4 solution and its absorbance was quantified at 450 nm using a Bio-Rad Model 680 microplate reader.
The inhibition rate of chitin synthase activity was determined using the following equations:
B0: Absorbance of HRP with substrate, enzyme, and without MPD.
Bn: Absorbance of HRP with MPD.
Od0: Blank absorbance without MPD, substrate, and enzyme.
2.15. Calcofluor white (CFW) staining
The SC5314 strain in the logarithmic growth phase was diluted to a concentration of 5 × 105 cells/mL using an SD medium. MPD was introduced at varying final concentrations of 0, 1, 2, and 4 μg/mL. Following a 12-hour incubation at a temperature of 35 °C, the SC5314 cells that had been treated were rinsed and then re-suspended using PBS. Following a 10-minute incubation in the dark with a 10 μg/mL concentration of CFW, the cells were imaged using an Olympus fluorescence microscope. The sample’s fluorescence intensity was measured using a multi-function microplate reader (Berthold Biotechnologies, Stuttgart, Germany), with excitation light at 390 nm and absorption light at 420 nm. The relative fluorescence intensity was determined based on the absorbance of each concentration.
2.16. Effect of cell wall perturbing agents on the antifungal activity of MPD
The inhibitory effect of MPD in combination with CFW against C. albicans was assessed using the chequerboard microdilution technique (Zhou et al. 2012). The SC5314 cells were diluted to a concentration of 0.5 to 2.5 × 103 cells/mL using RPMI 1640 medium. The compound MPD was introduced at concentrations of 0, 0.5, 1, and 2 μg/mL, while the cell wall perturbing agent CFW was administered at doses of 0, 25, 50, 100, and 200 µg/mL, respectively. The plate was subjected to incubation at a temperature of 30 °C for a duration of 24 h, after which the optical density at a wavelength of 600 nm was determined using a Bio-Rad Model 680 microplate reader.
2.17. Sorbitol protection assay
To verify the inhibitory impact of MPD on the cell wall of C. albicans, the sorbitol protection assay was conducted (Lee and Kim 2017). Prepare a solution of SC5314 cells that were cultured overnight by diluting them to a concentration of 1 × 105 cells/mL using an SD medium. First, add MPD to the samples at final concentrations of 0 and 1 µg/mL. Then, add 0.8 mmol/L of sorbitol to the samples treated with MPD, while leaving the other samples untreated. After that, incubate the samples at a temperature of 30 °C for a duration of 25 h. The OD600 of each sample was measured at 5, 10, 15, 20, and 25 h of incubation using a Bio-Rad Model 680 microplate reader. The obtained data was used to plot the growth curves.
2.18. C. elegans-C. albicans infection model
The viability of healthy C. elegans was observed following exposure to high concentrations of MPD treatment. The N2 nematodes, which were in their natural state, were exposed to various concentrations of MPD (0, 1, 2, 4, and 8 µg/mL). They were then placed in a 96-well plate and incubated at a temperature of 25 °C for 2 days. The survival rates were determined by quantifying the number of viable worms using microscopy.
The antifungal activity of MPD was assessed in vivo using the C. elegans-C. albicans infection model (Li et al. 2015). C. elegans were subjected to C. albicans strain SC5314 for 2 h and subsequently cultured at 25 °C for 7 days with varying concentrations of MPD. The group treated with FLC at a concentration of 2 µg/mL serves as the positive control. Daily monitoring of the survival state of infected worms was conducted to determine the survival rates.
2.19. Statistical analysis
GraphPad Prism 7.0 software was used for all graphic illustrations and statistical analyses. All experiments and measurements were conducted a minimum of three times, and the values were expressed as the mean ± standard deviation (SD). The log-rank test was employed to analyse the data from the C. elegans-C. albicans infection assay. A two-tailed Student’s t-test was conducted to assess the significance of the difference between the control and experimental groups. A significance level of p < 0.05 was used to determine statistical significance.
3. Results
3.1. The 40 N-substituted maleimide compounds and their derivatives were synthesized
We synthesised a total of 40 N-substituted maleimide compounds and their derivatives. Figure 1 displays the molecular structure of the 40 tested compounds containing a maleimide ring. The synthetic routes of these target compounds are shown in Figure S1. First, N-substituted maleimide compounds 1–12 were prepared through a two-step procedure according to reported methods. Reactions of amine analogues (1) between maleic anhydride gave the corresponding N-substituted maleamic acids (2), then N-substituted maleamic acids were cyclised to target N-substituted maleimides 1–12 by heating with acetic anhydride as a solvent and under both the heating and catalytic amounts of sodium acetate conditions. The NMR data of compounds 1–12 were consistent with the reported literature (Kalgutkar et al. 1996; Sortino et al. 2008, 2011). Secondly, the maleimide derivatives 13–40 were synthesised through aerobic oxidative [3 + 2] cycloaddition-aromatisation reactions between N-substituted tetrahydroisoquinoline or N, N-dimethyl-p-toluidine (3) and N-substituted maleimides 1–12, which were developed by our laboratory (Xie et al. 2020). These compounds were characterised by1H and13C NMR, and detailed data are shown in Supplementary Materials 1 and 2.
Figure 1.

The structure of synthesised compounds with maleimide ring.
3.2. The inhibitory effect of maleimide compounds against Candida species
We tested the antifungal properties of the compounds against various Candida species using the micro broth dilution method. The results showed that compounds 1 to 12 exerted antifungal effects against wild-type C. albicans SC5314 (Table 2). Subsequently, the antifungal properties of these compounds were evaluated against C. albicans (CA10), C. krusei (CK1), C. tropicalis (CT 171221301), C. glabrata (CG 171122302), and C. parapsilosis (CP 18092240). The MIC80 values of these substances were found to vary from 1 to 4 μg/mL. Moreover, for CK1 and CA10, the MIC80 values of the positive control FLC were 64 μg/mL and greater than 128 μg/mL, respectively, whereas the MIC80 values of other compounds ranged from 1 to 4 μg/mL for CK1 and 1 to 2 μg/mL for CA10 (Table 3). 1-(4-methoxyphenyl)-1hydro-pyrrole-2,5-dione, Compound 5 (MPD), which demonstrated superior antifungal activity. It was selected for further studies to elucidate the mechanism of action of maleimide derivatives against Candida species.
Table 2.
