Oocytes with impaired meiotic maturation contain increased mtDNA deletions

Abstract

Purpose

Induction of meiotic competence is a major goal of the controlled ovarian stimulation used in ART. Do factors intrinsic to the oocyte contribute to oocyte maturation? Deletions in mtDNA accumulate in long-lived post mitotic tissues and are found in human oocytes. If oogenesis cleanses the germline of deleterious deletions in mtDNA, meiotically competent oocytes should contain lower levels of mtDNA deletions vs. meiotically arrested oocytes. We tested this hypothesis using a novel PCR assay for a deletion ratio in human oocytes derived from IVF.

Methods

A real-time PCR assay was developed to measure total mtDNA copy number (mtDNA_CN) and mtDNA harboring the 5 Kb “common deletion” to enable calculation of the mtDNA deletion ratio (mtDNA_DR) in 143 cultured oocytes. Kruskal-Wallis test was carried out to compare the total mtDNA_CN and the mtDNA_DR among oocytes which matured to metaphase II (MII) vs. oocytes arrested at GV or metaphase I (MI).

Results

51.75% of oocytes reached MII, and 17% remained at MI. Mean mtDNADR in GV, MI and MII oocytes were 27.87%, 31.88% and 20.05%, respectively. The difference in deletion ratios between GV and MII and between MI and MII stages was statistically significant p < 0.001 and p = 0.034, respectively. Additionally, patient age was found to be positively correlated with time to Polar body extrusion (− 0.278 Pearson correlation).

Conclusions

Oocytes with impaired meiotic maturation contain an increased load of mtDNA deletions. This is the first report of an association between the mtDNA deletion ratio and human oocyte maturation in vitro.

Introduction

Mitochondrial DNA (mtDNA) mutations have long been known to cause rare genetic disorders and age-related cellular dysfunction, especially in long lived, post-mitotic cells. ATP is produced via oxidative phosphorylation (OXPHOS) within mitochondria, and ATP fuels most cellular functions. Nass et al. first described the circular form of mtDNA, and in 2001, Goto et al. reported that each mitochondrion contains one or multiple copies of mtDNA [1, 2]. In the human oocyte, estimates of mtDNA copy number within mature oocytes vary from 100,000 to 600,000 copies per oocyte [3]. It is unknown whether this wide range in mtDNA copy number within mature oocytes plays a role in the function and quality of oocytes.

The mitochondrial genome is susceptible to mutations because of its limited DNA repair capacity and proximity to the oxidative phosphorylation machinery within the mitochondrion, which produces reactive oxygen species (ROS). As a result, mtDNA has a mutation rate 10 to 20 times higher than nuclear DNA [4]. Most mtDNA mutations compromise OXPHOS, impair cellular respiration and reduce cell survival. Some mtDNA mutations contribute to mtDNA diseases, which preferentially affect long-lived, metabolically active tissue, such as brain and muscle [5], and also have been shown to be implicated in Alzheimer disease [6] as well as in various types of cancers [7]. Early embryo development does not depend on mitochondria for energy production, as evidenced by mouse models where genetically engineered mice carrying markedly reduced mtDNA copy number exhibited normal preimplantation embryo development to the blastocyst stage [8]. Metabolic function of preimplantation embryos, in regards to generation of ATP, is completed via aerobic glycolysis, the so-called Warburg Effect, unique to embryos and cancer cells to support rapid cell proliferation [9]. Mitochondria in oocytes and cleavage stage embryos appear quiescent, with a paucity of cristae, the folds on the inner membrane containing the OXPHOS enzymes. Oxygen uptake, the sine qua non of OXPHS, is exceptionally low in oocytes and early embryos [10].

Yet ample evidence demonstrates that mitochondrial function influences development, especially during the earliest stages of oogenesis. Primordial germ cells inherit only a few mitochondria, and the normalcy of this founder population determines the fate of the oocyte following robust amplification of mtDNA copy number during subsequent stages of development. This genetic bottleneck faced by mtDNA rids the germline of many deleterious mtDNA mutations/deletions.

