Control of pili synthesis and putrescine homeostasis in Escherichia coli

Iti Mehta; Jacob B Hogins; Sydney R Hall; Gabrielle Vragel; Sankalya Ambagaspitiye; Philippe E Zimmern; Larry Reitzer

doi:10.7554/eLife.102439

. 2025 Apr 3;13:RP102439. doi: 10.7554/eLife.102439

Control of pili synthesis and putrescine homeostasis in Escherichia coli

Iti Mehta ^1,^†, Jacob B Hogins ^1,^†, Sydney R Hall ¹, Gabrielle Vragel ¹, Sankalya Ambagaspitiye ^1,^‡, Philippe E Zimmern ², Larry Reitzer ^1,^✉

Editors: Bavesh D Kana³, Bavesh D Kana⁴

PMCID: PMC11968103 PMID: 40178519

Abstract

Polyamines are biologically ubiquitous cations that bind to nucleic acids, ribosomes, and phospholipids and, thereby, modulate numerous processes, including surface motility in Escherichia coli. We characterized the metabolic pathways that contribute to polyamine-dependent control of surface motility in the commonly used strain W3110 and the transcriptome of a mutant lacking a putrescine synthetic pathway that was required for surface motility. Genetic analysis showed that surface motility required type 1 pili, the simultaneous presence of two independent putrescine anabolic pathways, and modulation by putrescine transport and catabolism. An immunological assay for FimA—the major pili subunit, reverse transcription quantitative PCR of fimA, and transmission electron microscopy confirmed that pili synthesis required putrescine. Comparative RNAseq analysis of a wild type and ΔspeB mutant which exhibits impaired pili synthesis showed that the latter had fewer transcripts for pili structural genes and for fimB which codes for the phase variation recombinase that orients the fim operon promoter in the ON phase, although loss of speB did not affect the promoter orientation. Results from the RNAseq analysis also suggested (a) changes in transcripts for several transcription factor genes that affect fim operon expression, (b) compensatory mechanisms for low putrescine which implies a putrescine homeostatic network, and (c) decreased transcripts of genes for oxidative energy metabolism and iron transport which a previous genetic analysis suggests may be sufficient to account for the pili defect in putrescine synthesis mutants. We conclude that pili synthesis requires putrescine and putrescine concentration is controlled by a complex homeostatic network that includes the genes of oxidative energy metabolism.

Research organism: E. coli

Introduction

Polyamines are flexible aliphatic cations that are found in virtually all organisms. E. coli contains putrescine (1,4-diaminobutane) and lesser amounts of spermidine (N-(3-aminopropyl)–1,4-diaminobutane), and cadaverine (1,5-diaminopentane) (Tabor and Tabor, 1984). Both the pathways and enzymes of polyamine synthesis are redundant (Figure 1). Strains that lack eight of these genes do not contain detectable polyamines, grow slowly aerobically, and do not grow anaerobically (Chattopadhyay et al., 2009). Polyamines interact with nucleic acids and phospholipids, and can affect chromosome and ribosome structure, ribosome-mRNA interactions, and protein and nucleic acid elongation rates (Igarashi and Kashiwagi, 2000). Polyamines modulate, but are not required for, protein synthesis (Igarashi and Kashiwagi, 2015) and expression of hundreds of genes (Yoshida et al., 2004). A major mechanism of polyamine-dependent regulation is translational control of genes for 18 major transcription regulators: four of the seven σ factors – σ¹⁸ (FecI), σ²⁴ (RpoE), σ³⁸ (RpoS), and σ⁵⁴ (RpoN); three histone-like DNA-binding proteins (Fis, H-NS, and StpA); and CpxR, Cya, Cra, and UvrY (Igarashi and Kashiwagi, 2015; Yoshida et al., 2004).

Polyamines control flagella-dependent surface motility of Proteus mirabilis and pili-dependent surface motility (PDSM) of E. coli: the latter has been reported to require the polyamine spermidine (Armbruster et al., 2013; Kurihara et al., 2009). While reconstructing putrescine-deficient strains to characterize the basis for the anaerobic growth defect, we noticed that a mutant unable to synthesize spermidine moved normally, while mutants lacking enzymes of putrescine synthesis moved poorly. We characterized the role of polyamines on E. coli surface motility and pili synthesis by genetic analysis, ELISA assays, RT-qPCR, electron microscopy, and RNAseq. We showed that PDSM and pili synthesis required two independent pathways of putrescine synthesis, but did not require spermidine, and was modulated by putrescine transport and catabolism. Results from an RNAseq analysis are consistent with multiple mechanisms of putrescine-dependent control, and, unexpectedly, suggest a putrescine homeostatic network that rewires metabolism to maintain intracellular putrescine.

Results

W3110 surface motility requires pili

An assessment of surface motility for E. coli K-12 and eight derivatives showed five strains covered a plate in 12–18 hr, while four did not traverse a plate in 36 hr (Ambagaspitiye et al., 2019). The slow-moving strains generated genetically stable fast-moving variants which suggests that the former were ancestral. We chose our lab strain of W3110 for further study because (a) it exhibited the least variability in spreading diameter and generated fewer fast-moving variants, and (b) we had previously analyzed this strain for the energy requirements for surface motility (Sudarshan et al., 2021). We refer to our slow-moving lab strain hereafter as W3110 but not all W3110 strains move similarly: the W3110 from the genetic stock center is a fast-moving variant (Ambagaspitiye et al., 2019).

Several results suggested that W3110 requires pili for surface motility. First, the deletion of fimA, which codes for the major type 1 pili subunit, abolished the oscillatory pattern and reduced, but did not eliminate, surface motility, but the deletion of fliC which encodes the major flagellum subunit did not affect surface motility (Figure 2A). Second, electron microscopy confirmed that W3110 isolated from surface motility plates possessed pili (Figure 2B). None of >500 cells expressed flagella. A mixed population of elongated (3–4 µm) and non-elongated (<2 µm) cells were visible, and pili were mostly associated with elongated cells. Finally, W3110 surface motility requires glucose (Sudarshan et al., 2021) which should prevent flagella synthesis via inhibition of cyclic AMP synthesis (Yokota and Gots, 1970). We confirmed that glucose suppressed swimming motility which implies suppression of flagella synthesis in W3110 during surface motility assays (Figure 2C). A W3110 derivative with deletions of both fliC and fimA still exhibited outward movement on a surface motility plate (Figure 2A), but electron microscopy showed the absence of appendages (Figure 2C). In summary, genetics, electron microscopy, and the glucose requirement show that W3110 surface motility requires pili.

Figure 2. — (A) Surface motility of parental and derivative strains lacking the major subunits of the flagella (FliC), pili (FimA), or both. (B) Transmission electron microscopy (TEM) images of cells of W3110 and W3110 Δ*fliC* Δ*fimA* were taken from the movement’s edge directly from surface motility plates. (C) Swimming motility with and without 0.5% glucose.

Results from W3110 sequencing found an IS1 insertion in fimE which could explain its greater movement that is less variable and greater genetic stability. The FimB and FimE recombinases are the major components of phase variation that determine the orientation of the promoter that initiates transcription of the fimAICDFGH operon which codes for the pili structural proteins. The FimB recombinase favors the productive ON orientation, while the more active FimE recombinase favors the unproductive OFF orientation (Conway et al., 2023; Kelly et al., 2006; O’Gara and Dorman, 2000). The insertion in fimE is the likely basis for the relative stability of W3110.

PDSM required two independent putrescine synthesis pathways

We examined PDSM requirements for polyamine anabolic pathways. A major putrescine biosynthetic pathway is ornithine decarboxylation either by the constitutive SpeC or the low-pH inducible SpeF. TheΔspeC and ΔspeF mutants moved as well as the parental strain, but a ΔspeC ΔspeF double mutant moved less well (Figure 3). SpeA (arginine decarboxylase) and SpeB (agmatinase) catalyze an alternate two-step putrescine synthetic pathway (Figure 1; Tabor and Tabor, 1985): deletion of either gene reduced surface motility (Figure 3). The ΔspeA, ΔspeB, and ΔspeC ΔspeF strains grew as well as the parental strain and had normal swimming motility (Figure 3—figure supplement 1). A ∆speE mutant, which lacks the enzyme for spermidine synthesis, moved on a surface as well as the parental strain (Figure 3).

Figure 3. — (A) Pili-dependent surface motility (PDSM) of mutants with defects in polyamine anabolic genes. All assays were performed in triplicate, and representative images are shown. (B) Diameter of surface movement of polyamine mutants after 36 hr. Error bars represent standard deviations for three independent replicates. Statistical analysis was performed using the Dunnett test of significance: *p<0.05; **p<0.01; ***p<0.001. In this figure the Δ*speB* mutant was IM26.

Figure 3—figure supplement 1. — (A) Pili-dependent surface motility (PDSM) of mutants with defects in polyamine anabolic genes. All assays were performed in triplicate, and representative images are shown. (B) Diameter of surface movement of polyamine mutants after 36 hr. Error bars represent standard deviations for three independent replicates. Statistical analysis was performed using the Dunnett test of significance: *p<0.05; **p<0.01; ***p<0.001. In this figure the Δ*speB* mutant was IM26.

Supplemental putrescine at 1 mM restored the surface motility of a speB mutant (Figure 4A) and a speA mutant (not shown). Spermidine did not restore wild-type movement and, also, caused an unusual pattern of movement in the parental strain (Figure 4A). These exogenous concentrations of putrescine and spermidine had no effect on growth rates in a liquid motility medium (not shown). In summary, PDSM required the simultaneous presence of two independent pathways of putrescine synthesis but did not require spermidine.

Loss of putrescine transport systems affected surface motility

E. coli has several polyamine transport systems and one has been reported to be required for surface motility (Igarashi et al., 2001; Kurihara et al., 2011). Mutants lacking the PlaP and PotF putrescine transporters had 50% and 40% reduced surface motility, respectively, and lost the concentric ring pattern (Figure 5A). Loss of the PotE and PuuP transporters affected neither the movement diameter (Figure 5B) nor concentric ring formation (Figure 5A). We note that potF and plaP are more highly expressed than potE and puuP (85, 64, 17, and 6 counts per million transcripts, respectively) for W3110 grown in a liquid motility medium (Hogins et al., 2023a). We conclude that extracellular putrescine and its transport contribute to PDSM.