The minimal inhibitory concentrations (MICs) of compounds against Candida albicans SC5314.
| Compound | Structure (R) | MIC (μg/mL) |
|---|---|---|
| 1 | R1: Ph | 1 |
| 2 | R1: 2,4-di-MePh | 1 |
| 3 | R1: 3-MePh | 1 |
| 4 | R1: 4-MePh | 1 |
| 5 | R1: 4-MeOPh | 1 |
| 6 | R1: 4-ClPh | 1 |
| 7 | R1: 4-BrPh | 1 |
| 8 | R1: Bn | 2 |
| 9 | R1: 4-ClBn | 2 |
| 10 | R1: 4-MeOBn | 2 |
| 11 | R1: PhCH2CH2 | 2 |
| 12 | R1: Me | 2 |
| 13 | R2: Ph; R3: COOEt; R4: H | >128 |
| 14 | R2: 2,4-di-MePh; R3: COOEt; R4: H | >128 |
| 15 | R2: 3-MePh; R3: COOEt; R4: H | 128 |
| 16 | R2: 4-MePh; R3: COOEt; R4: H | >128 |
| 17 | R2: 2-MePh; R3: COOEt; R4: H | >128 |
| 18 | R2: 4-MeOPh; R3: COOEt; R4: H | >128 |
| 19 | R2: 4-ClPh; R3: COOEt; R4: H | >128 |
| 20 | R2: 4-BrPh; R3: COOEt; R4: H | >128 |
| 21 | R2: Bn; R3: COOEt; R4: H | >128 |
| 22 | R2: 4-ClBn; R3: COOEt; R4: H | >128 |
| 23 | R2: 4-MeOBn; R3: COOEt; R4: H | >128 |
| 24 | R2: PhCH2CH2; R3: COOEt; R4: H | >128 |
| 25 | R2: Me; R3: COOEt; R4: H | >128 |
| 26 | R2: Ph; R3: COOBn; R4: H | 128 |
| 27 | R2: Ph; R3: COOi-Bu; R4: H | >128 |
| 28 | R2: Ph; R3: COOt-Bu; R4: H | >128 |
| 29 | R2: Ph; R3: COOPh; R4: H | >128 |
| 30 | R2: Ph; R3: COOi-Pr; R4: H | >128 |
| 31 | R2: Ph; R3: COOMe; R4: H | >128 |
| 32 | R2: 4-CIPh; R3: Ph; R4: H | 128 |
| 33 | R2: Ph; R3: Ph; R4: H | >128 |
| 34 | R2: 4-MeOPh; R3: Ph; R4: H | >128 |
| 35 | R2: 4-ClPh; R3: COOEt; R4: 6,7-di-OMie | >128 |
| 36 | R2: 4-MeOPh; R3: COOEt; R4: 6,7-di-OMie | >128 |
| 37 | R2: 4-ClPh; R3: COOEt; R4: 7-Br | 128 |
| 38 | R2: 4-MeOPh; R3: COOEt; R4: 7-Br | >128 |
| 39 | Ar: Ph | >128 |
| 40 | Ar: 4-ClPh | >128 |
Table 3.
The minimal inhibitory concentrations (MICs) of compounds against different Candida species.
| Straina | MIC (μg/mL) |
||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | FLC | |
| CA10 | 2 | 2 | 2 | 2 | 1 | 2 | 2 | 2 | 1 | 4 | 1 | 1 | >128 |
| CK1 | 4 | 2 | 4 | 1 | 2 | 4 | 1 | 4 | 1 | 4 | 1 | 1 | 64 |
| CT171221301 | 2 | 2 | 2 | 2 | 1 | 1 | 1 | 4 | 2 | 4 | 2 | 1 | 1 |
| CG171122302 | 2 | 2 | 2 | 2 | 1 | 1 | 1 | 4 | 2 | 1 | 2 | 2 | 1 |
| CP18092240 | 2 | 2 | 2 | 2 | 1 | 1 | 1 | 2 | 2 | 2 | 1 | 2 | 0.5 |
aCA10 is a clinically isolated azole multi-resistance Candida albicans isolate. CK1 is a clinically isolated Candida krusei isolate. CT171221301 is a clinically isolated Candida tropicalis isolate. CG171122302 is a clinically isolated Candida glabrata isolate. CP18092240 is a clinically isolated Candida parapsilosis isolate.
3.3. The inhibitory effect of MPD on the growth of C. albicans
To investigate the impact of MPD on the growth of C. albicans over a while, time-killing curves for different doses of MPD, AMB, and FLC were plotted using the colony counting method. As shown in Figure 2, 0.5, 1, and 2 μg/mL of MPD effectively inhibited the growth of C. albicans. Furthermore, the concentrations of MPD at 4 and 8 μg/mL significantly reduced the number of viable initial cells over a while. In addition, a concentration of 8 μg/mL of MPD (8 × MIC) and 2 μg/mL of AMB resulted in a 3-log10 decrease in CFU within 24 h, thereby successfully demonstrating their fungicidal effects.
Figure 2.

The time-killing analysis of the maleimide compound 5 [1-(4-methoxyphenyl)-1hydro-pyrrole-2,5-dione, MPD] against Candida albicans. SC5314 cells were incubated with different doses of MPD at 30 °C for 24 h. The MPD-free group served as the negative control. FLC (2 μg/mL) and AMB (2 μg/mL) served as positive controls. The data is represented as mean ± SD.
3.4. MPD inhibits mixed-culture biofilms of C. albicans with non-albicans Candida
Treating multiple pathogenic fungal infections poses greater challenges in clinical setting. Hence, we examined the impact of MPD on biofilms composed of a combination of C. albicans and non-albicans Candida species. As shown in Figure 3a, microscopic studies demonstrate that treatment with MPD at concentrations of 1 and 2 μg/mL effectively inhibits the formation of mixed biofilms consisting of C. albicans and C. glabrata, C. albicans and C. parapsilosis, C. albicans and C. tropicalis. In addition, the XTT reduction assay results demonstrated that the presence of 1 μg/mL of MPD effectively inhibited the formation of mixed biofilm (Figure 3b). Furthermore, at a concentration of 2 µg/mL, MPD exhibited an inhibition rate of up to 80%.
Figure 3.

Effects of the maleimide compound 5 [1-(4-methoxyphenyl)-1hydro-pyrrole-2,5-dione, MPD] on biofilm formation in mixed cultures containing Candida albicans and non-albican fungal strains. SC5314 cells and other non-albicans cells were diluted in the RPMI1640 medium and incubated with different doses of MPD at 37 °C without shaking for 24 h. (a) The formation of biofilm was photographed by microscope. (b) The number of viable cells detected by the XTT Cell Proliferation Kit. The scale bar indicates 50 μm. The data is represented as mean ± SD. Asterisks represent statistically significant differences. * means P < 0.05; ** means P < 0.01.
3.5. Transcriptional profiling
To delve deeper into the molecular mechanism responsible for the antifungal properties of MPD, we conducted an RNA-seq analysis of C. albicans cells that were subjected to MPD treatment. When compared to the control group, MPD treatment led to the differential expression of 1,384 genes, with 975 genes being up-regulated and 409 genes being down-regulated (Figure 4a).
Figure 4.

Transcriptional profiling of Candida albicans SC5314 in response to the maleimide compound 5 [1-(4-methoxyphenyl)-1hydro-pyrrole-2,5-dione, MPD] treatment. (a) Volcano map of differentially expressed genes (DEGs). In the figure, the X-coordinate is the log2 fold change value, and the Y-coordinate is -log10 (padj). (b) Summary of gene enrichment analyses and the number of genes affected by C. albicans exposure to MPD. The X-coordinate denotes gene ontology (GO) representing biological processes, cellular components, and molecular functions, whereas the Y-coordinate represents the number of genes. (c) Heatmap of MPD on the expression of selected genes of C. albicans.
