Abstract
The F-BAR protein Cdc15 is essential for cytokinesis in the fission yeast Schizosaccharomyces pombe , playing a key scaffolding role and connecting the actomyosin-based cytokinetic ring to the plasma membrane. Here, we compared cdc15 temperature-sensitive mutants isolated in multiple genetic screens. We determined the mutations within each cdc15 mutant allele and analyzed their growth at different temperatures. Additionally, we report a new cdc15 allele that highlights the requirement for Cdc15 in the recruitment of the early secretory pathway to the cellular division site. The new mutants described here expand the toolkit for studying cytokinesis in S. pombe .
Figure 1. Characterization of mutant alleles.
(A) Schematic of gene product (drawn to scale). Numbers indicate amino acid position. Below the schematic is a table of cdc15 mutations encoded by the indicated temperature-sensitive alleles. (B) Live cell imaging of wildtype and cdc15-22 cells expressing Sec24-GFP and mCherry-tagged actomyosin ring component Rlc1 and spindle pole body component Pcp1 grown at the permissive temperature of 25°C and shifted to the restrictive temperature of 36˚C for 3 hours. Shown are the maximum projection images of nine 0.5 μm-spaced z-sections imaged at 25˚C or 36˚C. (C) Live cell imaging of wildtype and cdc15-22 cells expressing GFP-Cps1 grown at the permissive temperature of 25°C and shifted to the restrictive temperature of 36˚C for 3 hours. Shown are the maximum projection images of the z-stacks obtained by epifluorescence imaging at the appropriate temperatures of 25˚C or 36˚C. (D) Immunoprecipitated (IP) Cdc15 proteins treated or not treated with lambda phosphatase (λ-PPase) were separated by SDS-PAGE and immunoblotted ( top ). Lysates were blotted for Cdk1 levels as a loading control prior to immunoprecipitations ( bottom ). (E) The protein encoded by the cdc15-22 allele was tagged with GFP at the N-terminus and cells were grown either at 25°C (top) or shifted to 36˚C for 3 hours (bottom) before being imaged live at those temperatures. Shown are the maximum projection images of the nine 0.5 μm spaced z-sections. (F) The indicated strains were grown at 25˚C and shifted to 36˚C for 4 hours. Samples were collected at both temperatures and cells were fixed and stained with DAPI and methyl blue before imaging. (G) The indicated strains were grown in liquid YE at 25°C until they reached mid-log phase and adjusted to the same cell concentrations measured by optical density (Forsburg and Rhind, 2006). Then, 10-fold serial dilutions were made and 2.5 µL of each was spotted on YE agar plates and incubated at the indicated temperatures for 2-5 days prior to imaging. (B, C, E, F) Scale bar, 5 µm.
Description
In the fission yeast Schizosaccharomyces pombe, c ytokinesis requires the function of the plasma membrane (PM)-bound actin- and myosin-based cytokinetic ring (CR) that is assembled at the cell equator at the onset of mitosis. CR constriction at the end of anaphase ultimately results in the physical separation of two daughter cells.
One of the proteins mediating CR attachment to the PM is the essential dimeric F-BAR protein Cdc15 ( Figure 1A, top panel). Cdc15 is one of the first and most abundant components detected at the CR (Fankhauser et al., 1995; Nurse et al., 1976; Wu et al., 2003; Wu and Pollard, 2005). As cells progress into mitosis, the N-terminal dimeric F-BAR domain of Cdc15 oligomerizes, binds membranes, and interacts with the formin Cdc12 and the paxillin-related Pxl1 (Carnahan and Gould, 2003; McDonald et al., 2015; Snider et al., 2022; Snider et al., 2020; Willet et al., 2015). A C-terminal SH3 domain provides a second binding site for Pxl1 and also interacts with other CR components including the C2 domain protein Fic1 (Bhattacharjee et al., 2020; Cortes et al., 2015; Martin-Garcia et al., 2018; Ren et al., 2015; Roberts-Galbraith et al., 2009). Between the F-BAR and SH3 domains lies a predicted intrinsically disordered region (IDR) essential for Cdc15 function (Mangione et al., 2019) . Reducing the amount of Cdc15 , preventing Cdc15 membrane binding and/or F-BAR domain-mediated oligomerization, or deleting the Cdc15 SH3 domain destabilizes the CR during anaphase and leads to cytokinesis failure (Arasada and Pollard, 2011; McDonald et al., 2015; Roberts-Galbraith et al., 2009) . Abrogating Cdc15 function also prevents the enrichment of the early secretory machinery, transitional ER (tER) exit sites, at the nascent division site (Vjestica et al., 2008) .