Figure 5. — (A) Representative images of surface motility for strains defective in putrescine transport genes. (B) Diameter of surface movement of polyamine mutants after 36 hr. Error bars represent standard deviations for three independent replicates. Statistical analysis was performed using the Dunnett test of significance: *p<0.05; **p<0.01; ***p<0.001. All assays were performed in triplicate and representative images are shown.

Putrescine catabolism affected surface motility

Because putrescine catabolism modulates intracellular putrescine concentrations (Schneider et al., 2013; Schneider and Reitzer, 2012), we examined PDSM in putrescine catabolic mutants. The major putrescine catabolic pathway is initiated with putrescine glutamylation (Figure 6A, right column), and a second pathway initiates with putrescine deamination (Figure 6A, left column) (Schneider and Reitzer, 2012). Deletion of either puuA or patA which codes for the first enzymes of their respective pathways did not affect surface motility (Figure 6B). A double mutant moved less well which was unexpected because the proposed higher intracellular putrescine should have stimulated PDSM. Consistent with the stimulatory effect of putrescine, loss of puuR which codes for the repressor of PuuA-initiated pathway genes (Schneider and Reitzer, 2012), impaired PDSM (Figure 6B). One possible explanation to reconcile these seemingly contradictory results is that an optimal polyamine concentration stimulates PDSM, and a high concentration is inhibitory. The next section describes experiments to test this possibility.

Figure 6. — (A) Pathways and enzymes of putrescine catabolism. (B) Motility diameter of putrescine catabolic mutants after 36 hr. Error bars represent standard deviations for three independent replicates. Statistical analysis was performed using the Dunnett test of significance: *p<0.05; **p<0.01; ***p<0.001. All assays were performed in triplicates and representative images are shown. (C) Effect of loss of *speE* on the *patA puuA* catabolic double mutant.

High putrescine reduced the expression of pili genes

High putrescine inhibits the translation of some mRNAs, and high spermidine, a product of putrescine metabolism, inhibits growth (Fukuchi et al., 1995; Sakamoto et al., 2020). If the phenotype of the ΔpatA ΔpuuA double mutant results from spermidine toxicity, then loss of spermidine synthase (SpeE) should reverse the phenotype. This prediction was not met, which argues against spermidine toxicity (Figure 6C). For the speB mutant, 1 mM putrescine stimulated PDSM, and 4 mM putrescine was slightly inhibitory (Figure 7A and B). The concentric ring pattern was observed with 1 mM, but not 4 mM putrescine. RT-qPCR to test transcriptional regulation of pili expression by putrescine showed optimal fimA transcription at 1 mM putrescine in the speB mutant (Figure 7C). Indirect enzyme-linked immunosorbent assays (ELISAs) against FimA suggested that the level of FimA in the speB mutant at 1 mM putrescine was higher than with 4 mM putrescine, but the difference was not statistically significant (Figure 7D). Variation of supplemental putrescine did not affect FimA in the parental strain (Figure 7C and D). Transmission electron microscopy (TEM) showed that pili expression was highest for the speB mutant at 1 mM putrescine (Figure 8), moderate at 0.1- and 4 mM putrescine, and undetectable without putrescine. The cells grown with 4 mM putrescine were shorter and thinner, which suggests stress, possibly mimicking osmotic stress. From these results and those in the previous section, we conclude that pili expression requires an optimal putrescine concentration.

Figure 7. — (A) W3110 Δ*speB* surface motility with 0.0, 0.1, 1.0, and 4.0 mM exogenous putrescine. All assays were performed in triplicate. Representative images are shown. (B) Average diameter of three separate surface motility plates. The parental strain without putrescine is shown for reference. Significance was determined by comparing the diameters of the Δ*speB* mutants in the different concentrations of putrescine compared to the parental W3110. One-way ANOVA was used with Dunnett hypothesis testing to determine p values, ***p<0.001. (C) Reverse transcriptase-quantitative PCR using primers targeting the *fimA* gene from cells grown in 0.0, 0.1, 1.0, and 4.0 mM of supplemented putrescine. Double deltas were generated by normalizing the parental and the Δ*speB* mutant RNA libraries to *rpoD* t hen comparing *fimA* expression. Two-way ANOVA was used to determine significance followed by Sadik hypothesis testing. ***p<0.001. (D) Enzyme linked immunosorbent assays using antibodies targeting pili (FimA) from cells grown with 0.0, 0.1, 1.0, and 4.0 mM of supplemented putrescine. Two-way ANOVA was used to determine significance followed by FDR adjusting. ***p<0.001. In this figure the Δ*speB* mutant was J15.

Figure 8. — Representative images are shown and cells were removed from motility plates with the following exogenous putrescine concentrations: (A) none, (B) 0.1 mM, (C) 1.0 mM, and (D) 4.0 mM. No pili were observed with 0 and 0.1 mM putrescine. Optimal pili production was observed with 1.0 mM putrescine. The bar represents one micron. In this figure the Δ*speB* mutant was J15.

RNAseq analysis identifies fim operon expression and energy metabolism as targets of putrescine control

RNAseq analysis was used to further confirm or determine whether putrescine affected (a) transcription of the fim operon that codes for the pili structural genes, (b) fim operon promoter orientation, i.e., phase variation, or (c) energy metabolism: surface motility of W3110 has been shown to require glucose metabolism and oxidative phosphorylation (Sudarshan et al., 2021).

RNAseq analysis

We grew parental W3110 and its ΔspeB derivative with and without 1 mM putrescine. R² values of pairwise comparisons showed that the transcriptome of the speB mutant grown without putrescine differed from the other transcriptomes which were similar (summarized in Table 1 and shown graphically in Supplementary file 1). A multidimensional scaling plot and a plot of the 100 most variable genes visualize these comparisons (Figure 9A and B). When compared to the parental strain, the speB mutant grown without putrescine had 310 downregulated genes and 159 upregulated genes with at least fourfold differential expression and FDR <0.05. Transcripts for the putrescine-induced puuAP and puuDRCBE operons, which specify genes of the major putrescine catabolic pathway, were reduced from 1.6- to 14-fold (FDR ≤0.02) in the speB mutant (Supplementary file 2). Because higher intracellular putrescine results in higher catabolic gene expression, these results imply lower intracellular putrescine in the ΔspeB mutant.

Table 1. Pairwise statistical comparisons of transcriptomes.

Abbreviation: putr is putrescine.

Strain 1	Strain 2	R ²
Wild-type (1 mM putr)	wild-type (0 mM putr)	0.950
Wild-type (1 mM putr)	ΔspeB (1 mM putr)	0.954
ΔspeB (0 mM putr)	ΔspeB (1 mM putr)	0.820
ΔspeB (0 mM putr)	wild-type (0 mM putr)	0.796
ΔspeB (0 mM putr)	wild-type (1 mM putr)	0.786

Open in a new tab

Figure 9. — (A) Multidimensional scaling plot of the parental and Δ*speB* mutant transcriptomes. When grown with 1.0 mM putrescine (red), the Δ*speB* mutant transcriptome (triangles) are nearly identical to the parental transcriptomes when grown without and with putrescine (blue and red circles, respectively). When grown without putrescine, the Δ*speB* mutant transcriptome (blue triangles) is greatly skewed from transcriptomes of the parental strain and the Δ*speB* mutant grown with putrescine. (B) Heatmap of the top 100 most variable genes further demonstrates the distinctiveness of the Δ*speB* mutant grown without putrescine and the similarities of the Δ*speB* mutant transcriptome when grown with 1.0 mM putrescine supplementation and the parental grown with or without putrescine. In this figure the Δ*speB* mutant was J15.

Transcription of the fim operon is reduced in the ΔspeB mutant

Deletion of speB reduced transcripts for genes of the fimA operon (Figure 10A). Numerous transcription factors activate the fim operon (Schwan, 2011; Karp et al., 2018), and, of these, loss of speB reduced hns transcripts, and increased fis, lrp, and qseB transcripts, but had no effect on ihfA and ihfB (Figure 10B). Loss of hns, ihfA, and lrp impaired PDSM (Figure 10C and D), which confirms the requirement for their products for pili synthesis in our strain background.

Putrescine does not control fim operon phase variation in W3110

The phase ON-favoring FimB and phase OFF-favoring FimE recombinases control the orientation of the fim operon promoter. Our version of W3110 has an insertion in fimE which means that FimB is the major factor that controls phase variation. Loss of speB reduced transcripts from fimB which could account for loss of motility. PCR analysis with specific primers can determine the fim operon promoter orientation (Figure 11A) and showed that loss of speB, loss of hns, or the presence of putrescine did not alter the ratio of ON to OFF (Figure 11B). This experiment determines the steady state phase ON to OFF ratio, which less FimB might not affect if FimB is in excess. In strains with FimE, the rate of phase ON orientation formation will be much slower, and even small changes in FimB activity could conceivably affect the switch orientation. We conclude that putrescine does not control phase variation, at least in our strain of W3110.

Figure 11. — (A) The diagram shows the genes for the FimB and FimE recombinases, the invertible *fimS* region which contains the promoter for the *fim* operon, and the *fim* operon which codes for the proteins of the type 1 pilus. Primer pairs 1–2 and 1–3 detect the *fimS* region in the phase OFF and ON orientations, respectively. The DNA sizes for phases OFF and ON are 884 and 394, respectively, for wild-type strains of *E. coli*, such as MG1655. Our lab strain of W3110 has an *IS1* element insertion in *fimE* which increases the size of the amplified DNA fragment. MG1655 was analyzed as a control. Primer 1 is 5’-*CCGCGATGCTTTCCTCTATG*-3’; primer 2 is 5’-*TAATGACGCCCTGAAATTGC*-3’; and primer 3 is 5’-*TGCTAACTGGAAAGGCGCTG*-3’ (shown schematically). (B) Deletion of either *speB* or *hns* had no effect on *fimS* orientation. A possible explanation for the loss of pili or PDSM in the *speB* or *hns* mutants is locking the *fimS* switch in phase OFF. However, loss of either *speB* or *hns* had no effect on *fimS* orientation in W3110 (lanes 2–4), and putrescine did not alter *fimS* orientation of the W3110 *ΔspeB* mutant (lanes 6 and 7). We conclude that loss of *speB* in W3110 did not phase-lock *fimS* in phase OFF. Also note that W3110, which has an insertion in *fimE*, is not locked in phase ON.