Additionally, gene ontology (GO) enrichment analysis was conducted using all differentially expressed genes (DEGs) to establish a connection between the alterations in genes caused by MPD action and their respective functions. The biological processes that were significantly enriched include filamentous growth, cellular response, and cellular iron ion homoeostasis. Additionally, the plasma membrane, extracellular region, and cell wall showed significant enrichment at the cellular component level. Moreover, at the molecular function level, the enrichment of the DEGs was primarily related to RNA binding (Figure 4b).
Given the GO enrichment results, we conducted a new analysis of the differential expression of genes associated with filamentation, iron ion homoeostasis, cell membrane, and cell wall. The findings indicated that exposure to MPD resulted in the suppression of gene expressions related to filament growth (FGR13, FGR32, FGR34, VPS4, and VPS51), adhesion (UGA33, ALS9, and ZCF28), and biofilm formation (GCA1, GCA2, and ADH5). The genes responsible for maintaining iron balance, such as ferric permease genes (FTH1, FTH2, and FTR1), were found to be down-regulated. On the other hand, the genes involved in iron oxidation (FET34 and FET99) and iron regulation (SEF1 and HAP43) were up-regulated. Furthermore, genes responsible for the regulation of cell membranes were down-regulated. These include HGT5, HGT6, and SNG3, which are involved in substance transportation, as well as OBPA and STT4, which are responsible for maintaining membrane stability. Additionally, genes involved in ergosterol synthesis, viz. ERG1, ERG3, ERG4, ERG6, ERG9, and ERG10, were also down-regulated. Furthermore, the expression of genes responsible for cell wall stability such as glucan synthesis (PGA4 and PGA10), cell wall integrity (DSE1 and YWP1), and chitin synthase (CHS2, CHS3, CHS4, and CHS7) was also observed to be down-regulated. The heatmaps DEGs are presented in Figure 4c.
3.6. MPD interferes with metal iron ion homeostasis in C. albicans
C. albicans rely on iron for numerous vital biological processes (Jordá et al. 2022). Transcriptome data indicated that MPD could potentially impact the capacity of C. albicans to utilise iron. Subsequently, we observed the impact of MPD on the regulation of cellular iron ion homoeostasis. As shown in Figure 5a, when a subinhibitory concentration of MPD (0.5 μg/mL) is present, the growth of the S. cerevisiae mutant strain (aft2Δ/Δ) exhibits distinct behaviour compared to the wild-type strain (BY4743). The gene AFT2 is necessary for maintaining iron balance. Previous research has shown that the aft2Δ/Δ strain, which lacks the AFT2 gene, is more susceptible to disruptions in intracellular iron homoeostasis (Courel et al. 2005). A significant shift in the time needed to reach the mid-logarithmic stage (OD600 ~0.30) was observed. This result indicates that the antifungal mechanism of action of MPD may be associated with the regulation of intracellular iron levels.
Figure 5.

Effects of the maleimide compound 5 [1-(4-methoxyphenyl)-1hydro-pyrrole-2,5-dione, MPD] on iron homoeostasis. (a) Growth curves of Saccharomyces cerevisiae (BY4743) and heterozygous diploid deletion (aft2Δ/Δ). (b) Candida albicans SC5314 cells were cultured in RPMI 1640 medium with MPD for 10 h. The cells were stained with FeRhonox-1 and observed with a fluorescence microscope. The scale bar indicates 50 μm. (c) The OD600 of SC5314 cells was detected after growing at 30 °C for 24 h under the action of different doses of FeSO4 and MPD. (d) Effect of MPD on the expression of iron homeostasis-related genes. The data is represented as mean ± SD. Asterisks represent statistically significant differences. * means P < 0.05; ** means P < 0.01.
We subsequently measured the intracellular iron concentrations of C. albicans by employing the FeRhoNox-1 fluorescent probe. When C. albicans SC5314 cells were exposed to a concentration of 2 μg/mL of MPD, a notable reduction in the levels of active ferrous ions within the cells was observed, as compared to the cells that were not treated (Figure 5b).
The exogenous FeSO4 was combined with MPD to determine whether the intracellular iron level contributes to the antifungal activity of MPD. As shown in Figure 5c, a gradual decrease in the antifungal efficacy of MPD was observed when exposed to higher concentrations of iron (FeSO4).
We investigated the expression of three iron permease genes, namely FTR1, FTR2, and FTH1, as well as two ferroxidase genes, FET34 and FET99, in response to MPD treatment (Figure 5d). The MPD treatment group showed a decrease in the expression of FTR1, FTH1, and FTR2 genes, and an increase in the expression of FET34 and FET99 genes. The results showed that MPD changed the expression of genes associated with iron transporters, leading to a decrease in the amount of iron available inside the cells and disrupting the balance of iron ions in C. albicans.
3.7. MPD inhibits the ergosterol biosynthesis
Ergosterol, which is found in the cell membrane, directly interacts with the phospholipid membrane to control the permeability, fluidity, and transport of materials across the cell membrane (Sun and Liao 2020). As reported in previous studies, the production of ergosterol, a vital element of the cell membrane in fungi, relies on iron for four specific enzymatic processes (Jordá et al. 2022). Due to the potential disruption of intracellular iron ion balance by MPD, as well as its impact on the plasma membrane pathway according to the results of the GO analysis, we conducted measurements of ergosterol levels in cells treated with varying concentrations of MPD. Figures 6a,b demonstrated a significant reduction in the ergosterol content due to the application of MPD. When compared to the control group, the ergosterol contents decreased by 11.33%, 58.77%, and 70.15% in the groups treated with 0.5, 1, and 2 μg/mL of MPD, respectively. Additionally, the positive control group treated with FLC showed a reduction of 85.33% in ergosterol content. Furthermore, we assessed the expression levels of genes related to ergosterol synthesis (ERG1, ERG3, ERG6, ERG9, ERG24, ERG25, and ERG26). As shown in Figure 6c, the expression of all genes was significantly down-regulated. This aligns with the findings from the transcriptome sequencing analysis. Thus, these findings suggest that MPD can suppress the biosynthesis of cell membranes.
Figure 6.

Effect of the maleimide compound 5 [1-(4-methoxyphenyl)-1hydro-pyrrole-2,5-dione, MPD] on the cell membrane. (a) Ultraviolet scanning spectrum of total sterol extracted after MPD treatment (200–320 nm). (b) The reductions of ergosterol levels induced by various doses of MPD. (c) The relative expression of ergosterol biosynthesis-related genes was determined by RT-qPCR. (d) The propidium iodide (PI) staining results of Candida albicans SC5314 after different treatments were observed by fluorescence microscope. The scale bar indicates 50 μm. (e) Treated cells were stained with PI and their staining rate was calculated. (f) C. albicans SC5314 cells were treated with various doses of MPD for 12 h, followed by DPH staining for detection using a fluorescence spectrophotometer. (g) Effect of MPD on the intracellular trehalose content. (h) Effect of MPD on the extracellular trehalose content. The data is represented as mean ± SD. Asterisks represent statistically significant differences. *means P < 0.05.
