TABLE 1.

Sequence characteristics of 100 L1s in cultured cells^a

Clone no.	Typeb	Extrac	Length (bp)d	Cleavagee	TSDf (bp)	Del. or dupl.
1	Full length	5′ untemplated (G)	6,090	TCTT/A	13
2	Full length	5′ untemplated (G)	6,090	TTTC/A	10
3	Full length		5,984	TTTT/A	13
4	Full length		5,428	TCTT/A	15
5	Full length		5,986	TTTT/A	17
6	Full length		3,123	TTTA/A	15
7	5′ truncation	5′ duplication (6/11 nt)	472	TTTT/A	67
8	5′ truncation	5′ templated seq. palindrome	27	TTTT/G	Del. 3
9	5′ truncation	5′ untemplated (A)	281	TTTT/C	6,319
10	5′ truncation	5′ untemplated (A)	687	TTTT/G	116
11	5′ truncation	5′ untemplated (G)	27	TTCT/G	5
12	5′ truncation	5′ untemplated (T)	415	TTTT/A	39
13	5′ truncation	5′ untemplated nt (ATAA)	120	TTTT/A	15
14	5′ truncation	5′ untemplated nt (TTTATTAT)	306	TTTT/A	45
15	5′ truncation	5′ untemplated nt (TTGAAGATTC)	2,685	TTTC/A	162
16	5′ truncation	5′ untemplated nt (GAAGACATATTTG)	744	ATTT/G	13
17	5′ truncation	5′ untemplated nt (AATGGTTTTTAAGGGTTTT)	646	TTTT/A	75
18	5′ truncation	5′ untemplated nt (TATGTTTTATGTTTTAAATA)	752	TTTT/A	Blunt
19	5′ truncation	Inverted hnRNP on 5′ (TTTC/A)	306	TTTT/G	Del. 14101
20	5′ truncation	Template switch U6	101	TTTT/A	17
21	5′ truncation	Templated seq. (81 bp)	3,948	TTTT/A	125
22	5′ truncation	Templated seq. (55 bp)	300	AGGT/G	Del. 7567
23	5′ truncation	Templated seq. and translocation	242	TCTT/G	NA
24	5′ truncation		1,308	TTTT/A	2
25	5′ truncation		—	TTTT/A	217
26	5′ truncation		—	TTTT/A	Del. 5
27	5′ truncation		549	TCTT/G	34
28	5′ truncation		53	TTCT/A	17
29	5′ truncation		270	TTTT/A	98
30	5′ truncation		600	TTTA/A	323
31	5′ truncation		420	TTTT/C	Del. 20
32	5′ truncation		155	TTTT/G	18
33	5′ truncation		5,428	TTTT/G	13
34	5′ truncation		1,052	TATT/A	15
35	5′ truncation		135	TTTT/A	17
36	5′ truncation		138	TTTT/G	Del. 2
37	5′ truncation		307	TTTC/A	55
38	5′ truncation		3	TTCT/A	14
39	5′ truncation		172	TTTT/G	127
40	5′ truncation		1,661	TATT/G	Del. 17
41	5′ truncation		433	TTTT/A	13
42	5′ truncation		582	TCTT/G	Blunt
43	5′ truncation		501	TTTT/A	Del. 47
44	5′ truncation		376	TTCT/G	16
45	5′ truncation		288	TTTT/G	49
46	5′ truncation		9	TTTT/A	135
47	5′ truncation		536	TCTT/G	11
48	5′ truncation		221	TTCT/G	76
49	5′ truncation		691	TTTT/G	12
50	5′ truncation		60	TTTT/G	15
51	5′ truncation		118	ACTT/A	15
52	5′ truncation		18	TTTT/A	28
53	5′ truncation		10	ATTT/A	7
54	5′ truncation		120	TTCT/A	Blunt
55	5′ truncation		1,173	CTTT/C	27
56	5′ truncation		33	TTTT/G	Del. 31
57	5′ truncation		150	TCTT/A	7
58	5′ truncation		245	TTTT/A	14
59	5′ truncation		29	ATTT/A	15
60	Chimera	3′ duplication (9/15 and 267/270)	1,190	TTTT/A	Del. 2985/3014
61	Chimera		514	TTTT/A	Del. 503/545