Evidence for a putrescine homeostatic network

Altered transcript levels in the speB mutant suggest compensatory mechanisms for low putrescine (Supplementary file 2 for transcript differences for all genes, Table 2 for selected genes, and Figure 12 for a diagrammatic representation of transcript differences). The speB mutant had more transcripts from (a) genes of arginine and ornithine carboxylase, (b) all genes of ornithine and arginine synthesis from glutamate, and (c) genes for three separate putrescine transport systems; and fewer transcripts from the sap operon which codes for a putrescine exporter (Sugiyama et al., 2016) and rpmH and rpsT, whose products inhibit ornithine and arginine decarboxylase (Keseler et al., 2017). The net effect of these changes should be to increase intracellular putrescine (solid arrows in Figure 12). In other words, these changes are compensatory for low putrescine. In addition to these changes, the speB mutant had 60-fold and sevenfold more transcripts for mgtA and phoBR which code for the major magnesium transporter and the regulators of phosphate assimilation, respectively. These changes may also be compensatory and are discussed below.

Table 2. Differentially expressed genes that are proposed to contribute to putrescine homeostasis.

A positive number means more transcripts in the ΔspeB (lower putrescine) strain.

Gene (function)	log₂FC	FDR
Polyamine synthesis
speA (putrescine)	0.99	0.003
speC (putrescine)	1.43	3E-4
speD (spermidine)	–0.83	0.01
speF (putrescine)	1.05	0.007
rpmH (inhibitor of SpeA and SpeC)	–2.77	2E-4
rpsT (inhibitor of SpeA and SpeC)	–1.92	8E-4

Polyamine transport
potABCD^* (spermidine)	–2.17	3E-4
potE (putrescine)	2.07	2E-4
potFGHI^* (putrescine)	1.41	4E-4
plaP (putrescine)	1.11	0.005
sapBCDF^* (putrescine export)	–1.18	8E-4

Arginine synthesis
argA_2 (synthesis)	1.77	0.001
argB (synthesis)	1.87	0.002
argC (synthesis)	2.86	0.005
argD (synthesis)	1.41	0.001
argF (synthesis)	1.63	0.01
argG (synthesis)	2.32	0.002
argH (synthesis)	0.97	0.001
argI (synthesis)	1.95	0.018
argR (repressor of arginine regulon)	–1.35	4E-4

Glutamate generation
glsA (glutamine degradation)	2.16	5E-4
glnG (regulation of ammonia assimilation)	–1.59	0.022

TCA cycle/electron transport
acnA (TCA cycle)	–1.04	8E-4
acnB (TCA cycle)	–1.96	2E-4
fumA (TCA cycle)	–1.50	6E-4
fumB (TCA cycle)	–1.49	0.003
gltA (TCA cycle)	–1.64	2E-4
icdA (TCA cycle)	–1.32	0.002
sdhCDAB-sucABCD^* (TCA cycle)	–3.88	5E-5
nuo operon^* (electron transport)	–0.82	0.004
menFDHBCE^* (electron transport)	–0.8	0.005
ubiEJB^* (electron transport)	–0.93	0.004
cyoABCD^* (electron transport)	–1.41	9E-4
hemCD^* (heme)	–2.05	2E-4

Iron transport
exbBD^* (transport of all iron chelates)	–2.33	4E-5
tonB (transport of all iron chelates)	–1.9	4E-5
entCEBA^* (enterochelin iron)	–5.2	7E-6
fecABCDE ^* (ferric citrate)	–4.4	3E-5
fecIR (regulators, ferric citrate)	–4.4	6E-6
feoABC^* (ferrous iron)	–3.4	7E-4
fur (regulator, iron assimilation)	–0.40	0.11

Magnesium and phosphate transport
mgtA (magnesium)	5.90	5E-6
phoQ (regulator, magnesium)	0.79	0.009
pstSCAB^* (phosphate)	3.61	0.01
phoBR^* (regulator, phosphate assimilation)	2.80	0.02

Open in a new tab

Values for transcripts of the first gene of the operon are given. Results for other genes of the operon are in Supplementary file 2.

Figure 12. — The effects of low putrescine are shown. Genes and processes (transport and transcriptional regulators) in red have fewer transcripts, while those in black or blue have more. The dashed lines represent the proposed reduction in metabolic flux because of fewer transcripts from genes coding for the enzymes involved. Operons are shown except for the larger operons or regulons. For example, *pur* is meant to represent the unlinked genes that code for enzymes of purine synthesis. Table 2 or Supplementary file 2 should be consulted for specific genes and the quantitative change in transcripts.

Putrescine affects energy metabolism which could account for loss of motility

Loss of speB affected transcripts for genes of the major energy metabolism pathways (Table 2): fewer transcripts for genes coding for all citric acid cycle enzymes, NADH dehydrogenase I (the entire nuo operon), cytochrome oxidase (the cyo operon), and several genes of menaquinone (the menFDHBCE operon), ubiquinone, and heme synthesis. The speB mutant also had fewer transcripts for all genes of iron acquisition, which is consistent with diminished oxidative energy generation. A speB mutant had fewer transcripts for ptsH (Hpr of the phosphotransferase system of carbohydrate transport), ptsG (enzyme IIBC component of glucose transport), gltA (citrate synthase), sdhA (a succinate dehydrogenase subunit), and sucC (a succinyl-CoA synthetase subunit), and their loss has been shown to either impair or eliminate W3110 surface motility (Sudarshan et al., 2021). The cumulative effect of these differences could account for the motility defect in the speB mutant.

Discussion

Several aspects of polyamine metabolism affect PDSM in E. coli. Strains with loss of one or two polyamine synthesis genes ― speA and speB single mutants and a speC speF double mutant ― resulted in PDSM defects. This observation is remarkable because nine enzymes and several pathways are involved in polyamine synthesis. Our putrescine synthesis mutants had no growth defect which is not unexpected since deletions of eight biosynthetic genes were required to show a strong phenotype: impaired aerobic growth and elimination of anaerobic growth (Chattopadhyay et al., 2009). Strains with defects in the two most active putrescine transport systems had altered PDSM. The specific defects suggest the involvement of extracellular putrescine and arginine in intracellular putrescine homeostasis. The PDSM defect of putrescine transport mutants not only implicates extracellular putrescine but also suggests secretion of putrescine which is not added to the medium. The PDSM defect of speA and speB mutants implicates extracellular arginine because SpeA is mostly periplasmic (Tabor and Tabor, 1969). Defective putrescine catabolism also affected PDSM. The role of both putrescine synthesis and degradation suggests rapid adjustments to fluctuating putrescine concentrations and environmental conditions: putrescine catabolism is a core response to several stresses (Schneider et al., 2013).

Results from an RNAseq analysis showed that transcription of the fim operon was reduced in the speB mutant. Of the known transcription factors that control the fim operon, only the gene for H-NS had fewer transcripts. In contrast, transcripts for other relevant transcription factor genes were elevated in the speB mutant. Our results are consistent with H-NS mediating putrescine-dependent control, but we cannot exclude a general regulatory dysfunction mediated by altered nucleoprotein complexes at the fim operon promoter. The elevated transcripts for some transcription factors may be inhibitory.

The transcriptomic results showed that the speB mutant had more transcripts for genes whose products will maintain intracellular putrescine, which suggests compensatory mechanisms for low intracellular putrescine (Figure 11). The speB mutant also had more transcripts for magnesium and phosphate transport genes. The elevated transcripts for magnesium transport genes could compensate for low putrescine to the extent that magnesium can directly replace putrescine, e.g., binding to nucleotides and RNA (Miyamoto et al., 1993). Two recent studies observed an inverse correlation between intracellular magnesium and polyamines in Salmonella and proposed that either magnesium or the polyamines maintained an overall divalent cation homeostasis (Iwadate et al., 2023; Duprey and Groisman, 2020). The rationale for an increase in anionic phosphate assimilation is less clear, although the major phosphate permease transports metal-phosphates, including magnesium-phosphate (van Veen et al., 1994), which could help to compensate for low putrescine. Regardless of the rationale, the substantial changes in gene expression due to low putrescine suggest multiple compensatory mechanisms.

A major observation of the RNAseq analysis is that loss of speB lowered transcripts for many genes of energy metabolism and all genes of iron acquisition. This gene expression pattern suggests that low putrescine diverts metabolism away from energy generation and toward putrescine synthesis, i.e., a prioritization of putrescine synthesis over aerobic energy metabolism. Oxidative energy metabolism and putrescine synthesis compete for α-ketoglutarate and the metabolic diversion could also be a potential compensatory mechanism for low putrescine. Another way of looking at this relationship is that intracellular putrescine positively correlates with oxidative energy metabolism. Deletion of ptsH, ptsG, gltA, sdhA, and sucC have been shown to impair W3110 PDSM which suggests that a major, possibly the primary, effect of low putrescine is reduced energy generation.

In contrast to our results, a thorough and well-designed study showed that E. coli PDSM requires spermidine instead of putrescine (Kurihara et al., 2009). The differences between the studies were strain backgrounds, media (glucose-LB vs glucose-tryptone), and incubation temperature (33° vs 37°). We found that PDSM results for 37° incubations were highly variable and resulted in numerous fast-moving variants. Since growth at the higher temperature is faster, and faster growth is associated with higher putrescine (Tweeddale et al., 1998), we propose that growth at 37° results in an inhibitory putrescine concentration. In this case, spermidine would be stimulatory because of its known inhibition of the putrescine biosynthetic enzymes SpeA and SpeC (Applebaum et al., 1977; Wu and Morris, 1973) and subsequent reduction of intracellular putrescine to an optimal concentration. Regardless of the explanation, strain differences are not unexpected because of decades of strain passage for the strains employed with resulting laboratory evolution that can affect any of the numerous factors that control the intracellular putrescine concentration.