3.8. MPD destroys the cell membrane integrity
The dye PI, which can pass through certain membranes, was utilised to measure the impact of MPD on the permeability of the cell membrane (Erecińska and Wilson 1977). As shown in Figures 6d,e, the quantity of PI-stained cells escalated in a manner directly proportional to the dosage of MPD administered. When compared to the control group, the application of MPD treatment at concentrations of 4 and 8 μg/mL resulted in a significant increase in the proportion of stained cells. The percentages of stained cells in the treatment groups with concentrations of 2, 4, and 8 μg/mL were 16.00%, 69.67%, and 79.12%, respectively (Figure 6e). The membrane fluorescent dye DPH was employed to indicate alterations in the fluidity and organisation of the cell membrane (Lee and Kim 2020). Figure 6f demonstrated a dose-dependent decrease in the relative fluorescence intensity of DPH following MPD treatment. Moreover, at concentrations of 0.5, 1, and 2 μg/mL, MPD exhibited a reduction in relative fluorescence intensity to 92.00%, 45.67%, and 34.67%, respectively, when compared to the control group. These results demonstrated that MPD has the potential to impair the permeability and dynamics of the cell membrane.
3.9. MPD results in the leakage of intracellular trehalose
Trehalose functions as a signalling molecule that controls specific metabolic pathways and safeguards cellular proteins or membranes from being deactivated under stressful conditions (Perfect et al. 2017). The findings demonstrated a dose-dependent decrease in intracellular trehalose content following MPD treatment (Figure 6g). The control group had an intracellular trehalose content of 2.41 mg/g, whereas the 0.5, 1, and 2 μg/mL MPD groups had trehalose contents of 2.08 mg/g, 0.73 mg/g, and 0.42 mg/g, respectively. Conversely, the administration of MPD led to a proportional rise in the amount of trehalose found outside the cells. The control group had a trehalose content of 0.91 mg/g, whereas the groups treated with 0.5, 1, and 2 μg/mL of MPD had trehalose contents of 1.14 mg/g, 3.26 mg/g, and 4.52 mg/g, respectively (Figure 6h). The release of intracellular trehalose substantiated the heightened permeability of the cell membrane.
The aforementioned findings demonstrate that MPD can diminish the biosynthesis of cell membrane components and disrupt the structural integrity and permeability of cell membranes, leading to the release of intracellular substances. This also adequately elucidated the disruption of iron ion homoeostasis caused by MPD treatment.
3.10. MPD inhibits the biosynthesis of cell wall
The GO analysis result indicates that exposure to MPD has an impact on the cell wall pathway. Given that chitin is a vital constituent of the fungal cell wall (Walker et al. 2015), we observed alterations in chitin synthase activity in response to MPD treatment. Figure 7a demonstrates that the chitin synthase activity decreased by 33.56%, 38.92%, 42.41%, and 66.34% when treated with 0.5, 1, 2, and 4 μg/mL of MPD, respectively, in comparison to the control group. Subsequently, we measured the levels of expression of CHS1, CHS2, CHS3, and CHS8, which are associated with chitin synthesis. The findings depicted in Figure 7b indicate that the expression of all genes, except for CHS8, exhibited a downward trend. This outcome aligns with that of the transcriptome. Furthermore, calcofluor white (CFW), a fluorescent dye that specifically targets chitin, was employed to visually observe the entire chitin content. The fluorescence intensity exhibited a reduction of 24.38%, 41.56%, and 45.37% in the 1, 2, and 4 μg/mL MPD treatment groups, respectively, when compared to the control (Figure 7c). As shown in Figure 7d, the CFW staining morphology in the control group exhibited a well-defined cell outline, whereas, in the treatment group, it displayed a dispersed shape and a gradual reduction in fluorescence intensity.
Figure 7.

Effects of the maleimide compound 5 [1-(4-methoxyphenyl)-1hydro-pyrrole-2,5-dione, MPD] on the cell wall. (a) Effect of MPD on chitin synthase. (b) Showed the effect of MPD on the expression of chitin-related genes. (c) Treated cells were stained with calcofluor white (CFW) and spectrofluorophotometer detection. (d) The CFW staining results of Candida albicans SC5314 after different treatments were observed by fluorescence microscope. The scale bar indicates 50 μm. (e) The OD600 of SC5314 cells was detected after growing at 30 °C for 24 h under the action of different doses of CFW and MPD. (f) C. albicans SC5314 cells were adjusted to 1 × 105 cells/mL in SD medium and treated with 1 μg/mL MPD. After adding 0.8 mol/L sorbitol, it was incubated at 30 °C for 25 h. The growth curve was drawn by detecting OD600. The data is represented as mean ± SD. Asterisks represent statistically significant differences. *means P < 0.05; **means P < 0.01; ***means P < 0.005.
CFW exhibits the ability to stain chitin in the cell wall and cause damage to the fungal cell wall when present in high concentrations (Dong et al. 2023). Our investigation revealed that a high dosage of CFW significantly increased the effectiveness of MPD in inhibiting fungal growth (Figure 7e). Subsequently, we investigated how the cell wall protective agent sorbitol on the fungistatic ability of MPD. As shown in Figure 7f, the fungistatic ability of MPD was significantly weakened in the case of 0.8 mol/L sorbitol. The aforementioned findings suggest that MPD has the potential to impact the production of chitin by impeding the function of chitin synthase, consequently leading to the destruction of the cell wall.
3.11. MPD improves the nematodes’ survival in C. elegans -C. albicans infection model
We also employed the C. elegans-C. albicans infection model to further explore the in vivo antifungal efficacy of MPD. The findings indicated that the presence of 1, 2, 4, and 8 μg/mL MPD did not have a discernible impact on the well-being of the nematodes after 2 days of cultivation (Figure 8a). The survival curve demonstrated that the survival time of the infected nematode with MPD-treated was greater than that of the control group (Figure 8b), indicating the therapeutic efficacy of MPD in vivo. The data indicated the potential use of MPD for treating C. albicans infections in vivo.
Figure 8.

The Caenorhabditis elegans-Candida albicans infection model. (a) Healthy nematodes were cultured with different concentrations of the maleimide compound 5 [1-(4-methoxyphenyl)-1hydro-pyrrole-2,5-dione, MPD] or without it for 2 days. (b) Nematodes were infected with C. albicans SC5314 for 2 h and then transferred to a liquid medium with different concentrations of MPD; the group without MPD served as a negative control.
4. Discussion
Synthetic maleimides have been reported to exhibit remarkable antimicrobial properties, as well as minimal toxicity towards healthy human cells. For instance, Chen et al. reported the synthesis of 45 maleimides that exhibited anti-leishmania activity and were non-toxic to human monocytic leukaemia cells when used at the appropriate concentration (Fan et al. 2018). In addition, Sortino et al. (2011) synthesised a range of N-alkyl, N-aryl, and N-alkyl phenyl-1,4-pyrrolediones, and demonstrated that the majority of the active compounds exhibited no cytotoxicity against human cancer cell lines and had no haemolytic activity. Furthermore, our previous study also validated the low cytotoxicity of these compounds towards cell lines, erythrocytes, and Galleria mellonella (Li et al. 2023). Correspondingly, the present study involved the screening of a small molecule library of N-substituted maleimide and their derivatives to identify compounds with antifungal activity and investigate their mechanism of action.