The role of mitochondrial function during meiotic maturation in oocytes is less well understood. Ultrastructural studies show morphologically undifferentiated mitochondria, and single cell physiological studies demonstrate minimal oxygen uptake by oocytes consistent with minimal oxidative phosphorylation. Indeed, mature oocytes depend on alternative metabolic pathways (e.g. the adenosine shunt pathway) to generate ATP [11]. Expansion of the mitochondrial pool and increased activation appear only after the > 4 cell stage of human embryo development [12, 13].

Mitochondria, however, may play a role during earlier stages of oogenesis. Bursts of ATP production can be detected between the germinal vesicle (GV), metaphase I (MI) and metaphase II stages (MII) [10]. And mitochondrial DNA content has been shown to be critical to fertilization outcome and serves as an important marker of oocyte quality, explaining some cases of fertilization failure [14].

MtDNA is quite prone to rearrangements, and since it is inherited exclusively through the oocyte, detection and elimination of these variants are essential to protect the germline. One of the most common deletions, the so-called “common deletion” is a nearly five thousand base pair deletion flanked by 13 bp repeats which affects several key genes involved in OXPHOS. The common deletion has been linked to diseases of aging, including coronary artery disease [15].

The common deletion has also been found within human oocytes [16], but its impact on oogenesis remains poorly understood. We therefore sought to determine whether the level of mtDNA deletions harbored by in vitro matured human oocytes affect their development from GV to MII stages.

Materials and methods

Institutional IRB approval was obtained for genetic analysis of human oocytes discarded from IVF cycles. A total of 146 germinal vesicle (GV) oocytes from 66 patient cycles were accessioned from elective oocyte freeze and ICSI/IVF cycles between January 2015 and January 2016. GV oocytes were accessioned within 2 h post-retrieval and cultured in G-IVF™ PLUS in a time lapse incubator for 48 h. Images were captured every 5 min to ascertain timing of germinal vesicle breakdown (GVBD) and polar body extrusion (PBE) to measure the exact timings of oocyte maturation from the GV stage to MI (GVBD) and timing to MII stages (PBE). After 48 h of culture, oocytes were frozen and stored for future analysis.

Ethical approval

The NYU Langone Medical Center Institutional Review Board (NYU IRB 6902) approved the culture and genetic study of discarded human oocytes. Patients donating tissue provided written informed consent. The project was funded by the NYU Daniel Roshan MD Research Fund.

Stimulation protocol

All cycles employed rFSH (Gonal F, Merck Europe) and human menopausal gonadotropin (Menopur, Ferring GmbH) for ovarian stimulation in doses dependent on patient characteristics and GnRH antagonist (Ganirelix, Gedeon Richter Plc) to prevent ovulation. rhCG (Ovidrel, Merck) at 250 mcg × 2 or ¼ of one Ovidrel + Lupron (​​Abbott Laboratories) 40 IU units were used to trigger the cycles.

Oocyte collection

One hundred sixty-six GV oocytes were obtained from consented subjects. Retrieved oocytes were incubated in a benchtop tri-gas incubator at 37 °C, 6% CO₂ and 5% O2 (IVF Tech – IVFsynergy) until denudation 2 h post-retrieval (37 h post-trigger). Denudation was performed by brief exposure to hyaluronidase solution (80 IU/mL) (Hyase, Vitrolife) followed by repeated pipetting to remove cumulus-corona cells. After denudation, oocytes were rinsed in G-MOPS™ PLUS (Vitrolife) and evaluated for nuclear maturation. Germinal Vesicle (GV) stage oocytes were placed in micro drops containing G-IVF™ PLUS containing HSA (Vitrolife) with no supplementation and placed in a time lapse incubator (EmbryoScope™, Vitrolife) to monitor development. Incubator settings were 37 °C, 6% CO2, 5% O₂ and 95% relative humidity. Although specific IVM culture media is commercially available, the developmental competency of immature oocytes is not significantly different when using complex culture medium or regular IVF media (G-IVF PLUS).