The transcript changes observed in our study were different from those in the only other systematic study of putrescine’s effect on E. coli gene expression (Yoshida et al., 2004). Both studies had almost identical experimental designs: 1.0- or 1.14 mM putrescine was added to a speB or speB speC mutant, respectively. Differences in strains, growth media (minimal media vs tryptone-containing media), and growth temperature (33° vs 37°) could account for the discrepancy in results. The most crucial difference could be the growth media: Igarashi and colleagues grew bacteria in a minimal medium, while we grew bacteria in an amino acid-containing medium that was required for surface motility. We propose that the slower growth in minimal medium, possibly correlated with higher guanosine tetraphosphate which is associated with slower growth, counters and obscures many growth-stimulatory putrescine effects. In contrast, the growth stimulation from the amino acids in our medium would not counter putrescine effects and would essentially allow the detection of effects caused solely by changes in putrescine concentrations. Regardless of the explanation, common results can be interpreted as core responses to putrescine limitation. Both studies observed that low putrescine increased transcripts for genes of arginine synthesis and magnesium transport, and reduced transcripts for the sdhCDAB-sucABCD operon which codes for three TCA cycle enzymes. The link between putrescine and arginine synthesis is probably mediated by the ArgR repressor because argR transcripts are 2.5-fold lower (FDR = 0.0004) in the speB mutant (Supplementary file 2).

Several results implicate putrescine in E. coli virulence during urinary tract infections. First, pili-dependent binding to the urothelium is an essential step for uropathogenic E. coli (Flores-Mireles et al., 2015). Second, putrescine is present in urine from infected, but not healthy, individuals (Puebla-Barragan et al., 2020; Satink et al., 1989). Third, urinary putrescine can result from uropathogenic E. coli growth in urine (Satink et al., 1989) and urothelial pathophysiology (Keay et al., 2014). Putrescine’s possible role in virulence is seemingly contradicted by the observation that a speB mutant outcompetes the parental CFT073 in the bladder of mice, i.e., less putrescine synthesis enhanced virulence (Alteri et al., 2009). A majority of uropathogenic E. coli is associated with phylogenetic group B2―including CFT073, whereas most E. coli lab strains, such as W3110, are group A. Group B2 strains lack genes for the major putrescine catabolic pathway and have significantly higher transcripts for genes coding for SpeA and SpeB (Hogins et al., 2023a). Both observations suggest that the cytoplasmic putrescine concentration is higher in group B2 strains. We propose that the putrescine concentration in group B2 strains is normally in the inhibitory range for pili synthesis, and that loss of SpeB reduces putrescine to a level that stimulates pili synthesis. Regardless of the explanation, putrescine control of pili synthesis and other processes in uropathogenic E. coli are worth examination.

Materials and methods

Key resources table.

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Gene (Escherichia coli)	speB	PMID:16738554		P1 transduction construction
Gene (E. coli)	various, see strain list	PMID:16738554		P1 transduction construction
Strain, strain background (E. coli)	W3110	other		Lab strain; history provided in Methods
Genetic reagent (E. coli transducing virus)	P1 vir	other		Lab strain
Antibody	anti-E. coli RpoD (rabbit polyclonal)	Cusabio	Cat #: CSB-PA360419XA01ENV RRID:AB_3678626	1:10,000
Antibody	anti-E. coli FimA (rabbit polyclonal)	Cusabio	Cat #: CSB-PA361210ZA01ENV RRID:AB_3678627	1:10,000
Antibody	Goat anti-rabbit IgG (H+L) HRP conjugated	Cusabio	Cat #: CSB-PA489724 RRID:AB_3678628	1:10,000
Sequence-based reagent	FimA forward	This paper	PCR primers	ATGGTGGGACCGTTCACTTT
Sequence-based reagent	FimA reverse	This paper	PCR primers	GGCAACAGCGGCTTTAGATG
Sequence-based reagent	RpoD forward	This paper	PCR primers	TCGTGTTGAAGCAGAAGAAGCG
Sequence-based reagent	RpoD reverse	This paper	PCR primers	TCGTCATCGCCATCTTCTTCG
Sequence-based reagent	Phase variation test primer 1	This paper	PCR primers	CCGCGATGCTTTCCTCTATG
Sequence-based reagent	Phase variation test primer 2	This paper	PCR primers	TAATGACGCCCTGAAATTGC
Sequence-based reagent	Phase variation test primer 3	This paper	PCR primers	TGCTAACTGGAAAGGCGCTG
Commercial assay or kit	TMB substrate kit	ThermoFisher	Cat #: 34021
Commercial assay or kit	Ligation sequencing DNA V14	Oxford Nanopore Technologies	Cat #: SQK-LSK114
Commercial assay or kit	Rneasy Mini Kit	Qiagen	Cat #: 74104
Commercial assay or kit	RiboMinus Transcriptome Isolation Kit, bacteria	ThermoFisher	Cat #: K155004
Commercial assay or kit	RiboCop rRNA Depletion Kits for Bacteria	Lexogen	Cat #: 126.24
Commercial assay or kit	LunaScript RT Super	NEB	Cat #: E3010
Commercial assay or kit	PowerUp STBR Green Master Mix for qPCR	ThermoFisher	Cat #: A25777
Chemical compound, drug	Eiken Agar	Eiken Chemical Co., Ltd, Tokyo, Japan	Cat #: E-MJ00
Software, algorithm	bcl2fastq (v 4.2.4)	Illumina	RRID:SCR_015058
Software, algorithm	Guppy basecaller (v 6.5.7)	Oxford Nanopore Technologies	RRID:SCR_023196
Software, algorithm	Porechop (v 0.2.4)	Oxford Nanopore Technologies	RRID:SCR_016967
Software, algorithm	Flye (v 2.9.2)	PMID:27956617	RRID:SCR_017016
Software, algorithm	Pilon (v 1.24)	https://doi.org.10.1371/journal.pone.0112963	RRID:SCR_014731
Software, algorithm	Circulator (v 1.5.5)	PMID:26714481
Software, algorithm	Prokka (v 1.14.6)	https://doi.org.10.1093/bioinformatics/btu153	RRID:SCR_014732
Software, algorithm	QUAST (v 5.2.0)	PMID:23422339	RRID:SCR_001228
Software, algorithm	CLC Genomics Workbench	Qiagen	RRID:SCR_011853
Software, algorithm	edgeR	PMID:19910308	RRID:SCR_012802

Open in a new tab

Strains

All strains used for growth rate determinations and motility assays were derivatives of E. coli K-12 strain W3110 and are listed in Table 3. Great variations exist in standard lab strains, including W3110, from different labs. We initially tested nine strains derived from E. coli K-12, mostly from the Coli Genetic Stock Center (Ambagaspitiye et al., 2019), and chose our lab strain because of relative genetic stability and more quantitatively reproducible results. Our strain originated from the lab of Jon Beckwith in the 1960s via the lab of Boris Magasanik where it had been stored in a room temperature stab until the mid-1980s, at which time it was revived and frozen at –80 °C. To construct the mutant strains, the altered allele was obtained from the Keio collection in which the gene of interest had been deleted and replaced with an antibiotic-resistance gene (Baba et al., 2006). The marked deletion allele was transferred into W3110 by P1 transduction (Miller, 1972). The antibiotic gene was removed as described which generated an in-frame deletion (Datsenko and Wanner, 2000).

Table 3. Strains.

Strain name	Genotype	Reference
BLS77	W3110 ∆puuR::cat	Schneider and Reitzer, 2012
BLS80	W3110 ∆puuA::cat	Schneider and Reitzer, 2012
BLS88	W3110 ∆patA ∆puuA	Schneider and Reitzer, 2012
CP2	W3110 ∆patA	Schneider and Reitzer, 2012
IM26	W3110 ∆speB::kan fliC-lacZ	This study
IM27	W3110 ∆speE::kan fliC-lacZ	This study
IM28	W3110 ∆speF::cat fliC-lacZ	This study
IM29	W3110 ∆speC::kan fliC-lacZ	This study
IM34	W3110 ∆speC ∆speF::cat fliC-lacZ	This study
IM60	W3110 ∆cadA::kan fliC-lacZ	This study
IM61	W3110 ∆speA::kan	This study
IM62	W3110 ∆patA ∆puuA ∆speE::kan	This study
IM63	W3110 ∆potE::kan	This study
IM64	W3110 ∆potF::kan	This study
IM65	W3110 ∆plaP::kan	This study
IM66	W3110 ∆puuP::kan	This study
J15	W3110 ΔspeB ΔfliC::kan	This study
SA1	W3110 ∆fliC::kan	This study
SA2	W3110 ∆fimA::kan	This study
SA3	W3110 ∆fliC ∆fimA	This study
SA4	W3110 ∆hns::kan	This study
SA5	W3110 ∆ihfA::kan	This study
SA6	W3110 ∆lrp::kan	This study
W3110-LR referred to as W3110	lacI ^q lacL8	Lab strain

Open in a new tab

Media and growth conditions

For P1 transductions and plasmid transformation experiments, cells were grown in standard LB liquid medium (1% tryptone, 1% NaCl, and 0.5% yeast extract, pH 7.0) at 37°C. Antibiotics were used for selection at concentrations of 25 µg/mL (both chloramphenicol and kanamycin). For growth analysis, bacteria were grown in a liquid motility medium (0.5% glucose, 1% tryptone, and 0.25% NaCl) which we refer to as GT medium. Starter cultures (typically 6–12 hr incubation) were grown in GT medium, harvested by centrifugation, washed twice with phosphate-buffered saline, and re-suspended in GT medium before inoculation. The cells were then grown at 37 °C in aerobic conditions (shaking at 240 rpm) and the turbidity was measured every 30 min. Cell growth was measured in Klett units using a Scienceware Klett colorimeter with a KS-54 filter. 100 Klett units represent an OD₆₀₀ value of about 0.7.

Surface motility assay

For a standard surface motility assay, single colonies from fresh plates (streaked out from frozen stocks a day before) were inoculated in GT medium for 6 hr at 37 °C in aerobic conditions (shaking at 240 rpm). 30 ml of autoclaved GT medium with 0.45% agar (Eiken, Tokyo, Japan) was poured into a sterile polystyrene petri dish (100 mm × 15 mm) and allowed to solidify at room temperature for approximately 6 hr. Then, 1 µL of the pre-motility growth medium was inoculated at the center of the agar plate and incubated at 33°C for 36 hr. Each experiment was performed in triplicate and pictures were taken after 36 hr. Surface motility was extremely sensitive to humidity. Opening the incubator before 36 hr resulted in movement cessation. The surface motility assay was performed at 33 °C because results from incubations at 37°C were highly variable and the cultures more frequently generated genetically stable fast-moving variants.