Earlier studies show that the majority of invasive candidiasis cases (>95%) are caused by the following five pathogens: C. albicans, C. glabrata, C. tropicalis, C. parapsilosis, and C. krusei (Al Thaqafi et al. 2014). The present study involved the screening of 12 maleimide compounds for their antifungal activity against the five most prevalent pathogenic Candida species. One of the compounds, MPD, demonstrated superior anti-C. albicans activity similar to FLC (Orozco et al. 1998). Furthermore, it was able to effectively inhibit the growth of naturally occurring azole-resistant C. krusei strain (CK1) and clinically isolated azole-resistant C. albicans strain (CA10).
Given the potent antifungal properties and minimal harm to cells exhibited by maleimide compounds, we were encouraged to investigate their antifungal mechanisms in greater detail. Correspondingly, the analysis of the transcription profile revealed the down-regulation of genes associated with iron utilisation in response to MPD treatment. The primary iron-dependent transcriptional regulatory system of C. albicans is the negative regulatory system facilitated by the GATA transcription inhibitor harbouring a zinc finger structure (Hameed et al. 2020). Herein, the transcription factors Sef1, Sfu1, and Hap43 exhibit strong interactions, collectively establishing a complex regulatory circuit that contributes to the maintenance of intracellular iron homoeostasis (Chen et al. 2011). Furthermore, Sef1 can directly initiate the expression of HAP43 and genes associated with iron absorption. MPD-induced iron deficiency upregulates SEF1, resulting in the upregulation of HAP43. Both of these genes comprise inhibitory factors that result in the downregulation of the downstream genes involved in iron uptake. This suggests that MPD could potentially impact the level of iron available to fungi.
A prior investigation employed chemogenomic profiling to investigate the potential mechanism of action of the target compounds (Mohammad et al. 2018). This approach is based on the principle that small molecules have decreased targeting activity in heterozygous deletion strains. Consequently, focusing on specific activities and the corresponding elimination strains resulted in a higher vulnerability to growth compared to strains with deletions in the entire genome. Aft2p can stimulate the expression of genes that are involved in the utilisation of intracellular iron and iron homoeostasis (Poor et al. 2014). Moreover, the removal of aft2 did not impact its capacity for proliferation. Thus, the difference in the growth curves observed between the wild-type and aft2Δ/Δ strains of S. cerevisiae suggests that MPD induces disruption in iron homoeostasis. Disruptions in metal ion homoeostasis typically alter the cellular concentration of available ions (Duan et al. 2022). Thus, treatment with MPD resulted in a reduction of intracellular iron levels in C. albicans cells. As observed, these findings indicate that MPD exerts antifungal activity by reducing intracellular concentrations of available iron.
Iron chelators have been found to disrupt sterol synthesis and decrease the amount of ergosterol in C. albicans (Jordá and Puig 2020). Treatment with MPD resulted in a reduction in intracellular iron concentration, which in turn hindered the synthesis of ergosterol. It is worth noting that MPD was previously believed to lack any functional groups capable of binding to iron. However, the transcription profile and RT-qPCR results demonstrated the downregulation of genes involved in ergosterol biosynthesis (ERG1, ERG3, ERG4, ERG6, ERG9, and ERG10), thereby confirming the reduction in ergosterol synthesis at the molecular level. Ergosterol, being the primary constituent of the fungal cell membrane, regulates the flexibility and transportability of cells. The analysis of the transcription profile also revealed a down-regulation in the expression of genes encoding membrane proteins involved in substance transport (HGT5, HGT6, and SNG3) and membrane stability maintenance (OBPA and STT4) following MPD treatment. This suggests that MPD could potentially impact fungal cell membranes. Moreover, the reduction in DPH fluorescence intensity and the increase in the number of PI-stained cells indicate that MPD can disrupt the cell membrane’s structure, resulting in heightened permeability and compromised integrity of the cell membrane. The damage to the cell membrane resulted in the release of intracellular substances, leading to a decrease in intracellular trehalose and an increase in extracellular trehalose.
While the cell membrane acts as a barrier between C. albicans and the outside world, it also has indirect contact with the external environment. The cell wall, situated outside the cell membrane, serves as a physical and chemical barrier that directly interfaces with the external environment. The interaction between fungi and hosts is influenced by cell wall-associated proteins, which are recognised by the host immune cells and result in cell wall remodelling. Cell wall proteins also participate in the regulation of adhesion and invasion. The transcriptomic data obtained in this study revealed that MPD significantly down-regulates the expression of virulence-associated genes involved in filamentous growth, adhesion, and biofilm formation in C. albicans, which suggests that MPD has the potential to suppress the pathogenicity of Candida (Jabra-Rizk et al. 2016). This conclusion was validated in our previous study (Li et al. 2023). Accordingly, MPD demonstrated significant efficacy in inhibiting the development of biofilms created by a diverse population of C. albicans and non-albicans Candida. This finding confirms the potential of MPD in addressing intricate fungal infections.
The process of cell wall remodelling is contingent upon the interaction between the cell membrane and the cell wall. Before reaching the cell membrane, drugs must first interact with the cell wall. Upon entering the cell wall, the drug alters the cell membrane, resulting in a noticeable impact on the structure of the cell wall. Previous studies have demonstrated that when C. albicans is exposed to azoles that specifically target the synthesis of ergosterol, it has an impact on the process of chitin biosynthesis and deposition (Milewski et al. 1991). The cell wall of C. albicans is composed of two primary layers: An internal layer formed by the interconnection of chitin and glucan, and an external layer consisting of mannan fibrils that are covalently attached to the inner layer via anchoring mannoproteins (Childers et al. 2020). The inner layer is the closest to the cell membrane. Prior research has demonstrated that maleimide compounds effectively hinder the functioning of β-(1,3)-glucan synthase in C. albicans, thereby disrupting the integrity of the cell wall (Heasley et al. 2012). Nevertheless, research was scarce regarding the impact of maleimide on chitin. The transcription data of the present study revealed that CHS8, which is a gene responsible for synthesising chitin during cell wall regeneration, exhibited a compensatory increase in expression in response to stress. Additionally, the expression of CHS3, the gene responsible for encoding the primary chitin synthase in yeast and mycelium, was reduced following treatment with MPD (Lenardon et al. 2007). Moreover, the administration of MPD resulted in a reduction in the functioning of chitin synthase, leading to an alteration in the typical arrangement of chitin in the cell wall. This indicates an additional detrimental impact of maleimides on the fungal cell wall. Furthermore, MNN22, identified as the α-1,2-mannosyltransferase gene, exhibited susceptibility to substances that disrupt the cell wall (Hall et al. 2013). The increased expression of MNN22 suggested that the fungal cell wall experienced disruption. Moreover, the addition of external cell wall stabilisers diminished the antifungal potency of MPD, suggesting that MPD achieves its antifungal impact by causing cell wall destruction.
To summarise, this study represents the primary investigation into the intricate antifungal mechanism of maleimide compounds. Accordingly, MPD was found to alter the normal expression of iron uptake genes, resulting in a significant decrease in intracellular iron levels. This decrease inhibits the synthesis of ergosterol, which in turn increases cell membrane permeability and causes leakage of intracellular materials. The interaction between the cell membrane and the cell wall subsequently results in a decrease in the chitin content of the cell wall, as well as compromising the stability of the cell wall. Eventually, the destruction of the cell membrane and cell wall exacerbates the release of cell contents, finally resulting in cell death.