c dc15 temperature-sensitive mutants have been isolated in genetic screens for general cell cycle regulators and also in those targeting cytokinesis factors (Balasubramanian et al., 1998; Chang et al., 1996; Nurse et al., 1976) . We isolated a novel cdc15 allele, cdc15-22 , in a genetic screen for mutants where the CR assembled and remained stable over an extended period of time but failed to recruit tER marked by the eGFP-tagged COPII coat protein Sec24 ( Figure 1B ). Yet, the cell wall synthase Cps1 / Bgs1 localized normally to the division site in cdc15-22 cells at the restrictive temperature of 36˚C ( Figure 1C ). The mutations within several cdc15 mutant alleles, including cdc15-22 , have not been identified or reported in PomBase (Rutherford et al., 2024) .
To determine the molecular lesions in all cdc15 temperature-sensitive mutants, we amplified and sequenced the cdc15 open reading frame (ORF) from each strain ( Figure 1A, bottom panel). In one of the first described alleles (Nurse et al., 1976) , cdc15-140 , we found a single mutation conferring a single amino acid substitution (A100T) within the F-BAR domain. The same amino acid was changed to a valine in cdc15-A5 . A distinct mutation within the F-BAR domain was also identified in cdc15-287 and this was an identical change to that in cdc15-127 . Since the F-BAR mediates membrane binding, it is likely that the F-BAR domain becomes destabilized at the non-permissive temperature. Two alleles, cdc15-B1 and cdc15-C5 , contained the same mutation at the 5'end of an intron. This mutation does not lead to an amino acid substitution. Instead, it likely inhibits splicing and causes a decrease in protein production exacerbated at the non-permissive temperature. Indeed, significantly decreasing Cdc15 levels leads to cytokinesis failure and cell death (Arasada and Pollard, 2011) . The last allele we sequenced was cdc15-22 . This allele contained three amino acid substitutions and a stop codon at the amino acid 708. Introduction of individual cdc15-22 mutations into the wild-type cdc15 locus indicated that the premature stop codon was responsible for the cytokinesis failure of cdc15-22 cells. We previously found that C-terminal truncations to amino acid 752 or amino acid 710 were viable (Mangione et al., 2019; Roberts-Galbraith et al., 2009) . However, these truncation alleles grew slowly and showed a variety of cell division and morphological defects similar to cdc15-22 cells.
To validate the sequencing results from cdc15-22 , we performed an immunoprecipitation and immunoblotting experiment. This confirmed that Cdc15-22 was a shorter protein ( Figure 1D ). However, the overall protein levels were not diminished, in fact they appeared increased, and the truncated protein was still phosphorylated. Cdc15's ability to oligomerize and bind membrane and protein partners is regulated by its phosphorylation state (Bhattacharjee et al., 2023; Bhattacharjee et al., 2020; Fankhauser et al., 1995; Roberts-Galbraith et al., 2010). N-terminal tagging of Cdc15-22 mutant protein with eGFP showed that it was efficiently recruited to the CR suggesting that its phosphoregulation was largely intact ( Figure 1E ).
To compare cellular phenotypes of the strains, we examined each mutant by staining for nuclei and septa at the permissive temperature of 25°C or after the shift to the restrictive temperature of 36˚C for 4 hours. The phenotypes of the cdc15-140 , cdc15-A5 , and cdc15-287 cells were comparable to each other, with an accumulation of multiple nuclei and occasionally a septa at the restrictive temperature ( Figure 1F ). In contrast, the cdc15-C5 and cdc15-22 cultures contained cells with multiple nuclei and septa even at 25˚C and cells that became wider and bulged at 36˚C ( Figure 1F ).
We next determined the range of temperature-sensitivity of each cdc15 allele. All cdc15 alleles grew less well than wildtype cells at 36°C, with cdc15-140 showing the greatest temperature-sensitivity ( Figure 1G ).
In sum, we have provided further information on range of cdc15 mutants as well as initial characterization of previously uncharacterized cdc15 mutants that expand the repertoire of reagents which can be used to study cytokinesis and subcellular polarization of the early secretory pathway compartments in S. pombe .
Methods
S. pombe methods
S. pombe strains were grown in yeast extract (YE) and standard S. pombe mating, sporulation, and tetrad dissection techniques were used to construct new strains (Forsburg and Rhind, 2006) . Spot assays were performed twice with reproducible results.