Swim assay

The media and culturing for swimming motility are identical to that for surface motility, except that the plates contained 0.25% agar and were solidified at room temperature for about 1 hr before inoculation. Then, 1 µL of the culture was stabbed in the center of this swim agar plate and incubated at 33°C for 20 hr. Each experiment was performed in triplicate.

Transmission electron microscopy

Cells from surface motility plates were collected and fixed with 2.5% glutaraldehyde. Bacteria were absorbed onto Foamvar carbon-coated copper grids for 1 min. Grids were washed with distilled water and stained with 1% phosphotungstic acid for 30 s. Washed and stained grids were dried at 37 °C for 10 min. Samples were viewed on a JEOL 1200 EX transmission electron microscope at the University of Texas Southwestern Medical Center (Figure 2) and the University of Texas at Dallas (Figure 8).

ELISA analysis

Cells were grown overnight in 5 mL GT media followed by a 2 hr growth in GT media with 0.0, 0.1, 1.0, or 4.0 mM putrescine. Cells were then lysed using a 24-gauge needle. The cell lysate was diluted to a concentration of 1 mg/mL protein (based on A280) in pH 9.6 coating buffer (3 g Na₂CO₃, 6 g NaHCO₃, 1000 mL distilled water) and then coated onto the walls of a 96-well plate by incubating overnight at 4 °C. The wells were rinsed three times with PBS and further blocked using coating buffer with 1% bovine albumin overnight at 4 °C. The following day, wells were rinsed three times with PBS, and primary antibodies to FimA or RpoD were added following supplier directions. After a 2 hr room temperature incubation, secondary antibodies conjugated to HRP were added and incubated for a further 2 hr. HRP was activated using the TMB substrate kit (Thermo-34021) following the provided protocol. Expression was read on a BioTek plate reader based on the provided kit protocol. Data was blanked to wells only treated with bovine albumin and then normalized to RpoD. Data was generated from technical and biological triplicates.

DNA isolation and genome assembly and annotation for W3110

DNA was isolated based on previously established protocols (Hogins et al., 2023b). Short reads were sequenced at the SeqCenter (Pittsburgh, Pennsylvania) using Illumina tagmentation-based and PCR-based DNA prep and custom IDT indices targeting inserts of 280 bp without further fragmentation or size selection steps. The Illumina NovaSeq X Plus sequencer was run producing 2×151 paired-end reads. Demultiplexing, quality control, and adapter trimmer were performed with bcl-convert (v4.2.4). Total Illumina Reads (R1+R2): 4059078 with 553087045 bps >Q30.

Long reads were prepared using the PCR-free Oxford Nanopore Technologies ligation sequencing kit with the NEBNext companion module. No fragmentation or size selection was performed. Long-read libraries were performed using the R10.4.1 flow cell. The 400bps sequencing mode with a minimum read length of 200 bp was selected. Guppy (v6.5.7) was used at the super-accurate base calling, demultiplexing, and adapter removal. Total long reads: 53773 with 89.607% of bps >Q20.

To generate the completed genome, porechop (v0.2.4) was used to trim residual adapter sequences from long reads. Flye (v2.9.2) was used to generate the de novo assembly under the nano-hq model. Reads longer than the estimated N₅₀ based on a genome size of 6Mbp initiated the assembly. Subsequent polishing using the short read data was performed using Pilon (v1.24) (RRID:SCR_014731) under default parameters. Long-read contigs with an average short-read coverage of 15 X or less were removed from the assembly. The assembled contig was confirmed to be circular via circulator (v1.5.5). Annotation was performed using prokka (v 1.14.6). Finally, statistics were recorded using QUAST (v5.2.0). The final genome contained 1 contig of 4750347 bp with a sequencing depth of 123.92 x. The N₅₀ was 4750347. This genome can be accessed via the accession number CP165600 or via the BioProject PRJNA1142534 via NCBI. The completed genome has an estimated average nucleotide identity of 99.9694 to the W3110 genome deposited to NCBI (genome assembly ASM1024v1).

RNA isolation and quality control

Cells were grown for 2 hr in 1 mL GT media. 60 µL were then added to 1 mL of fresh GT, with or without 1 mM putrescine, and grown for another 2 hr. After growth, the cells were centrifuged, and frozen at –80 °C. The isolation and analysis protocol has been previously published (Hogins et al., 2023a). Cell pellets were thawed, resuspended in 0.7 mL of buffer RLT (Qiagen RNeasy kit), and mechanically lysed using a bead beater (FastPrep-24 Classic from MP Biomedical (RRID:SCR_013308)) set at the highest setting for three 45 s cycles with a 5 min rest period on ice between cycles. Cell lysates were used to isolate RNA using a Qiagen RNeasy mini kit. RNA was quantified, DNase treated, and re-quantified on a nanodrop. RNA that passed the first quality check was analyzed on RNA-IQ (Qubit). RNA with an IQ higher than 7.5 was used. RNA that passed both checks was run on an agarose gel to check for RNA integrity. RT-qPCR was used to ensure there was no DNA contamination. RNA libraries that passed all these quality checks were submitted to the genomics core facility at The University of Texas at Dallas for RNA sequencing. The core performed rRNA removal (RiboMinus Transcriptome Isolation Kit or RiboCop bacterial rRNA depletion—Lexogen), library preparation (Stranded Total RNA Prep—Illumina), and single-end Illumina sequencing.

Reverse transcription quantitative PCR

RNA was isolated as described above. One microgram of RNA was reverse transcribed using LunaScript RT Super Mix (NEB E3010) and another microgram was subjected to the same reaction as the reverse transcribed RNA, except without reverse transcriptase (negative control) following manufacturer instructions. The cDNA was then diluted to 10 ng/µL for qPCR. PCR reactions were composed of 10 ng cDNA, 8 µL of nuclease-free water, 10 nM primers (rpoD: Forward: TCGTGTTGAAGCAGAAGAAGCG; Reverse: TCGTCATCGCCATCTTCTTCG) (fimA: Forward: ATGGTGGGACCGTTCACTTT; Reverse: GGCAACAGCGGCTTTAGATG), and PowerUp SYBR Green 2 X master mix for qPCR (ThermoFisher A25777) in a 20 µL reaction. A Quantstudio 3 qPCR machine was used to generate critical threshold (Ct) values. The Ct values were then analyzed using the 2^-ΔΔC_T method (Livak and Schmittgen, 2001) using rpoD as a library control.

RNAseq analysis

Transcripts were aligned to the W3110 genome and CDS (CP165600) available on NCBI using the CLC genomics workbench (Qiagen version 22.00) for RNA-seq analysis. The gene expression counts generated as this output were used to perform differentially expressed gene (DEG) analysis using EdgeR (version 3.38.4) (RRID:SCR_012802) to analyze read counts (McCarthy et al., 2012; Robinson et al., 2010). DEGs had an adjusted p-value of less than 0.05.

Material availability statement

All strains are available upon request. All mutant alleles are readily accessible via the KEIO mutant collection (Baba et al., 2006).

Acknowledgements

This work was funded through private donations. PEZ received endowment support from the Cain Foundation through the Felecia and John Cain Distinguished Chair in Women’s Health in honor of Philippe E Zimmern, MD. The authors declare no potential conflicts of interest.

The authors (JH, SH, GV, and LR) would like to thank Prof. Kelli Palmer of The University of Texas at Dallas for the use of her space, supplies, and tissue homogenizer. JH would like to further thank Prof. Palmer for the use of her CLC genomics program. The authors would like to thank the Genome Center at The University of Texas at Dallas for the services to support our research. The authors would like to thank the Olympus Discovery Center/Imaging Core facility at UT Dallas for providing equipment and support (Figure 8), and the UT Southwestern Medical Center for electron microscopy (Figure 2).

Funding Statement

This work was funded through private donations. PEZ received endowment support from the Cain Foundation through the Felecia and John Cain Distinguished Chair in Women's Health in honor of Philippe E Zimmern, MD. The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Contributor Information

Larry Reitzer, Email: reitzer@utdallas.edu.

Bavesh D Kana, University of the Witwatersrand, South Africa.

Funding Information

This paper was supported by the following grant:

Cain Foundation The Felecia and John Cain Distinguished Chair in Women’s Health, in Honor of Philippe Zimmern, M.D. to Philippe E Zimmern.

Additional information

Competing interests

No competing interests declared.

Author contributions

Formal analysis, Validation, Investigation, Visualization, Writing – original draft.

Data curation, Formal analysis, Supervision, Validation, Investigation, Visualization, Methodology, Writing – original draft, Project administration, Writing – review and editing.

Formal analysis, Investigation, Visualization, Methodology.

Formal analysis, Validation, Investigation, Visualization, Methodology.

Formal analysis, Validation, Investigation, Visualization.

Supervision, Funding acquisition, Writing – review and editing.

Conceptualization, Resources, Data curation, Formal analysis, Supervision, Funding acquisition, Validation, Investigation, Visualization, Methodology, Writing – original draft, Project administration, Writing – review and editing.

Additional files

Supplementary file 1. Expression graphs comparing the logCPM of the transcriptomes of the average of the three replicates of the W3110 with and without 1 mM putrescine and the speB mutant with and without 1 mM putrescine.

A regression line was calculated and the correlation between each set of transcriptomes was noted on the graph. Higher R2 values indicate greater similarity between the transcriptomes.

elife-102439-supp1.pdf^{(2.5MB, pdf)}

Supplementary file 2. Differential gene expression analysis of W3110 and ΔspeB.

J15 refers to the ΔspeB mutant. In the tab labeled ‘W3110_0_vs_J15_1_ Putrescine’ W3110 was grown without putrescine, and J15 was grown with 1.0 mM putrescine; positive fold change values refer to increases in J15 gene expression.

elife-102439-supp2.xlsx^{(1.1MB, xlsx)}

MDAR checklist

elife-102439-mdarchecklist1.docx^{(88KB, docx)}

Data availability

The raw RNA seq reads were deposited in GenBank: BioProject accession number PRJNA1126736. The genome was deposited in GenBank: BioProject accession number PRJNA1142534. The genome accession number is CP165600.