5. Conclusions
The present study aimed to clarify the potential mechanism of action of the maleimide derivative MPD against C. albicans. As evident from the findings, the MPD interfered with intercellular iron ion homoeostasis in C. albicans, ruptured the cell wall structure, and disrupted the cell membrane permeability. Correspondingly, the fungicidal activity of MPD was primarily attributed to the destruction of the cell membrane and subsequent leakage of intracellular substances. Thus, the present study successfully elucidates the antifungal molecular mechanism of MPD in vitro. However, to explore its potential biomedical applications, additional in vivo studies involving murine models are required to assess its biocompatibility and better understand its mode of action.
Supplementary Material
Acknowledgments
The experiments in this article were completed in the Public Experimental Research Centre of Xuzhou Medical University, and we thank the teachers for their support and help during the experiments.
Correction Statement
This article has been corrected with minor changes. These changes do not impact the academic content of the article.
Funding Statement
This work was supported by the National Natural Science Foundation of China (81902040), Xuzhou Key Research and Development Program for Social Development (KC23248), National Natural Science Foundation of China (82273975), Xuzhou Application Foundation Project (KC23009), Fusion Innovation Project of Xuzhou Medical University (XYRHCX2021015), and Scientific and Technological Projects of Henan Province (212102310311).
Disclosure statement
No potential conflict of interest was reported by the author(s).
Data availability statement
BioProject ID: PRJNA1010997. Database link: https://www.ncbi.nlm.nih.gov/bioproject/?term=PRJNA1010997. Other datasets generated for this study are included in this article.
Supplemental data
Supplemental data for this article can be accessed online at https://doi.org/10.1080/21501203.2024.2330403.
References
- Alexander BD, Byrne TC, Smith KL, Hanson KE, Anstrom KJ, Perfect JR, Reller LB.. 2007. Comparative evaluation of Etest and sensititre yeastone panels against the Clinical and Laboratory Standards Institute M27-A2 reference broth microdilution method for testing Candida susceptibility to seven antifungal agents. J Clin Microbiol. 45(3):698–706. doi: 10.1128/JCM.01840-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ali B, Kanda Kupa LD, Heluany CS, Drewes CC, Vasconcelos SNS, Farsky SHP, Stefani HA. 2017. Cytotoxic effects of a novel maleimide derivative on epithelial and tumor cells. Bioorg Chem. 72(3):199–207. doi: 10.1016/j.bioorg.2017.04.013. [DOI] [PubMed] [Google Scholar]
- Al Thaqafi AH, Farahat FM, Al Harbi MI, Al Amri AF, Perfect JR. 2014. Predictors and outcomes of Candida bloodstream infection: eight-year surveillance, western Saudi Arabia. Int J Infect Dis. 21:5–9. doi: 10.1016/j.ijid.2013.12.012. [DOI] [PubMed] [Google Scholar]
- Arendrup MC, Patterson TF. 2017. Multidrug-resistant Candida: Epidemiology, molecular mechanisms, and treatment. J Infect Dis. 216(suppl_3):S445–S451. doi: 10.1093/infdis/jix131. [DOI] [PubMed] [Google Scholar]
- Arthington-Skaggs BA, Jradi H, Desai T, Morrison CJ. 1999. Quantitation of ergosterol content: novel method for determination of fluconazole susceptibility of Candida albicans. J Clin Microbiol. 37(10):3332–3337. doi: 10.1128/JCM.37.10.3332-3337.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Brown GD, Denning DW, Gow NA, Levitz SM, Netea MG, White TC. 2012. Hidden killers: Human fungal infections. Sci Transl Med. 4(165):165rv113. doi: 10.1126/scitranslmed.3004404. [DOI] [PubMed] [Google Scholar]
- Cervera C. 2012. Candidemia and invasive candidiasis in the adult: clinical forms and treatment. Enferm Infecc Microbiol Clin. 30(8):483–491. doi: 10.1016/j.eimc.2012.02.003. [DOI] [PubMed] [Google Scholar]
- Chaudhary PM, Tupe SG, Deshpande MV. 2013. Chitin synthase inhibitors as antifungal agents. Mini Rev Med Chem. 13(2):222–236. doi: 10.2174/1389557511313020005. [DOI] [PubMed] [Google Scholar]
- Chen C, Pande K, French SD, Tuch BB, Noble SM. 2011. An iron homeostasis regulatory circuit with reciprocal roles in Candida albicans commensalism and pathogenesis. Cell Host Microbe. 10(2):118–135. doi: 10.1016/j.chom.2011.07.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Childers DS, Avelar GM, Bain JM, Larcombe DE, Pradhan A, Budge S, Heaney H, Brown AJP. 2020. Impact of the environment upon the Candida albicans cell wall and resultant effects upon immune surve illance. Curr Top Microbiol. 425:297–330. doi: 10.1007/82_2019_182. [DOI] [PubMed] [Google Scholar]
- Choi JW, Lee KT, Kim S, Lee YR, Kim HJ, Seo KJ, Lee MH, Yeon SK, Jang BK, Park SJ, et al. 2021. Optimization and evaluation of novel antifungal agents for the treatment of fungal infection. J Med Chem. 64(21):15912–15935. doi: 10.1021/acs.jmedchem.1c01299. [DOI] [PubMed] [Google Scholar]
- Courel M, Lallet S, Camadro JM, Blaiseau PL. 2005. Direct activation of genes involved in intracellular iron use by the yeast iron-responsive transcription factor Aft2 without its paralog Aft1. Mol Cell Biol. 25(15):6760–6771. doi: 10.1128/MCB.25.15.6760-6771.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dong Y, Du J, Deng Y, Cheng M, Shi Z, Zhu H, Sun H, Yu Q, Li M. 2023. Reduction of histone proteins dosages increases CFW sensitivity and attenuates virulence of Candida albicans. Microbiol Res. 279(23):127552. doi: 10.1016/j.micres.2023.127552. [DOI] [PubMed] [Google Scholar]
- Duan X, Xie Z, Ma L, Jin X, Zhang M, Xu Y, Liu Y, Lou H, Chang W, Nielsen K. 2022. Selective metal chelation by a thiosemicarbazone derivative interferes with mitochondrial respiration and ribosome biogenesis in Candida albicans. Microbiol Spectr. 10(3):e0195121. doi: 10.1128/spectrum.01951-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dymond JS. 2013. Saccharomyces cerevisiae growth media. Meth Enzymol. 533:191–204. doi: 10.1016/B978-0-12-420067-8.00012-X. [DOI] [PubMed] [Google Scholar]