In vitro maturation of oocytes

Immature oocytes (GV oocytes) were placed in a time lapse incubator to measure two outcomes: time to germinal vesicle breakdown (GVBD) and polar body extrusion (PBE). This allowed for accurate identification of MI and MII stages. All oocytes remained in culture for 48 h and were checked for viability and were confirmed to not be atretic or degenerated. By maintaining all oocytes stages in stable culture conditions for 48 h, we sought to apply the same culture conditions to all oocytes. After 48 h culture, all oocytes were vitrified by the Kitazato Cryotop® method and stored at –86 °C in a New Brunswick ultralow temperature freezer (Richmond Scientific) in PCR tubes. These conditions are sufficient to stabilize DNA. Samples remained in the ultralow freezer for a week, at which point all oocytes were thawed and lysed.

Oocyte lysis

After oocytes were thawed at room temperature, 5 µl of lysis buffer (YK001B, Yikon Genomics, Shanghai, China) was added into 1 µl containing the oocyte. The lysis reaction was performed on a thermal cycler (Eppendorf Mastercycler Gradient) for 1 cycle at 50 °C for 50 min and 80 °C for 10 min, following the manufactures’ instructions.

Sample processing

Lysed oocytes were homogenized and split into two equal sample sizes of 3 µl. One sample was used to assess mitochondrial parameters by qPCR and the other served as a replicate. Homogenization of samples was confirmed by assessing mtDNA copy number in both halves of the cell. mtDNA copy number did not differ statistically between the two replicates.

Multiplex qPCR to determine mitochondrial copy number and deletion ratio

Our experiments used a multiplex real-time quantitative PCR (qPCR) assay to simultaneously quantify mtDNA copy number (mtDNA_CN) and deleted mtDNA, to enable calculation of deletion ratio (mtDNA_DR). This was achieved by targeting two regions in the mtDNA: a mitochondrial DNA site in the minor arc where large deletions are rare (mtMinArc) thus representing the mtDNA_CN per cell, and a mitochondrial DNA site in the major arc where large deletions are common (mtMajArc). The proportion of mtGenomes with major arc deletions, or mtDNA_DR, is represented by mtMinArc − mtMajArc)/mtMinArc. This assay detected two targets in the same reaction (multiplex assay) using two different color fluorescent probes, namely TexRed (Min Arc) and FAM (Maj Arc) (Table 1). Multiplexing the two targets not only offered higher throughput analyses at reduced cost, but also minimized extraneous variability due to multiple pipetting and well-to-well variation that occurs when comparing multiple singleplex reactions.

Table 1.

Primer and probe sequences

Primer name	Sequences (5′−3′)
ND4 FmtND4 ND4 RmtND4 Probe FmtDloop RmtDloop Probe	CTGTTCCCCAA CTTTTCCT(10,912–10,931) CCATGATTGTGAGGGGTAGG(10,975–10,994) 6FAM-GACCCCCTAACAACCCCC(NFQ) CTAAATAGCCCACACGTTCCC(16,528–16,548) AGAGCTCCCGTGAGTGGTTA(23–42) Tex615-CATCACGATGGATCACAGGT(NFQ)

The mtMinArc target is in the mitochondrial displacement loop (D-loop), an area where no mtDNA deletions have been reported. It is a triple-stranded region found in the major non-coding region (NCR) of mtDNA. It consists of a 1123 base-pair sequence. D-loop serves as the control site for mtDNA expression and replication.

The mtMajArc target is in the ND4 which lies within the greatest number of reported large deletions in the major arc. The amplicon is present only if there is a deletion present by approximating the otherwise too widely separated primers. Among the 263 pathogenic deletions, most of them span the major arc including the 4977 bp common deletion (mDNA4977) which is the most described mtDNA deletion in various human cancers and aging. These sequences were adapted from Philips et al. who validated these sequences for simultaneous quantification of mtDNA copy number and the 4977 mtDNA deletion [17]. Given this assay was performed on single cells, an assay of a nuclear encoded gene, to control cell number, was not necessary.