The following datasets were generated:

Hogins J, Reitzer L. 2024. Transcriptomic Sequencing of a speB mutant in Escherichia coli W3110. NCBI BioProject. PRJNA1126736

Hogins J, Reitzer L. 2024. Escherichia coli str. K-12 substr. W3110 Genome sequencing. NCBI BioProject. PRJNA1142534

Hogins J, Reitzer L. 2025. Escherichia coli str. K-12 substr. W3110 chromosome, complete genome. NCBI Nucleotide. CP165600

References

Alteri CJ, Smith SN, Mobley HLT. Fitness of Escherichia coli during urinary tract infection requires gluconeogenesis and the TCA cycle. PLOS Pathogens. 2009;5:e1000448. doi: 10.1371/journal.ppat.1000448. [DOI] [PMC free article] [PubMed] [Google Scholar]
Ambagaspitiye S, Sudarshan S, Hogins J, McDill P, De Nisco NJ, Zimmern PE, Reitzer L. Fimbriae and flagella mediated surface motility and the effect of glucose on nonpathogenic and uropathogenic Escherichia coli. bioRxiv. 2019 doi: 10.1101/840991. [DOI]
Applebaum DM, Dunlap JC, Morris DR. Comparison of the biosynthetic and biodegradative ornithine decarboxylases of Escherichia coli. Biochemistry. 1977;16:1580–1584. doi: 10.1021/bi00627a008. [DOI] [PubMed] [Google Scholar]
Armbruster CE, Hodges SA, Mobley HLT. Initiation of swarming motility by proteus mirabilis occurs in response to specific cues present in urine and requires excess L-glutamine. Journal of Bacteriology. 2013;195:1305–1319. doi: 10.1128/JB.02136-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
Baba T, Ara T, Hasegawa M, Takai Y, Okumura Y, Baba M, Datsenko KA, Tomita M, Wanner BL, Mori H. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Molecular Systems Biology. 2006;2:e0050. doi: 10.1038/msb4100050. [DOI] [PMC free article] [PubMed] [Google Scholar]
Chattopadhyay MK, Tabor CW, Tabor H. Polyamines are not required for aerobic growth of Escherichia coli: preparation of a strain with deletions in all of the genes for polyamine biosynthesis. Journal of Bacteriology. 2009;191:5549–5552. doi: 10.1128/JB.00381-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
Conway C, Beckett MC, Dorman CJ. The DNA relaxation-dependent OFF-to-ON biasing of the type 1 fimbrial genetic switch requires the Fis nucleoid-associated protein. Microbiology. 2023;169:001283. doi: 10.1099/mic.0.001283. [DOI] [PMC free article] [PubMed] [Google Scholar]
Datsenko KA, Wanner BL. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. PNAS. 2000;97:6640–6645. doi: 10.1073/pnas.120163297. [DOI] [PMC free article] [PubMed] [Google Scholar]
Duprey A, Groisman EA. DNA supercoiling differences in bacteria result from disparate DNA gyrase activation by polyamines. PLOS Genetics. 2020;16:e1009085. doi: 10.1371/journal.pgen.1009085. [DOI] [PMC free article] [PubMed] [Google Scholar]
Flores-Mireles AL, Walker JN, Caparon M, Hultgren SJ. Urinary tract infections: epidemiology, mechanisms of infection and treatment options. Nature Reviews. Microbiology. 2015;13:269–284. doi: 10.1038/nrmicro3432. [DOI] [PMC free article] [PubMed] [Google Scholar]
Fukuchi J, Kashiwagi K, Yamagishi M, Ishihama A, Igarashi K. Decrease in cell viability due to the accumulation of spermidine in spermidine acetyltransferase-deficient mutant of Escherichia coli. The Journal of Biological Chemistry. 1995;270:18831–18835. doi: 10.1074/jbc.270.32.18831. [DOI] [PubMed] [Google Scholar]
Hogins J, Xuan Z, Zimmern PE, Reitzer L. The distinct transcriptome of virulence-associated phylogenetic group B2 Escherichia coli. Microbiology Spectrum. 2023a;11:e0208523. doi: 10.1128/spectrum.02085-23. [DOI] [PMC free article] [PubMed] [Google Scholar]
Hogins J, Zimmern PE, Reitzer L. Genome sequences of seven clade B2 Escherichia coli strains associated with recurrent urinary tract infections in postmenopausal women. Microbiology Resource Announcements. 2023b;12:e0003523. doi: 10.1128/mra.00035-23. [DOI] [PMC free article] [PubMed] [Google Scholar]
Igarashi K, Kashiwagi K. Polyamines: mysterious modulators of cellular functions. Biochemical and Biophysical Research Communications. 2000;271:559–564. doi: 10.1006/bbrc.2000.2601. [DOI] [PubMed] [Google Scholar]
Igarashi K, Ito K, Kashiwagi K. Polyamine uptake systems in Escherichia coli. Research in Microbiology. 2001;152:271–278. doi: 10.1016/s0923-2508(01)01198-6. [DOI] [PubMed] [Google Scholar]
Igarashi K, Kashiwagi K. Modulation of protein synthesis by polyamines. IUBMB Life. 2015;67:160–169. doi: 10.1002/iub.1363. [DOI] [PubMed] [Google Scholar]
Iwadate Y, Golubeva YA, Slauch JM. Cation homeostasis: coordinate regulation of polyamine and magnesium levels in Salmonella. mBio. 2023;14:e0269822. doi: 10.1128/mbio.02698-22. [DOI] [PMC free article] [PubMed] [Google Scholar]
Karp PD, Ong WK, Paley S, Billington R, Caspi R, Fulcher C, Kothari A, Krummenacker M, Latendresse M, Midford PE, Subhraveti P, Gama-Castro S, Muñiz-Rascado L, Bonavides-Martinez C, Santos-Zavaleta A, Mackie A, Collado-Vides J, Keseler IM, Paulsen I. The EcoCyc Database. EcoSal Plus. 2018;8:e2018. doi: 10.1128/ecosalplus.ESP-0006-2018. [DOI] [PMC free article] [PubMed] [Google Scholar]
Keay SK, Birder LA, Chai TC. Evidence for bladder urothelial pathophysiology in functional bladder disorders. BioMed Research International. 2014;2014:865463. doi: 10.1155/2014/865463. [DOI] [PMC free article] [PubMed] [Google Scholar]
Kelly A, Conway C, O Cróinín T, Smith SGJ, Dorman CJ. DNA supercoiling and the Lrp protein determine the directionality of fim switch DNA inversion in Escherichia coli K-12. Journal of Bacteriology. 2006;188:5356–5363. doi: 10.1128/JB.00344-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
Keseler IM, Mackie A, Santos-Zavaleta A, Billington R, Bonavides-Martínez C, Caspi R, Fulcher C, Gama-Castro S, Kothari A, Krummenacker M, Latendresse M, Muñiz-Rascado L, Ong Q, Paley S, Peralta-Gil M, Subhraveti P, Velázquez-Ramírez DA, Weaver D, Collado-Vides J, Paulsen I, Karp PD. The EcoCyc database: reflecting new knowledge about Escherichia coli K-12. Nucleic Acids Research. 2017;45:D543–D550. doi: 10.1093/nar/gkw1003. [DOI] [PMC free article] [PubMed] [Google Scholar]
Kurihara S, Suzuki H, Tsuboi Y, Benno Y. Dependence of swarming in Escherichia coli K-12 on spermidine and the spermidine importer. FEMS Microbiology Letters. 2009;294:97–101. doi: 10.1111/j.1574-6968.2009.01552.x. [DOI] [PubMed] [Google Scholar]
Kurihara S, Suzuki H, Oshida M, Benno Y. A novel putrescine importer required for type 1 pili-driven surface motility induced by extracellular putrescine in Escherichia coli K-12. The Journal of Biological Chemistry. 2011;286:10185–10192. doi: 10.1074/jbc.M110.176032. [DOI] [PMC free article] [PubMed] [Google Scholar]
Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
McCarthy DJ, Chen Y, Smyth GK. Differential expression analysis of multifactor RNA-Seq experiments with respect to biological variation. Nucleic Acids Research. 2012;40:4288–4297. doi: 10.1093/nar/gks042. [DOI] [PMC free article] [PubMed] [Google Scholar]
Miller JH. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory; 1972. [Google Scholar]
Miyamoto S, Kashiwagi K, Ito K, Watanabe S, Igarashi K. Estimation of polyamine distribution and polyamine stimulation of protein synthesis in Escherichia coli. Archives of Biochemistry and Biophysics. 1993;300:63–68. doi: 10.1006/abbi.1993.1009. [DOI] [PubMed] [Google Scholar]
O’Gara JP, Dorman CJ. Effects of local transcription and H-NS on inversion of the fim switch of Escherichia coli. Molecular Microbiology. 2000;36:457–466. doi: 10.1046/j.1365-2958.2000.01864.x. [DOI] [PubMed] [Google Scholar]
Puebla-Barragan S, Renaud J, Sumarah M, Reid G. Malodorous biogenic amines in Escherichia coli-caused urinary tract infections in women-a metabolomics approach. Scientific Reports. 2020;10:9703. doi: 10.1038/s41598-020-66662-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
Robinson MD, McCarthy DJ, Smyth GK. edgeR: a bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics. 2010;26:139–140. doi: 10.1093/bioinformatics/btp616. [DOI] [PMC free article] [PubMed] [Google Scholar]
Sakamoto A, Sahara J, Kawai G, Yamamoto K, Ishihama A, Uemura T, Igarashi K, Kashiwagi K, Terui Y. Cytotoxic mechanism of excess polyamines functions through translational repression of specific proteins encoded by polyamine modulon. International Journal of Molecular Sciences. 2020;21:2406. doi: 10.3390/ijms21072406. [DOI] [PMC free article] [PubMed] [Google Scholar]
Satink HP, Hessels J, Kingma AW, van den Berg GA, Muskiet FA, Halie MR. Microbial influences on urinary polyamine excretion. Clinica Chimica Acta; International Journal of Clinical Chemistry. 1989;179:305–314. doi: 10.1016/0009-8981(89)90093-4. [DOI] [PubMed] [Google Scholar]
Schneider BL, Reitzer L. Pathway and enzyme redundancy in putrescine catabolism in Escherichia coli. Journal of Bacteriology. 2012;194:4080–4088. doi: 10.1128/JB.05063-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
Schneider BL, Hernandez VJ, Reitzer L. Putrescine catabolism is a metabolic response to several stresses in Escherichia coli. Molecular Microbiology. 2013;88:537–550. doi: 10.1111/mmi.12207. [DOI] [PMC free article] [PubMed] [Google Scholar]
Schwan WR. Regulation of fim genes in uropathogenic Escherichia coli. World Journal of Clinical Infectious Diseases. 2011;1:17–25. doi: 10.5495/wjcid.v1.i1.17. [DOI] [PMC free article] [PubMed] [Google Scholar]
Sudarshan S, Hogins J, Ambagaspitiye S, Zimmern P, Reitzer L. The nutrient and energy pathway requirements for surface motility of nonpathogenic and uropathogenic Escherichia coli. Journal of Bacteriology. 2021;203:e46720. doi: 10.1128/jb.00467-2010.1128/jb.00467-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
Sugiyama Y, Nakamura A, Matsumoto M, Kanbe A, Sakanaka M, Higashi K, Igarashi K, Katayama T, Suzuki H, Kurihara S. A novel putrescine exporter sapBCDF of Escherichia coli. The Journal of Biological Chemistry. 2016;291:26343–26351. doi: 10.1074/jbc.M116.762450. [DOI] [PMC free article] [PubMed] [Google Scholar]
Tabor H, Tabor CW. Partial separation of two pools of arginine in Escherichia coli; preferential use of exogenous rather than endogenous arginine for the biosynthesis of 1,4-diaminobutane. The Journal of Biological Chemistry. 1969;244:6383–6387. [PubMed] [Google Scholar]
Tabor CW, Tabor H. Polyamines. Annual Review of Biochemistry. 1984;53:749–790. doi: 10.1146/annurev.bi.53.070184.003533. [DOI] [PubMed] [Google Scholar]
Tabor CW, Tabor H. Polyamines in microorganisms. Microbiological Reviews. 1985;49:81–99. doi: 10.1128/mr.49.1.81-99.1985. [DOI] [PMC free article] [PubMed] [Google Scholar]
Tweeddale H, Notley-McRobb L, Ferenci T. Effect of slow growth on metabolism of Escherichia coli, as revealed by global metabolite pool (“metabolome”) analysis. Journal of Bacteriology. 1998;180:5109–5116. doi: 10.1128/JB.180.19.5109-5116.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
van Veen HW, Abee T, Kortstee GJ, Konings WN, Zehnder AJ. Translocation of metal phosphate via the phosphate inorganic transport system of Escherichia coli. Biochemistry. 1994;33:1766–1770. doi: 10.1021/bi00173a020. [DOI] [PubMed] [Google Scholar]
Wu WH, Morris DR. Biosynthetic arginine decarboxylase from Escherichia coli. Journal of Biological Chemistry. 1973;248:1687–1695. doi: 10.1016/S0021-9258(19)44245-2. [DOI] [PubMed] [Google Scholar]
Yokota T, Gots JS. Requirement of adenosine 3’, 5’-cyclic phosphate for flagella formation in Escherichia coli and Salmonella typhimurium. Journal of Bacteriology. 1970;103:513–516. doi: 10.1128/jb.103.2.513-516.1970. [DOI] [PMC free article] [PubMed] [Google Scholar]
Yoshida M, Kashiwagi K, Shigemasa A, Taniguchi S, Yamamoto K, Makinoshima H, Ishihama A, Igarashi K. A unifying model for the role of polyamines in bacterial cell growth, the polyamine modulon. The Journal of Biological Chemistry. 2004;279:46008–46013. doi: 10.1074/jbc.M404393200. [DOI] [PubMed] [Google Scholar]