The marker reconstitution mutagenesis strategy described in (Tang et al., 2011) was used to isolate cdc15-22 . Briefly, a non-functional fragment of the selective marker his5 (containing the promoter and the N-terminal ORF fragment), together with the entire ura4 gene were inserted at the 3' end of the native cdc15 genomic locus, in the his5- ura4 - mutant genetic background. This strain was obtained by transforming the HpaI-linearized plasmid cdc15-pH5-C∆ and we denoted the locus as cdc15-his5C∆::ura4 + . In parallel, we performed error-prone PCR of the cdc15 genomic sequence fused to the 3′-UTR and the C-terminal part of his5 + from the plasmid cdc15-pH5-C+, at high Mg 2+ concentration. The mutagenized amplicon was transformed into cdc15-his5C∆::ura4 + locus and the homologous recombination within cdc15- and his5 -encoding sequences resulted in the replacement of the genomic cdc15 sequence with a library of PCR fragments. Such recombination events were selected based on the restoration of histidine prototrophy. We screened all resulting colonies for temperature-sensitive cdc15 alleles showing impaired recruitment of the tER to the cellular division site.
To tag the mutant Cdc15-22 protein with eGFP we used the 3'region cdc15 -5'region cdc15 -eGFP- cdc15 ORF -pJK210 plasmid that upon SnaBI linearization has homology arms to the 5'UTR and the 3'UTR of cdc15 gene, introducing the eGFP- cdc15 construct and the ura4+ cassette at the cdc15 locus.
Molecular biology methods
cdc15 alleles were amplified using an oligonucleotide 123 bp upstream of the start site (GATAGGCAACGGTTGCTAGG) and 142 bp downstream of the stop codon (ACGAAGCTTAGACCATGACG) (Integrated DNA technologies). The PCR products were each sequenced by Plasmidsaurus (Eugene, OR) using Oxford Nanopore Technology with custom analysis and annotation.
The cdc15-pH5-C∆ plasmid was obtained through overlap-extension PCR using primers prSO1372(ccgctcgagACACTGATTACCCTCTTTTCTAG), prSO1373(ccactataaccaccattgttAACATTGTTAATAAAATAAAATAAAATATATTCC), prSO1374(tttattttattaacaatgttAACAATGGTGGTTATAGTGGATCG), prSO1375(CGGAATTCctaTACCGTCTGAACAAAGTTCG) and the amplicon was introduced into the pH5-C∆ plasmid (Tang et al., 2011) using XhoI and EcoRI restriction sites. The plasmid cdc15-pH5-C+ was obtained using prSO1376(cgcggatccGGATCGAACATTAAATTTAACG) and prSO1377(gctacggatatcCTATACCGTCTGAACAAAGTTCG) to amplify cdc15 locus and cloned into pH5-C+ backbone (Ta ng et al., 2011) using BamHI and EcoRV restriction sites.
For the N-terminal eGFP tagging of Cdc15-22 protein variant, we amplified the mutant allele ORF sequence with prSO712 (CGCGGATCCATGGAGGTTAATGGAGTCTCTCAATCTG) and prSO2584 (tccccgcggCTATACCGTCTGAACAAAGTTCGACGGG) and used to clone it downstream of eGFP in pJK210 vector using BamHI and SacII restriction sites. We amplified the 3'region of cdc15 using prSO2585 (ccatcgatACACTGATTACCCTCTTTTCTAGATG) and prSO2586 (tcgcccgggttgttctgcggagtacGTACCTTGATTTTAATTTACTAAAATCGG) and 5' region of cdc15 using prSO2587 (ctccgcagaactacGTATCTGCTAGCAAGTTTGAATGAAAATAGG) and prSO2588 (tcgcccgggAACCTCCATTTTGTTATTGAAAGAAC) and cloned them in front of the eGFP using ClaI, SnaBI and XmaI restriction sites to obtain the final plasmid 3'region cdc15 -5'region cdc15 -eGFP- cdc15 ORF -pJK210 which upon linearization with SnaBI targeted the native cdc15 locus.
Microscopy and image analysis
Strains for fixed-cell imaging experiments were grown at 25°C in YE and then shifted to 36°C for 4 hours. Cells were fixed with 70% ethanol for DAPI and methyl blue (MB) staining as described previously (Roberts-Galbraith et al., 2009). Images were acquired using a Zeiss Axio Observer inverted epifluorescence microscope with Zeiss 63× oil objective (1.46 NA) and captured using Zeiss ZEN 3.0 (Blue edition) software. A singular medial Z slice was obtained. All images were further processed using ImageJ (Schindelin et al., 2012) . All imaging experiments were repeated twice.