Synthetic DNA (g-Blocks) (Integrated DNA Technologies, Inc. Iowa, US) and mtDNA from cells known to be homoplasmic for the common deletion FLP ∆ (aka FLP6a39.32) provided controls. FLP ∆ (aka FLP6a39.32) are hybrid cells created from the osteosarcoma lineage fused with homoplasmic deletion-containing mitochondria from a Kearn-Sayre Syndrome patient [18]. Placental DNA was used as negative control after prior confirmation that it contained no deletions.

Three microliters of DNA lysate from a single cell was amplified separately with 1ul Dloop and 1ul ND4 primer/probe combinations. To each sample 10 µl of Sso Advanced Supermix (Biorad) was added and 5 µl water for a final reaction volume of 20 µl. Fluorescence analysis was performed using the CFX manager software on the Biorad CFX96 detection system. Amplification conditions were set at 95 °C for 2 min, 95 °C for 15 s, 60 °C for 30 s for a total of 40 cycles.

The calculation of the deletion ratio was completed by subtracting the number of ND4 copies from D loop copies and dividing this number by D loop copies. Given the highly conserved nature of the mitochondrial D loop we set this as our copy number.

[Dloop Copies − ND4 copies] / Dloop Copies.

This number was multiplied by 100 to represent the deletion ratio as a percentage.

qPCR standard curves

Absolute quantification of DNA was accomplished using reference DNA obtained using Synthetic gBlocks® Gene Fragments as standards. These are double-stranded, sequence-verified genomic blocks (Integrated DNA technologies) synthesized to produce the amplicons resulting from specified primers (see Table 1). Standard curves were produced by performing serial dilutions of known concentrations of the gBlocks starting at 200,000 down to 20 copies.

Statistical analysis

The subjects’ clinical characteristics and demographics were summarized using descriptive statistics in mean ± SD for continuous variables or % (counts) for categorical variables. We used ANOVA (Kruskal Wallis test) for continuous variables to compare among groups. These univariate analyses were followed by multivariate linear (logistic) regression methods to adjust for potential confounding variables. A multinomial logistic regression analysis was conducted to examine the relation between the outcome variable and various predictor variables. All the outcome data were checked for normality and homogeneity of variance prior to analyses. Two-sided p values < 0.05 were considered to be statistically significant. All statistical procedures were performed using IBM SPSS version 29.

Results

Subject characteristics

A total of 166 oocytes from 66 subjects were included in the study. Forty-eight subjects underwent oocyte cryopreservation and 18 patients were undergoing IVF/ICSI cycles. The average age of the subjects was 37.34 years. Average AMH was 3.18 ng/ml. Table 2 summarizes the baseline characteristics and cycle parameters/outcomes.

Table 2.

Study patients parameters related to cycle and outcomes. Anti-müllerian hormone (AHM), Body Mass Index (BMI), Estradiol (E2), Follicle Stimulating Hormone (FSH), International Units (IU)

Patient characteristics (N = 66)	Mean (SD)
Patient age (years)	37.34 (3.55)
AHM (ng/ml)	3.18 (2.52)
BMI (kg/m2)	22.59 (3.48)
Baseline E2 (pg/ml)	54.08 (20.85)
Baseline FSH (mIU/ml)	6.40 (2.30)
Total IU Gonadotropins	3712.51 (1412.49)
Retrieved eggs	64.38 (14.38)
No. eggs retrieved (%mature) Trigger day (cycle day)	19.63 (11.90) 9.88 (1.36)

Of the 166 GV oocytes obtained for this research study, 23 (13.86%) were discarded due to atresia. The remaining 143 oocytes were used for further statistical analysis. A total of 45 (31%) oocytes remained at GV stage, 24 (17%) remained at the MI stage and 74 (51.75%) reached the MII stage (Table 3); 51.75% maturation rate for IVM GV oocytes falls within the published rates of between 40 and 60% [19].