eLife. doi: 10.7554/eLife.102439.3.sa0

eLife Assessment

Bavesh D Kana ¹

This valuable study presents an interesting analysis of the role of the polyamine precursor putrescine in the pili-dependent surface motility of a laboratory strain of Escherichia coli. The overall data convincingly demonstrate a role in this case. This study presents interesting findings for those studying uropathogenic bacteria, and those studying bacterial polyamine function.

eLife. doi: 10.7554/eLife.102439.3.sa1

Reviewer #2 (Public review):

Anonymous

Summary:

Mehta et al., in constructing E. coli strains unable to synthesize polyamines, noted that strains deficient in putrescine synthesis showed decreased movement on semisolid agar. They show that strains incapable of synthesizing putrescine have decreased expression of Type I pilin and, hence, decreased ability to perform pilin-dependent surface motility.

Strengths:

The authors characterize the specific polyamine pathways that are important for this phenomenon. RNAseq provides a detailed overview of gene expression in the strain lacking putrescine. They rule out potential effects of pilin phase variation on the phenotype. The data suggest homeostatic control of polyamine synthesis and metabolic changes in response to putrescine.

Weaknesses:

The authors do not, in the end, uncover the molecular details of pilin expression per se, but that would require significantly more analyses and data; the mechanisms of pilin regulation are complicated and still not completely understood.

eLife. doi: 10.7554/eLife.102439.3.sa2

Reviewer #3 (Public review):

Anonymous

Summary:

This study by Mehta et al. describes the mechanisms behind the observation that putrescine biosynthesis mutants in Escherichia coli strain W3110 are affected in surface motility. The manuscript shows that the surface motility phenotype is dependent on Type I fimbriae and that putrescine levels affect the expression level of fimbriae. The results further suggest that without putrescine, the metabolism of the cell is shifted towards production of putrescine and away from energy metabolism.

Strengths:

The authors show the effect of putrescine on the regulation of type I fimbriae using various strategies (mutants, addition of exogenous, RNA seq, etc.). All experiments converge to the same conclusion that an optimal level of putrescine is needed.

Weakness:

The authors use one isolate of E. coli strain W3110, that contains an insertion in fimE which controls the expression of type I fimbriae. The insertion in fimE likely modifies the ratio of cells expressing fimbriae in the population, and it would be important to confirm the results in other isolates or other strains.

eLife. 2025 Apr 3;13:RP102439. doi: 10.7554/eLife.102439.3.sa3

Author response

Iti Mehta ¹, Jacob B Hogins ², Sydney R Hall ³, Gabrielle Vragel ⁴, Sankalya Ambagaspitiye ⁵, Philippe E Zimmern ⁶, Larry Reitzer ⁷

The following is the authors’ response to the original reviews.

Alternate explanations for major conclusions.

The major conclusions are (a) surface motility of W3110 requires pili which is not novel, (b) pili synthesis and pili-dependent surface motility require putrescine — 1 mM is optimal, and 4 mM is inhibitory, and (c) the existence of a putrescine homeostatic network that maintains intracellular putrescine that involves compensatory mechanisms for low putrescine, including diversion of energy generation toward putrescine synthesis.

Conclusion a: Reviewer 3 suggests that the mutant may have lost surface motility because of outer surface structures that actually mediate motility but are co-regulated with or depend on pili synthesis. The reviewer explicitly suggests flagella as the alternate appendage, although flagella and pili are reciprocally regulated. Most experiments were performed in a ΔfliC background, which lacks the major flagella subunit, in order to prevent the generation of fast-moving flagella-dependent variants. Furthermore, no other surface structure that could mediate surface motility is apparent in the electron microscope images. This observation does not definitively rule out this possibility, especially because of the large transcriptomic changes with low putrescine. Our explanation is the simplest.

Conclusion b, first comment: Reviewer 1 states that “it is not possible to conclude that the effects of gene deletions to biosynthetic, transport or catabolic genes on pili-dependent surface motility are due to changes in putrescine levels unless one takes it on faith that there must be changes to putrescine levels.” The comment ignores both the nutritional supplementation and the transcript changes that strongly suggest compensatory mechanisms for low putrescine. Why compensate if the putrescine concentration does not change? The reviewer then implicitly acknowledges changes in putrescine content: “it is important to know how much putrescine must be depleted in order to exert a physiological effect”.

Conclusion b, second comment: Reviewer 1 proposes that agmatine accumulation can account for some of the observed properties, but which property is not specified. With respect to motility, agmatine accumulation cannot account for motility defects because motility is impaired in (a) a speA mutant which cannot make agmatine and (b) a speC speF double mutant which should not accumulate agmatine. With respect to the transcriptomic results, even if high agmatine is the reason for some transcript changes, the results still suggest a putrescine homeostasis network.

Conclusion c: the reviewers made no comments on the RNAseq analysis or the interpretation of the existence of a homeostatic network.

Additional experiments proposed.

Complementation. Reviewers 1 and 3 suggested complementation experiments, but the latter states that nutritional supplementation strengthens our arguments. The most relevant complementation is with speB. We tried complementation and found that our control plasmid inhibited motility by increasing the lag time before movement commenced. A plasmid with speB did stimulate motility relative to the control plasmid, but movement with the speB plasmid took 4 days, while wild-type movement took 1.5 days. We think that interpretation of this result is ambiguous. We did not systematically search for plasmids that had no effect on motility.

The purpose of complementation is to determine whether a second-site mutation is the actual cause of the motility defect. In this case, the artifact is that an alteration in polyamine metabolism is not the cause of the defect. However, external putrescine reverses the effects on motility and pili synthesis in the speB mutant. This result is inconsistent with a second-site mutation. Still, we agree that complementation is important, and because of our difficulties, we tested numerous mutants with defects in polyamine metabolism. The results present an interpretable and coherent pattern. For example, if putrescine is not the regulator, then mutants in putrescine transport and catabolism should have had no effect. Every single mutant is consistent with a role in movement and pili synthesis. The simplest explanation is that putrescine affects movement and pili synthesis.

Phase variation. Reviewer 2 noted that we did not discuss phase variation. The comment came from the observation that the speB mutant had fewer fimB transcripts which could explain the loss of motility. The reviewer also suggested a simple experiment, which we performed and found that putrescine does not control phase variation. We present those results in the supplemental material. Our discussion of this topic includes a major qualification.