Live imaging of cdc15-22 strains was performed on epifluorescence microscopy setup using mercury lamp as an illumination source with appropriate sets of filters on a Zeiss Axiovert 200M microscope (Carl Zeiss, Inc.) using a Plan Apochromat 100X, 1.4 N.A. objective lens, CoolSnap camera (Photometrics, Tucson, AZ) and Uniblitz shutter driver (Photonics, Rochester, NY) under the control of Metamorph software package (Universal Imaging, Sunnyvale, CA). When required, imaging was performed at 36˚C using an objective heater system (Bioptechs, Butler, PA, USA). We acquired whole cell image stacks that consisted of 9 z-sections with 0.5 µm spacing for red and green fluorophores. The z-stack maximum or average projection images were obtained by ImageJ 1.46b software package (http://rsb.info.nih.gov/ij/; National Institutes of Health, Bethesda, MD, USA).
Protein methods
Cell pellets (15 OD) were snap-frozen in dry ice–ethanol baths. Pellets were resuspended in 1 ml and lysates were prepared by bead disruption (Fastprep cell homogenizer; MP Biomedicals) in NP-40 buffer (6 mM Na 2 HPO 4 , 4 mM NaH 2 PO 4 , 1% NP-40, 150 mM NaCl, 2 mM EDTA, 50 mM NaF, 4 mg/mL leupeptin, 0.1 mM Na 3 VO 4 ) with the addition of 1 mM PMSF (Sigma-Alrdrich; P7626), 2 mM benzamidine (Sigma-Alrdrich; B6506), and 0.5 mM diisopropyl fluorophosphate (Sigma-Aldrich; D0879-1G). Immunoprecipitations and lambda phosphatase collapse were performed as described (Bhattacharjee et al., 2023) . Briefly, lysates were incubated with anti- Cdc15 serum (Roberts-Galbraith et al., 2009) for 2 h at 4°C and then protein A sepharose beads (GE Healthcare; 17-5280-04) for 30 minutes. Beads were washed three times with NP-40 buffer and two times with phosphatase buffer (150 mM NaCl, 50 mM Hepes pH 7.4) before being split in two and added to either lambda phosphatase reaction or control. Lambda phosphatase collapse was performed according to manufacturer's protocol (New England Biolabs; P0753). Reactions were stopped by the addition of gel sample buffer.
Protein samples were resolved by SDS-PAGE and transferred to polyvinylidene fluoride (PVDF) membrane (Immobilon P, EMD Millipore). Anti- Cdc2 (PSTAIRE) mouse monoclonal antibody at 1:10,000 dilution (Sigma-Aldrich; P7962) or anti- Cdc15 (1-405) rabbit polyclonal antibody at 1:10,000 dilution (Roberts-Galbraith et al., 2009) were used as primary antibodies in immunoblotting. Secondary antibodies were conjugated to IRDye800 or IRDye680 (LI-COR Biosciences). Blotted proteins were detected via an Odyssey CLx instrument (LI-COR Biosciences).
Reagents
The strains used in this study and their genotypes are listed below.
|
Strain |
Genotype |
Source |
|---|---|---|
|
KGY114-2 |
cdc15-C5 ura4-D18 h + |
This study |
|
KGY188 |
cdc15-140 h - |
Nurse et al., 1976 |
|
KGY282-2 |
cdc15-A5 ura4-D18 h 90 |
This study |
|
KGY642-3 |
cdc15-127 h - |
Nurse et al., 1976 |
|
KGY749 |
cdc15-287 h - |
Chang et al., 1996 |
|
KGY1077 |
cdc15-B1 ura1 leu1-32 mam2::LEU2 ade6-M216 h 90 |
Balasubramanian et al., 1998 |
|
KGY1078 |
cdc15-C5 ura1 leu1-32 mam2::LEU2 ade6-M216 h 90 |
Balasubramanian et al., 1998 |
|
KGY1079 |
cdc15-A5 ura1 leu1-32 mam2::LEU2 ade6-M216 h 90 |
Balasubramanian et al., 1998 |
|
SO6279 |
cdc15-22:ura4 + :his5 + ade? his5? leu1-32 ura4-D18 h + |
This study |
|
SO5986 |
sec24-GFP:ura4+ cdc15 :his5C∆:ura4+ his5- h? |
This study |
|
SO7141 |
cdc15-22:his5+:ura4+ sec24-GFP rlc1-mCherry:ura4+ pcp1-mCherry:ura4+ h? |
This study |
|
SO7350 |
eGFP-cdc15-22:ura4+ h? |
This study |
|
SO628 5 |
cdc15-22:his5+:ura4+ GFP- cps1 :kanR h? |
This study |
Acknowledgments
We are grateful to PomBase
Funding Statement
Work in the KLG laboratory was supported by NIH grant R35GM131799 to K.L.G. Work in the SO lab at TLL was supported by the Singapore Millenium Foundation.