Table 3.

Number of oocytes obtained at different maturation stages

Total oocytes (N)	GV	MI	MII
143	45 (31%)	24 (17%)	74 (52%)

With respect to oocyte maturation, mean time to GVBD was 2668 min (~ 9.5 h post retrieval). Mean time to polar body extrusion (PBE) was 3669 min (~ 26 h post retrieval) (Table 4).

Table 4.

Oocyte maturation timings

Timepoint	Time (min)	SD (min)
GVBD	2668	± 218.9
PBE	3669	± 382.1

Oocytes were maintained in optimal culture conditions within the time lapse incubator during the entire period of IVM. Interestingly, 51.75% of GV oocytes cultured in G-IVF™ PLUS wash droplets progressed to the MII stage of development. Oocytes that had not progressed by 30 h in culture did not progress further.

The mtDNA multiplex PCR assay run time was ~ 1 h. PCR efficiency ranged from 98 to 103%. Mean mtDNA copy number was determined by mean copy number of the D loop amplicon (see Table 5).

Table 5.

Mean mtDNA copy number (D loop amplicon) and mean deletion ratio for germinal vesicle (GV) stage oocytes, MI stage oocytes and MII stage oocytes

	GV (N = 45)	MI (N = 24)	MII (N = 74)	p value
Mean mtDNACN	17,360	117,665	121,743
	(63,303.56)	64,671.55	(77,354.23)	0.996
Mean mtDNADR (%)	27.87 (17.09)	31.88 (10.13)	20.05 (13.93)	< 0.001

Mean mtDNA copy numbers at each stage of meiotic maturation were 117,360 (GV); 117,665 (MI); 121,743 (MII). Kruskal–Wallis test showed no significant difference in the mean copy number among the meiotic maturation stages (p = 0.996). The deletion ratio was significantly lower in MII vs. GV (p < 0.001), and MII vs. MI oocytes (p = 0.034). The deletion ratio did not differ between GV and MI oocytes (p = 0.537). See Table 5 and Fig. 1.

Fig. 1.

Box plot of deletion ratio for each oocyte maturation stage. Mean mtDNA copy numbers at each stage of meiotic maturation were 117,360 (GV); 117,665 (MI); 121,743 (MII). Kruskal–Wallis test showed that, among the three meiotic maturation stages, the mean copy numbers were not significantly different (p = 0.996), while the mean mtDNA deletion ratios were highly significant (p < 0.001) 27.87 (GV); 31.88 (MI); 121,743 (MII), shown in Table 5. Further post hoc test revealed that the deletion ratios were significantly different between GV and MII stages (p < 0.001), and between MI and MII stages (p = 0.034), but not significantly different between the GV and MI stages (p = 0.537)

A multinomial logistic regression analysis was conducted to test the effects of predictor variables as a whole on progression of oocytes through meiotic maturation.

These included age, AMH, day 3 FSH, day 3 E2, total IU gonadotropins administered during the retrieval cycle, number of oocytes retrieved, percent of total oocytes retrieved that were GV, percent of total oocytes retrieved that were MI, percent of total oocytes retrieved that were MII, percent oocytes retrieved that were atretic, total mtDNA Dloop copy number, total mtDNA ND4 copy number, as well as mtDNA_DR.

The model was statistically significant, indicating that it was able to distinguish effectively among the oocyte stages based on the predictor variables as a whole (R² = 0.37) χ2(28, N = 143) = 47.36, Nagelkerke R² = 0.37, p = 0.013.

The model delivered relatively low precision, presumably because of limited sample size. Baseline E2, total no. eggs retrieved, % GV retrieved and % MII retrieved contributed to the model (Table 6). The odds ratio analysis showed that mtDNA_DR is the greatest contributor to meiotic maturation.

Table 6.