- Erecińska M, Wilson DF. 1977. On the mechanism of regulation of cellular respiration. The dependence of respiration on the cytosolic [ATP], [ADP] and [PI]. Adv Exp Med Biol. 94:271–278. doi: 10.1007/978-1-4684-8890-6_36. [DOI] [PubMed] [Google Scholar]
- Fan Y, Lu Y, Chen X, Tekwani B, Li XC, Shen Y. 2018. Anti-leishmanial and cytotoxic activities of a series of maleimides: synthesis, biological evaluation and structure-activity relationship. Mol. 23(11):2878. doi: 10.3390/molecules23112878. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ge Z, Ji Q, Chen C, Liao Q, Wu H, Liu X, Huang Y, Yuan L, Liao F. 2016. Synthesis and biological evaluation of novel 3-substituted amino-4-hydroxylcoumarin derivatives as ch itin synthase inhibitors and antifungal agents. J Enzyme Inhib Med Chem. 31(2):219–228. doi: 10.3109/14756366.2015.1016511. [DOI] [PubMed] [Google Scholar]
- Hall RA, Bates S, Lenardon MD, Maccallum DM, Wagener J, Lowman DW, Kruppa MD, Williams DL, Odds FC, Brown AJ, et al. 2013. The Mnn2 mannosyltransferase family modulates mannoprotein fibril length, immune recognition and virulence of Candida albicans. PLoS Pathog. 9(4):e1003276. doi: 10.1371/journal.ppat.1003276. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hameed S, Hans S, Singh S, Fatima Z. 2020. Harnessing metal homeostasis offers novel and promising targets against Candida albicans. Curr Drug Discov Technol. 17(4):415–429. doi: 10.2174/1570163816666190227231437. [DOI] [PubMed] [Google Scholar]
- Haralampiev I, Mertens M, Schwarzer R, Herrmann A, Volkmer R, Wessig P, Müller P. 2015. Recruitment of SH-containing peptides to lipid and biological membranes through the use of a palmitic acid functionalized with a maleimide group. Angew Chem Int Edit. 54(1):323–326. doi: 10.1002/anie.201408089. [DOI] [PubMed] [Google Scholar]
- Hara S, Nojima T, Seio K, Yoshida M, Hisabori T. 2013. DNA-maleimide: an improved maleimide compound for electrophoresis-based titration of reactive thiols in a specific protein. Biochim Biophys Acta. 1830(4):3077–3081. doi: 10.1016/j.bbagen.2013.01.012. [DOI] [PubMed] [Google Scholar]
- Heasley BH, Pacofsky GJ, Mamai A, Liu H, Nelson K, Coti G, Peel MR, Balkovec JM, Greenlee ML, Liberator P, et al. 2012. Synthesis and biological evaluation of antifungal derivatives of enfumafungin as orally bioavailable inhibitors of β-1,3-glucan synthase. Bioorg Med Chem Lett. 22(22):6811–6816. doi: 10.1016/j.bmcl.2012.05.031. [DOI] [PubMed] [Google Scholar]
- Hwang B, Cho J, Hwang IS, Jin HG, Woo ER, Lee DG. 2011. Antifungal activity of lariciresinol derived from Sambucus williamsii and their membrane-active mechanisms in Candida albicans. Biochem Bioph Res Co. 410(3):489–493. doi: 10.1016/j.bbrc.2011.06.004. [DOI] [PubMed] [Google Scholar]
- Jabra-Rizk MA, Kong EF, Tsui C, Nguyen MH, Clancy CJ, Fidel PL, Noverr M, Maurelli AT. 2016. Candida albicans pathogenesis: fitting within the host-microbe damage response framework. Infect Immun. 84(10):2724–2739. doi: 10.1128/IAI.00469-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jordá T, Barba-Aliaga M, Rozès N, Alepuz P, Martínez-Pastor MT, Puig S. 2022. Transcriptional regulation of ergosterol biosynthesis genes in response to iron deficiency. Environ Microbiol. 24(11):5248–5260. doi: 10.1111/1462-2920.16157. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jordá T, Puig S. 2020. Regulation of ergosterol biosynthesis in Saccharomyces cerevisiae. Genes. 11(7):795. doi: 10.3390/genes11070795. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kalgutkar AS, Crews BC, Marnett LJ. 1996. Design, synthesis, and biochemical evaluation of N-substituted maleimides as inhibitors of prostaglandin endoperoxide synthases. J Med Chem. 39(8):1692–1703. doi: 10.1021/jm950872p. [DOI] [PubMed] [Google Scholar]
- Kojima K, Yakushiji F, Katsuyama A, Ichikawa S. 2020. Total synthesis of echinomycin and its analogues. Org Lett. 22(11):4217–4221. doi: 10.1021/acs.orglett.0c01268. [DOI] [PubMed] [Google Scholar]
- Koselny K, Green J, DiDone L, Halterman JP, Fothergill AW, Wiederhold NP, Patterson TF, Cushion MT, Rappelye C, Wellington M, et al. The celecoxib derivative AR-12 has broad-spectrum antifungal activity in vitro and improves the activity of fluconazole in a murine model of Cryptococcosis. Antimicrob Agents Chemother. 2016;60(12):7115–7127. doi: 10.1128/AAC.01061-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lee HS, Kim Y. 2017. Paeonia lactiflora inhibits cell wall synthesis and triggers membrane depolarization in Candida albicans. J Microbiol Biotechnol. 27(2):395–404. doi: 10.4014/jmb.1611.11064. [DOI] [PubMed] [Google Scholar]
- Lee HS, Kim Y. 2020. Aucklandia lappa causes membrane permeation of Candida albicans. J Microbiol Biotechnol. 30(12):1827–1834. doi: 10.4014/jmb.2009.09044. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lenardon MD, Whitton RK, Munro CA, Marshall D, Gow NA. 2007. Individual chitin synthase enzymes synthesize microfibrils of differing structure at specific locatio ns in the Candida albicans cell wall. Mol Microbiol. 66(5):1164–1173. doi: 10.1111/j.1365-2958.2007.05990.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Leonardelli F, Macedo D, Dudiuk C, Cabeza MS, Gamarra S, Garcia-Effron G. 2016. Aspergillus fumigatus intrinsic fluconazole resistance is due to the naturally occurring T301I substitution in Cyp51Ap. Antimicrob Agents Chemother. 60(9):5420–5426. doi: 10.1128/AAC.00905-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li Y, Chang W, Zhang M, Li X, Jiao Y, Lou H, Sturtevant J. 2015. Diorcinol D exerts fungicidal action against Candida albicans through cytoplasm membrane destruction and ROS accumulation. PLoS One. 10(6):e0128693. doi: 10.1371/journal.pone.0128693. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li Y, Chen C, Cong L, Mao S, Shan M, Han Z, Mao J, Xie Z, Zhu Z. 2023. Inhibitory effects of a maleimide compound on the virulence factors of Candida albicans. Virulence. 14(1):2230009. doi: 10.1080/21505594.2023.2230009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li Y, Du M, Chen LA, Liu Y, Liang Z. 2016. Nosocomial bloodstream infection due to Candida spp. in China: Species distribution, clinical features, and outcomes. Mycopathologia. 181(7–8):485–495. doi: 10.1007/s11046-016-9997-3. [DOI] [PubMed] [Google Scholar]