References
- Arasada R, Pollard TD. Distinct roles for F-BAR proteins Cdc15p and Bzz1p in actin polymerization at sites of endocytosis in fission yeast. Curr Biol. 2011 Sep 1;21(17):1450–1459. doi: 10.1016/j.cub.2011.07.046. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Balasubramanian MK, Mc Collum D, Chang L, Wong KC, Naqvi NI, He X, Sazer S, Gould KL. 1998. Isolation and characterization of new fission yeast cytokinesis mutants. Genetics. 149: 1265-75. 1626. [DOI] [PMC free article] [PubMed]
- Bhattacharjee R, Hall AR, Mangione MC, Igarashi MG, Roberts-Galbraith RH, Chen JS, Vavylonis D, Gould KL. Multiple polarity kinases inhibit phase separation of F-BAR protein Cdc15 and antagonize cytokinetic ring assembly in fission yeast. Elife. 2023 Feb 7;12 doi: 10.7554/eLife.83062. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bhattacharjee R, Mangione MC, Wos M, Chen JS, Snider CE, Roberts-Galbraith RH, McDonald NA, Presti LL, Martin SG, Gould KL. DYRK kinase Pom1 drives F-BAR protein Cdc15 from the membrane to promote medial division. Mol Biol Cell. 2020 Feb 26;31(9):917–929. doi: 10.1091/mbc.E20-01-0026. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Carnahan RH, Gould KL. 2003. The PCH family protein, Cdc15p, recruits two F-actin nucleation pathways to coordinate cytokinetic actin ring formation in Schizosaccharomyces pombe. J Cell Biol. 162: 851-62. 2140. [DOI] [PMC free article] [PubMed]
- Chang F, Woollard A, Nurse P. 1996. Isolation and characterization of fission yeast mutants defective in the assembly and placement of the contractile actin ring. J Cell Sci. 109: 131-42. 1490. [DOI] [PubMed]
- Cortés JC, Pujol N, Sato M, Pinar M, Ramos M, Moreno B, Osumi M, Ribas JC, Pérez P. Cooperation between Paxillin-like Protein Pxl1 and Glucan Synthase Bgs1 Is Essential for Actomyosin Ring Stability and Septum Formation in Fission Yeast. PLoS Genet. 2015 Jul 1;11(7):e1005358–e1005358. doi: 10.1371/journal.pgen.1005358. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fankhauser C, Reymond A, Cerutti L, Utzig S, Hofmann K, Simanis V. 1995. The S. pombe cdc15 gene is a key element in the reorganization of F- actin at mitosis [published erratum appears in Cell 1997 Jun 27;89(7):1185]. Cell. 82: 435-44. 1494. [DOI] [PubMed]
- Forsburg SL, Rhind N. Basic methods for fission yeast. Yeast. 2006 Feb 1;23(3):173–183. doi: 10.1002/yea.1347. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mangione MC, Snider CE, Gould KL. The intrinsically disordered region of the cytokinetic F-BAR protein Cdc15 performs a unique essential function in maintenance of cytokinetic ring integrity. Mol Biol Cell. 2019 Sep 11;30(22):2790–2801. doi: 10.1091/mbc.E19-06-0314. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Martín-García R, Arribas V, Coll PM, Pinar M, Viana RA, Rincón SA, Correa-Bordes J, Ribas JC, Pérez P. Paxillin-Mediated Recruitment of Calcineurin to the Contractile Ring Is Required for the Correct Progression of Cytokinesis in Fission Yeast. Cell Rep. 2018 Oct 16;25(3):772–783.e4. doi: 10.1016/j.celrep.2018.09.062. [DOI] [PubMed] [Google Scholar]
- McDonald NA, Vander Kooi CW, Ohi MD, Gould KL. Oligomerization but Not Membrane Bending Underlies the Function of Certain F-BAR Proteins in Cell Motility and Cytokinesis. Dev Cell. 2015 Dec 21;35(6):725–736. doi: 10.1016/j.devcel.2015.11.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nurse P, Thuriaux P, Nasmyth K. 1976. Genetic control of the cell division cycle in the fission yeast Schizosaccharomyces pombe. Mol Gen Genet. 146: 167-178. 744. [DOI] [PubMed]