Odds ratios predicting maturation arrest at GV and MI. MII stage is set as the reference

			95% confidence interval
Oocyte stages		OR	Lower bound	Upper bound
GV	Age	0.95	0.75	1.19
	Antimullerian hormone	0.89	0.66	1.20
	Baseline E2	1.03	1.00	1.07
	Baseline FSH	1.05	0.82	1.35
	Total IU gonadotropins	1.00	1.00	1.00
	Trigger day	0.80	0.43	1.48
	No. eggs retrieved	1.09	1.03	1.16
	% GV retrieved	1.24	1.01	1.52
	% MI retrieved	1.19	0.96	1.48
	% mature eggs retrieved	1.25	1.03	1.52
	% atresia retrieved	1.33	1.07	1.66
	Total mtDNA copy number	1.00	1.00	1.00
	Total_ND4 number	1.00	1.00	1.00
	Deletion ratio	15.75	0.04	6056.74
MI	Age	0.98	0.72	1.33
	Antimullerian hormone	0.64	0.35	1.17
	Baseline E2	1.03	0.98	1.07
	Baseline FSH	1.17	0.84	1.62
	Total IU gonadotropins	1.00	1.00	1.00
	Trigger day	0.55	0.23	1.31
	No. eggs retrieved	1.08	0.99	1.18
	% GV retrieved	0.85	0.64	1.11
	% MI retrieved	0.84	0.63	1.11
	% mature eggs retrieved	0.93	0.72	1.18
	% atresia retrieved	1.14	0.89	1.46
	Total mtDNA copy number	1.00	1.00	1.00
	Total_ND4 number	1.00	1.00	1.00
	Deletion ratio	0.10	0.00	454.54

Each unit increase in mtDNA_DR in GVs was associated with a decrease in the likelihood of progressing to MII (B = 2.76, OR = 15.748, 95% CI [0.04, 6056.74]).

However, when comparing oocytes that arrested at MI to oocytes that progressed to the MII stage of development, each unit increase in deletion ratio in MI was associated with an increase in the likelihood of further progression to MII (B = − 2.29, OR = 0.10, 95% CI [0, 454.54]). The rest of the variables tested did not significantly predict preference for maturation progression (Tables 6 and 7).

Table 7.

Risk ratios of MI and MII arrest

	Odds ratio	95% CI
GV to MII	15.748	0.04–6056.74
MI to MII	0.10	0.00–454.54

We also found that age had a statistically significant effect on time to polar body extrusion, PBE, though the effect size was small (–0.278). The correlation was positive, so the higher the age, the quicker progression through meiosis/ progression to a mature oocyte (see Tables 8 and 9, and Fig. 2).

Table 8.

Correlations between age and PBE

		Age	Time to PBE
Age	Pearson correlation	1	–0.278
	Sig (2-tailed)	NA	0.036
	N	143	57
Time to PBE	Pearson correlation	–0.278	1
	Sig (2-tailed)	0.36	NA
	N	57	57

Table 9.

Estimation is based on Fisher’s r-to-z transformation

	Pearson correlation	Sig (two tailed)	95% CI lower	95% CI upper
Age vs TBE	− 0.278	0.036	− 0.502	− 0.019

Fig. 2.

Correlation of patient age with polar body extrusion (PBE) variable

Discussion

Our results show that mitochondrial DNA deletion ratio (mtDNA_DR) is higher in arrested GV stage oocytes compared to mature human oocytes in an IVM protocol (using G-IVF™ PLUS media for 48 h). The cross-sectional study design limits inference based on causality, but the most plausible interpretation of these findings is that mtDNA deletions impair oogenesis. Biologically, this is plausible given that following MI, and without an intervening round of DNA replication, the oocyte proceeds to meiosis II, rapidly reforms a spindle and arrests at metaphase MII, a cellular activity requiring massive organelle and cytoskeletal reorganization with concomitant expenditure of ATP. Intriguingly, in oocytes mitochondria are underdeveloped, primitive structures with truncated cristae with only minimal oxygen uptake [20]. Presumably ATP generated at earlier stages of oogenesis is essential to meiotic progression.