62	Chimera		577	TCTT/A	Del. 193/238
63	Chimera		1,090	TTTA/A	NA
64	Endo. indep. and chimera	3′ untemplated (GTG)	775	GTGA/G	Del. 1296
65	Endo. indep. and chimera	5′ flank duplication and 3′ truncation	332	3 pos.	Del 131076
66	Inv./del. and chimera	Intrachromosomal dupl.	1,879	TTTT/G	15	15- to 38-bp del.
67	Inv./del. and chimera	Intrachromosomal dupl. and 5′ untemplated (T)	1,617	TTTT/A	14	4,467- to 4,469-bp del.
68	Inversion/deletion	Internal deletion (246-nt del.)	3,817	TTTT/A	15	7- to 9-bp del.
69	Inversion/deletion	Untemplated nt (ATATATAACAGAGC)	2,731	TTCT/A	14	175- to 179-bp del.
70	Inversion/deletion		211	TCTT/A	13	12- to 22-bp del.
71	Inversion/deletion		327	TTTA/A	15	13- to 16-bp del.
72	Inversion/deletion		514	TTTT/G	11	563- to 568-bp del.
73	Inversion/deletion		2,233	TTAT/A	16	569- to 574-bp del.
74	Inversion/deletion		5,512	TCTT/A	16	2- to 4-bp del.
75	Inversion/deletion		1,370	TTCT/A	14	536- to 538-bp del.
76	Inversion/deletion		132	TTTC/A	11	246- to 253-bp del.
77	Inversion/deletion		272	TCTT/A	16	9- to 11-bp del.
78	Inversion/deletion		275	TTTA/A	16	3- to 5-bp del.
79	Inversion/deletion		240	TCTT/A	14	33- to 35-bp del.
80	Inversion/deletion		1,891	TTCT/A	16	4- to 10-bp del.
81	Inversion/deletion		2,029	TTCT/A	NA	NA
82	Inversion/duplication		552	TTTT/G	15	5- to 6-bp dupl.
83	Inversion/duplication		6,074	TTTT/A	15	8- to 11-bp dupl.
84	5′ truncation	5′ untemplated (G)	353	TTTA/A	Del. 2
85	5′ truncation	5′ untemplated (G)	153	ATTA/G	55
86	5′ truncation	5′ untemplated nt (ACAAGTTAT)	—	TTTA/A	186
87	5′ truncation		349	TTTA/A	20
88	5′ truncation		2,005	TTTT/A	235
89	5′ truncation		399	TCTT/G	108
90	5′ truncation		20	TTTT/A	14
91	5′ truncation		496	TTTT/A	113
92	5′ truncation		226	TTTT/G	10
93	5′ truncation		117	TTCT/A	Blunt
94	5′ truncation		—	TATT/A	Blunt
95	5′ truncation		1,127	TGTT/A	43
96	5′ truncation		399	TCTT/G	12
97	5′ truncation		194	TGTT/G	153
98	5′ truncation		51	TTTT/G	Del. 2
99	Chimera		239	TTTT/A	159
100	Inversion/deletion		28	TTTA/A	16	22- to 23-bp del.

^aAn expanded version of Table 1 is present in the supplemental material. Abbreviations: del., deletion; dupl., duplication; nt, nucleotide(s); seq., sequence; inv., inversion; endo. indep., endonuclease independent; NA, not applicable; pos., position(s).

^bStructural feature(s) associated with the insertion. —, no L1 segment was reverse transcribed.

^cSequence alteration(s) associated with the insertion.

^dLength of L1 insertion, not including the size of the retrotransposition indicator cassette (2.3 or 2.7 kb, respectively).

^eSequence of the “bottom-strand” target site cleavage site.

^fLength of target site duplication.