- Ren L, Willet AH, Roberts-Galbraith RH, McDonald NA, Feoktistova A, Chen JS, Huang H, Guillen R, Boone C, Sidhu SS, Beckley JR, Gould KL. The Cdc15 and Imp2 SH3 domains cooperatively scaffold a network of proteins that redundantly ensure efficient cell division in fission yeast. Mol Biol Cell. 2014 Nov 26;26(2):256–269. doi: 10.1091/mbc.E14-10-1451. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Roberts-Galbraith RH, Chen JS, Wang J, Gould KL. The SH3 domains of two PCH family members cooperate in assembly of the Schizosaccharomyces pombe contractile ring. J Cell Biol. 2009 Jan 12;184(1):113–127. doi: 10.1083/jcb.200806044. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Roberts-Galbraith RH, Ohi MD, Ballif BA, Chen JS, McLeod I, McDonald WH, Gygi SP, Yates JR 3rd, Gould KL. Dephosphorylation of F-BAR protein Cdc15 modulates its conformation and stimulates its scaffolding activity at the cell division site. Mol Cell. 2010 Jul 9;39(1):86–99. doi: 10.1016/j.molcel.2010.06.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rutherford KM, Lera-Ramírez M, Wood V. PomBase: a Global Core Biodata Resource-growth, collaboration, and sustainability. Genetics. 2024 May 7;227(1) doi: 10.1093/genetics/iyae007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, Preibisch S, Rueden C, Saalfeld S, Schmid B, Tinevez JY, White DJ, Hartenstein V, Eliceiri K, Tomancak P, Cardona A. Fiji: an open-source platform for biological-image analysis. Nat Methods. 2012 Jun 28;9(7):676–682. doi: 10.1038/nmeth.2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Snider CE, Bhattacharjee R, Igarashi MG, Gould KL. Fission yeast paxillin contains two Cdc15 binding motifs for robust recruitment to the cytokinetic ring. Mol Biol Cell. 2022 Feb 2;33(4):br4–br4. doi: 10.1091/mbc.E21-11-0560. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Snider CE, Chandra M, McDonald NA, Willet AH, Collier SE, Ohi MD, Jackson LP, Gould KL. Opposite Surfaces of the Cdc15 F-BAR Domain Create a Membrane Platform That Coordinates Cytoskeletal and Signaling Components for Cytokinesis. Cell Rep. 2020 Dec 22;33(12):108526–108526. doi: 10.1016/j.celrep.2020.108526. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tang X, Huang J, Padmanabhan A, Bakka K, Bao Y, Tan BY, Cande WZ, Balasubramanian MK. Marker reconstitution mutagenesis: a simple and efficient reverse genetic approach. Yeast. 2010 Nov 22;28(3):205–212. doi: 10.1002/yea.1831. [DOI] [PubMed] [Google Scholar]
- Vjestica A, Tang XZ, Oliferenko S. The actomyosin ring recruits early secretory compartments to the division site in fission yeast. Mol Biol Cell. 2008 Jan 9;19(3):1125–1138. doi: 10.1091/mbc.e07-07-0663. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Willet AH, McDonald NA, Bohnert KA, Baird MA, Allen JR, Davidson MW, Gould KL. The F-BAR Cdc15 promotes contractile ring formation through the direct recruitment of the formin Cdc12. J Cell Biol. 2015 Feb 16;208(4):391–399. doi: 10.1083/jcb.201411097. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wu JQ, Kuhn JR, Kovar DR, Pollard TD. Spatial and temporal pathway for assembly and constriction of the contractile ring in fission yeast cytokinesis. Dev Cell. 2003 Nov 1;5(5):723–734. doi: 10.1016/s1534-5807(03)00324-1. [DOI] [PubMed] [Google Scholar]
- Wu JQ, Pollard TD. Counting cytokinesis proteins globally and locally in fission yeast. Science. 2005 Oct 14;310(5746):310–314. doi: 10.1126/science.1113230. [DOI] [PubMed] [Google Scholar]