We assume that contributions from our IVM protocol to promote ROS damage and therefore to confound our findings to be negligible. Recent studies employing biochemical and functional assays have confirmed that mitochondrial metabolism in oocytes is suppressed by inhibition of complex I. This is understood as an evolutionarily conserved strategy to protect long-lived oocytes [21].

Our data also shows that progression from MI to MII is positively correlated with mtDNA deletion load (OR = 0.10). The statistical significance of such a small OR may result from the fact that ORs tend to exaggerate the effect size compared with a relative risk [22], thus representing a Type I error. Alternatively, the minimal checkpoint control after exit from meiotic prophase I, and absence of DNA damage checkpoint before the first meiotic division [23], may permit oocytes containing damaged mtDNA to progress.

The positive correlation between age and time to polar body extrusion (PBE) is intriguing, since age-associated meiotic aneuploidy is one of the most important processes affecting human fertility. Expedited progression through the first meiotic division in oocytes from older women presumably would reduce the time available for proper chromosome congression prior to chromosome segregation [24]. This has clinical consequences, suggesting a shorter interval from trigger to oocyte retrieval in older patients is warranted to prevent early ovulation and loss of oocytes.

In our study we did not look at the resulting functional effects of the mitochondrial DNA deletions on the oocytes. However, what is known is that most of the mitochondrial deletion breakpoints occur within two directly repeated sequences, which are thought to cause most large-scale mtDNA deletions [25, 26]. Among the 263 large-scale deletions these frequently locate in the major arc, especially the ND4 and ND5 gene. Furthermore, these deletions occur within perfect repeats (68%) (class I deletions), whereas 12% deletions are flanked by imperfect repeats (class II deletions) and 20% deletions are flanked by no direct repeats (class III deletions) [27]. mtDNA 4977 bp deletion has been frequently reported within the category of class I deletions [28]. The two 13 bp perfect repeats (ACCTCCCTCACCA) have been found at mtDNA nucleotide positions 8470–8482 bp (in the ATPase8 gene) and 13,447–13,459 bp (in the ND5 gene) surrounding this deletion breakpoint. One repeat remains, whereas the other is removed. This deletion removes two complex V subunits, one complex IV subunit, four complex I subunits and five intervening tRNAs. The deleted 5 kb subgenomic fragment therefore lies in the hotspot of the distribution of deletions in the major arc [28].

Recent advances in live imaging techniques have revealed a functional heterogeneity of mitochondria with respect to mitochondrial redox state, membrane potential, respiratory activity, uncoupling proteins, mitochondrial ROS and calcium [29] which could be a consequence of deletions/mutations. The heterogeneity of mitochondrial function demonstrates an additional level of mitochondrial complexity. For example, mitochondria can be classified according to their membrane potential, and because the magnitude of potential is directly correlated to important mitochondrial functions, including ATP production, there is the awareness that mitochondria are not a homogeneous population and that specific localization of subpopulations characterized by different membrane potential may correspond to precise oocyte regulatory needs. It is notable that the localization of highly polarized, and therefore more functional mitochondria occurs in a timely fashion in a specific oocyte domain where they are believed to be crucially needed. Several lines of evidence in fact suggest the notion that hyperpolarized mitochondria are essential for supporting the very first steps of fertilization at the cortical level [30]. Future studies should establish whether mtDNA_DR load can affect mitochondrial function and how and if the mtDNA_DR load can predict other downstream oocyte competency indicators such as fertilization rate, good blastocyst development rate, implantation rate and live birth rates.