- Li Y, Sun H, Zhu X, Bian C, Wang Y, Si S. 2019. Identification of new antifungal agents targeting chitin synthesis by a chemical-genetic method. Molecules. 24(17):3155. doi: 10.3390/molecules24173155. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Marena GD, Ramos M, Lima LC, Chorilli M, Bauab TM. 2022. Galleria mellonella for systemic assessment of anti-Candida auris using amphotericin B loaded in nanoemulsion. Sci Total Environ. 807(Pt 3):151023. doi: 10.1016/j.scitotenv.2021.151023. [DOI] [PubMed] [Google Scholar]
- McCarty TP, White CM, Pappas PG. 2021. Candidemia and invasive candidiasis. Infect Dis Clin North Am. 35(2):389–413. doi: 10.1016/j.idc.2021.03.007. [DOI] [PubMed] [Google Scholar]
- Milewski S, Mignini F, Borowski E. 1991. Synergistic action of nikkomycin X/Z with azole antifungals on Candida albicans. J Gen Microbiol. 137(9):2155–2161. doi: 10.1099/00221287-137-9-2155. [DOI] [PubMed] [Google Scholar]
- Millsop JW, Fazel N. 2016. Oral candidiasis. Clin Dermatol. 34(4):487–494. doi: 10.1016/j.clindermatol.2016.02.022. [DOI] [PubMed] [Google Scholar]
- Mohammad H, Elghazawy NH, Eldesouky HE, Hegazy YA, Younis W, Avrimova L, Hazbun T, Arafa RK, Seleem MN. 2018. Discovery of a novel dibromoquinoline compound exhibiting potent antifungal and antivirulence activity that targets metal ion homeostasis. ACS Infect Dis. 4(3):403–414. doi: 10.1021/acsinfecdis.7b00215. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nanda JS, Lorsch JR. 2014. Labeling of a protein with fluorophores using maleimide derivitization. Meth Enzymol. 536(4):79–86. doi: 10.1016/B978-0-12-420070-8.00007-6. [DOI] [PubMed] [Google Scholar]
- Orozco AS, Higginbotham LM, Hitchcock CA, Parkinson T, Falconer D, Ibrahim AS, Ghannoum MA, Filler SG. 1998. Mechanism of fluconazole resistance in Candida krusei. Antimicrob Agents Chemother. 42(10):2645–2649. doi: 10.1128/AAC.42.10.2645. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Orozco F, Niyazov Z, Garnier T, Migliore N, Zdvizhkov AT, Raffa P, Moreno-Villoslada I, Picchioni F, Bose RK. 2021. Maleimide self-reaction in furan/maleimide-based reversibly crosslinked polyketones: Processing limitation or potential advantage? Molecules. 26(8):2230. doi: 10.3390/molecules26082230. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Perfect JR, Tenor JL, Miao Y, Brennan RG. 2017. Trehalose pathway as an antifungal target. Virulence. 8(2):143–149. doi: 10.1080/21505594.2016.1195529. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Poor CB, Wegner SV, Li H, Dlouhy AC, Schuermann JP, Sanishvili R, Hinshaw JR, Riggs-Gelasco PJ, Outten CE, He C. 2014. Molecular mechanism and structure of the Saccharomyces cerevisiae iron regulator Aft2. Proc Natl Acad Sci USA. 111(11):4043–4048. doi: 10.1073/pnas.1318869111. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sortino M, Cechinel Filho V, Corrêa R, Zacchino S. 2008. N-Phenyl and N-phenylalkyl-maleimides acting against Candida spp.: Time-to-kill, stability, interaction with maleamic acids. Bioorgan Med Chem. 16(1):560–568. doi: 10.1016/j.bmc.2007.08.030. [DOI] [PubMed] [Google Scholar]
- Sortino M, Garibotto F, Cechinel Filho V, Gupta M, Enriz R, Zacchino S. 2011. Antifungal, cytotoxic and SAR studies of a series of N-alkyl, N-aryl and N-alkylphenyl-1,4-pyrrolediones and related compounds. Bioorgan Med Chem. 19(9):2823–2834. doi: 10.1016/j.bmc.2011.03.038. [DOI] [PubMed] [Google Scholar]
- Sun L, Cheng A, Wu X, Zhang H, Lou H. 2010. Synergistic mechanisms of retigeric acid B and azoles against Candida albicans. J Appl Microbiol. 108(1):341–348. doi: 10.1111/j.1365-2672.2009.04429.x. [DOI] [PubMed] [Google Scholar]
- Sun L, Liao K. 2020. The effect of honokiol on ergosterol biosynthesis and vacuole function in Candida albicans. J Microbiol Biotechn. 30(12):1835–1842. doi: 10.4014/jmb.2008.08019. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Thangamani S, Maland M, Mohammad H, Pascuzzi PE, Avramova L, Koehler CM, Hazbun TR, Seleem MN. 2017. Repurposing approach identifies auranofin with broad spectrum antifungal activity that targets Mia40-Erv1 pathway. Front Cell Infect Microbiol. 7:4. doi: 10.3389/fcimb.2017.00004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Walker LA, Lee KK, Munro CA, Gow NA. 2015. Caspofungin treatment of Aspergillus fumigatus results in ChsG-dependent upregulation of chitin synthesis and the formation of chitin-rich microcolonies. Antimicrob Agents Chemother. 59(10):5932–5941. doi: 10.1128/AAC.00862-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wisplinghoff H, Bischoff T, Tallent SM, Seifert H, Wenzel RP, Edmond MB. 2004. Nosocomial bloodstream infections in US hospitals: Analysis of 24,179 cases from a prospective nationwide surveillance study. Clin Infect Dis. 39(3):309–317. doi: 10.1086/421946. [DOI] [PubMed] [Google Scholar]
- Wu XZ, Cheng AX, Sun LM, Lou HX. 2008. Effect of plagiochin E, an antifungal macrocyclic bis(bibenzyl), on cell wall chitin synthesis in Candida albicans. Acta Pharmacol Sin. 29(12):1478–1485. doi: 10.1111/j.1745-7254.2008.00900.x. [DOI] [PubMed] [Google Scholar]
- Wu S, Wang Y, Liu N, Dong G, Sheng C. 2017. Tackling fungal resistance by biofilm inhibitors. J Med Chem. 60(6):2193–2211. doi: 10.1021/acs.jmedchem.6b01203. [DOI] [PubMed] [Google Scholar]
- Xie Z, Li F, Niu L, Li H, Zheng J, Han R, Ju Z, Li S, Li D. 2020. CuBr/NHPI co-catalyzed aerobic oxidative [3 + 2] cycloaddition-aromatization to access 5,6-dihydro-pyrrolo[2,1-a]isoquinolines. Org Biomol Chem. 18(35):6889–6898. doi: 10.1039/d0ob01403f. [DOI] [PubMed] [Google Scholar]
- Zhou Y, Wang G, Li Y, Liu Y, Song Y, Zheng W, Zhang N, Hu X, Yan S, Jia J. 2012. In vitro interactions between aspirin and amphotericin B against planktonic cells and biofilm cells of Candida albicans and C. parapsilosis. Antimicrob Agents Chemother. 56(6):3250–3260. doi: 10.1128/AAC.06082-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
BioProject ID: PRJNA1010997. Database link: https://www.ncbi.nlm.nih.gov/bioproject/?term=PRJNA1010997. Other datasets generated for this study are included in this article.