Aging is associated with a general cellular and mitochondrial impairment affecting tissue function. Tissues with slow turnover of mitochondria, such as the ovary, develop physiologic deficits via mitochondria-regulated apoptosis. mtDNA also becomes compromised as a tissue ages due to the acquisition of mutations. The 4977 base pair common deletion has been detected in oocytes from reproductively older women [16]. In this particular study, it was shown that unfertilized oocytes obtained from women undergoing IVF presented deleted mtDNA (common deletion). However, IVF pregnancy rates did not differ between those patients whose unfertilized oocytes harbored mtDNA deletions and those patients whose oocytes did not harbor mtDNA deletions. Nevertheless, this can be explained in that the high-frequency deletions could arise in individual oocytes rather than the whole patient pool of oocytes. Unfertilized oocytes were used in that particular study, and it is unknown whether those findings can be generalized to those embryos transferred to patients.

Arbeithuber et al. recently detected low-frequency, de novo point mutations in mtDNA from oocytes and somatic tissues. Mutation frequencies and patterns differed between germline and somatic tissues and among mtDNA regions, suggestive of distinct mutagenesis mechanisms. Additionally, they discovered more pronounced genetic drift of mitochondrial genetic variants in the germline of older versus younger mice, arguing for mtDNA turnover during oocyte meiotic arrest [31].

The possible impact of mitochondrial aging on female reproductive capacity was investigated by Duran and colleagues [32]. The study involved examination of the ATP content, mitochondria number and the presence of the 4977 bp deletion in individual human oocytes at different stages of maturation (i.e. germinal vesicle [GV]; meiosis I [MI]; meiosis II [MII]). Mitochondrial numbers, estimated by mtDNA copy number, were more closely associated with reproductive age (as determined by measurement of FSH levels), than chronological age. Additionally, ATP content increased as oocytes matured, but its amount was not related to chronological age. The 4977 bp deletion was identified only in arrested or degenerate oocytes [32].

Clinically significant heteroplasmy, in which cells contain mixtures of mtDNA with different sequences, is frequent. The likelihood of heteroplasmy persisting across generations is reduced by a mechanism regulating mitochondrial segregation during oogenesis known as the “genetic bottleneck” [33]. This involves the elimination of the majority of the oocyte mtDNA molecules, with only a small population ultimately passed to the next generation. In most cases, this genetic bottleneck results in either the removal of mtDNA variants harboring mutations or their increase past a critical level of heteroplasmy, causing tissue dysfunction and possibly mitochondrial disease. We cannot rule out the possibility that meiotic maturation is contributing to this genetic mechanism.

One possible limitation of our study is its generalizability as oocytes were derived from stimulated cycles and oocytes were matured in vitro. Importantly, our study applied the same culture conditions to all oocytes stages to focus on the possible role of mtDNA deletions on development. We are aware that we cannot extrapolate our findings to other IVM protocols.

But we have no reason to believe that meiotic maturation in vivo would be immune from the effects of high levels of mtDNA deletions. Also, we do not understand the mechanism underlying variation in the levels of the common mtDNA deletion among oocytes. We are not aware of evidence that gonadotropin stimulation influences mtDNA deletion ratio load, though definitive conclusions on this matter await studies on oocytes obtained from natural cycles.

We did not find a statistically significant difference in mtDNA copy number among the oocyte maturation stages, though we likely were underpowered to detect such differences. A post hoc power analysis showed that the number of oocytes needed to achieve statistical power was 6180, a number that was not feasible for this study. We recognize the limitation of our sample size in this respect; however, mtDNA deletion ratio appears to have a more robust effect than mtDNA copy number, since we detected statistically significant differences, even with the relatively modest sample size studied. mtDNA copy number has provided the metric most commonly used to estimate mitochondrial function in zygotes but has been questioned by many contradicting studies [34, 35]. mtDNA deletion ratio thus appears to provide a more sensitive metric to assess mitochondrial function, at least during meiotic maturation. Future studies should assess mtDNA deletion ratio during later stages of development.

With the increased emphasis on three-person reproduction as a method to curb the inheritance of mitochondrial disease, further understanding of mitochondrial mutational load on oocyte biology may lead to better outcomes for patients in the future.

Funding

The project was funded by the Daniel Roshan MD research fund.

Declarations

Competing interests

The authors declare no competing interests.