Testing of additional strains. Published results from another lab showed that surface motility of MG1655 requires spermidine instead of putrescine (PMID 19493013 and 21266585). MG1655 and the W3110 that we used in our study are E. coli K-12 derivatives and phylogenetic group A. Any number of changes in enzymes that affect intracellular putrescine concentration could result in different responses to putrescine. We are currently studying pili synthesis and motility in other strains. While that study is incomplete, loss of speB in a strain of phylogenetic group D eliminates no surface motility. This work was intended as our initial analysis and the focus was on a single strain.

Measuring intracellular polyamines. We felt that we had provided sufficient evidence to conclude that putrescine controls pili synthesis and putrescine concentrations are lower in the speB mutant: the nutritional supplementation, the lower levels of transcripts for putrescine catabolic enzymes which require putrescine for their expression strongly suggest lower putrescine in a mutant lacking a putrescine biosynthesis gene, and a transcriptomic analysis that found the speB mutant had transcript changes to compensate for low putrescine. We understand the importance of measuring intracellular polyamines. We are currently examining the quantitative relationship between intracellular polyamines and pili synthesis in multiple strains which respond differently to loss of speB.

Recommendations for the authors:

Reviewer #1 (Recommendations for the authors):

The authors should measure putrescine, agmatine, cadaverine, and spermidine levels in their gene deletion strains.

Polyamine concentration measurements will be part of a separate study on polyamine control of pili synthesis of a uropathogenic strain. A comparison is essential, and the results from W3110 will be part of that study.

Reviewer #2 (Recommendations for the authors):

(1) Line 28. Your statements about urinary tract infections are pure speculation. They are fine for the discussion, but should not be in the abstract.

The abstract from line 27 on has been reworked. The comment of the reviewer is fair.

(2) Line 65. Do we need this discussion about the various strains? If you keep it, you should point out that they were all W3110 strains. But you could just say that you confirmed that your background strain can do PDSM (since you are also not showing any data for the other isolates). Discussing the various strains implies that you are not confident in your strain and raises the question of why you didn't use a sequenced wt MG1655, or something like that.

This section has been reworked. Our strain of W3110 has an insertion in fimB which is relevant for movement but does not affect our results. The insertion limits our conclusions about phase variation. We want to point out that strains variations are large. We also sequenced our strain of W3110.

(3) Related. You occasionally use "W3110-LR" to designate the wild type. You use this or not, but be consistent throughout the text.

Fixed

(4) Line 99. Does eLife allow "data not shown"?

(5) Line 119. As you note, the phenotype of the puuA patA double mutant is exactly the opposite of what one would expect. Although you provide additional evidence that high levels also inhibit motility, complementing the double mutant would provide confidence that the strain is correct.

We rapidly ran into issues with complementation which are discussed in public responses to reviewer comments.

(6) Figure 6C. Either you need to quantify these data or you need a better picture.

The files were corrupted. It was repeated several time, but we lost the other data.

(7) Figure 7. Label panels A and B to indicate that these strains are speB. Also, you need to switch panels C and D to match the order of discussion in the manuscript.

Done

(8) Line 134. Is there a statistically significant difference in the ELISA between 1 and 4 mM? You need to say one way or the other.

No statistical significance and this has been added to the paper

(9) Figure 10C. You need to quantify these data.

Quantification added as an extra panel.

(10) Line 164. You include H-NS in the group of "positive effectors that control fim operon expression" and you reference Ecocyc, rather than any primary reference. Nowhere in the manuscript do you mention phase variation. In the speB mutant, you see decreased fimB, increased fimE, and decreased hns expression. My interpretation of the literature suggests that this would drive the fim switch to the off-state. This could certainly explain some of the results. It is also easily measurable with PCR. This might require testing cells scraped directly from the plates.

The experiments were performed. There is no need to scrap cells from plates because the fimB result from RNAseq was from a liquid culture, and the prediction would be that the phase-locking should be evident in these cells.

(11) Figure 10. Likewise, do you know that your hns mutant is not locked in the off-state? Granted, the original hns mutants (pilG) showed increased rates of switching, but growth conditions might matter.

We also did phase variation for the hns mutant and the hns mutant was not phase locked. This result is shown. In addition to growth conditions, the strain probably matters.

(12) Line 342. You describe the total genome sequencing of W3110, yet this is not mentioned anywhere else in the manuscript.

It is now

Minor points:

(13) Line 192. "One of the most differentially expressed genes...".

(14) Line 202. "...implicates extracellular putrescine in putrescine homeostasis."

(15) Line 209. "...potential pili regulators...".

(16) You are using a variety of fonts on the figures. Pick one.

(17) Figure 9A. It took me a few minutes to figure out the labeling for this figure and I was more confused after reading the legend. It would be simpler to independently label red triangles, blue triangles, red circles, and blue circles.

(18) Figure 9B and 10. The reader can likely figure out what W3110_1.0_3 means, but more straightforward labeling would be better, or you need to define these labels.

All points were addressed and fixed.

Reviewer #3 (Recommendations for the authors):

Other comments:

(1) Please go through the figures and the reference to figures in the text, as they often do not refer to the right panel (ex: figures 2 and 7 for instance). In the text, please homogenize the reference to figures (Figure 2C vs Figure 3). To help compare motility experiments between figures, please use the same scale in all figures.

This has been fixed.

(2) Lines 65-70: I am not sure I get the reason behind choosing the W3110 strain from your lab stock. In what background were the initial mutants constructed (from l.64-65)? Were the nine strains tested, all variations of W3110? If so, is the phenotype described in the manuscript robust in all strains?

We have provided more explanation. W3110 was the most stable: insertions that allowed flagella synthesis in the presence of glucose were frequent. We deleted the major flagella subunit for most experiments. Before introduction of the fliC deletion, we needed to perform experiments 10 times so that fast-moving variants, which had mutationally altered flagella synthesis, did not complicate results.

(3) Line 82-84: As stated in the public review, I think more controls are needed before making this conclusion, especially as type I fimbriae are usually involved in sessile phenotypes.

Response provided in the public response.

(4) In Figure 3: Changing the order of the image to follow the text would make the figure easier to follow.

Fixed as requested

(5) Lines 100-101: simultaneous - the results presented here do not support this conclusion. In Figure 4b, the addition of putrescine to speB mutants is actually not different from WT. From the results, it seems like one of biosynthesis or transport is needed, but it's not clear if both are needed simultaneously. For this, a mutant with no biosynthesis and no transport is needed and/or completely non-motile mutants would be needed to compare.

We disagree. If there are two pathways of putrescine synthesis and both are needed, then our conclusion follows.

(6) Lines 104-105: '... because E. coli secretes putrescine.' - not sure why this statement is there, as most transporters tested after are importers of putrescine? It is also not clear to me if putrescine is supplemented in the media in these experiments. If not, is there putrescine in the GT media?

Good points, and this section has been reworded to clarify these issues. Some of the material was moved to the discussion.

(7) Line 109: 'We note that potE and plaP are more highly expressed than potE and puuP...' - first potE should be potF?

This has been corrected.

(8) Figure 8: What is the difference between the TEM images in Figure 1 and here? The WT in Figure 1 does show pili without the supplementation unless I'm missing something here. Please specify.

The reviewer means Figure 2 and not Figure 1. Figure 2 shows a wild-type strain which has both putrescine anabolic pathways while Figure 8 is the ΔspeB strain which lacks one pathway.

(9) Line160-162: Transcripts for the putrescine-responsive puuAP and puuDRCBE operons, which specify genes of the major putrescine catabolic pathway, were reduced from 1.6- to 14- fold (FDR {less than or equal to} 0.02) in the speB mutant (Supplemental Table 1), which implies lower intracellular putrescine. I might not get exactly the point here. If the catabolic pathways are repressed in the speB mutant, then there will be less degradation which means more putrescine!?

Expression of these genes is a function of intracellular putrescine: higher expression means more putrescine. Any discussion of steady putrescine must include the anabolic pathways: the catabolic pathways do not determine the intracellular putrescine, they are a reflection of intracellular putrescine.

(10) Lines 162-163: Deletion of speB reduced transcripts for genes of the fimA operon and fimE, but not of fimB. It seems that the results suggest the opposite a reduction of fimB but not fimE!?

The reviewer is correct, and it is our mistake, and the text now states what is in the figure..

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Citations

Hogins J, Reitzer L. 2024. Transcriptomic Sequencing of a speB mutant in Escherichia coli W3110. NCBI BioProject. PRJNA1126736
Hogins J, Reitzer L. 2024. Escherichia coli str. K-12 substr. W3110 Genome sequencing. NCBI BioProject. PRJNA1142534
Hogins J, Reitzer L. 2025. Escherichia coli str. K-12 substr. W3110 chromosome, complete genome. NCBI Nucleotide. CP165600

Supplementary Materials

A regression line was calculated and the correlation between each set of transcriptomes was noted on the graph. Higher R2 values indicate greater similarity between the transcriptomes.

elife-102439-supp1.pdf^{(2.5MB, pdf)}

Supplementary file 2. Differential gene expression analysis of W3110 and ΔspeB.

elife-102439-supp2.xlsx^{(1.1MB, xlsx)}

MDAR checklist

elife-102439-mdarchecklist1.docx^{(88KB, docx)}

Data Availability Statement

The following datasets were generated:

Hogins J, Reitzer L. 2024. Transcriptomic Sequencing of a speB mutant in Escherichia coli W3110. NCBI BioProject. PRJNA1126736

Hogins J, Reitzer L. 2024. Escherichia coli str. K-12 substr. W3110 Genome sequencing. NCBI BioProject. PRJNA1142534

Hogins J, Reitzer L. 2025. Escherichia coli str. K-12 substr. W3110 chromosome, complete genome. NCBI Nucleotide. CP165600

[bib1] Alteri CJ, Smith SN, Mobley HLT. Fitness of Escherichia coli during urinary tract infection requires gluconeogenesis and the TCA cycle. PLOS Pathogens. 2009;5:e1000448. doi: 10.1371/journal.ppat.1000448. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib2] Ambagaspitiye S, Sudarshan S, Hogins J, McDill P, De Nisco NJ, Zimmern PE, Reitzer L. Fimbriae and flagella mediated surface motility and the effect of glucose on nonpathogenic and uropathogenic Escherichia coli. bioRxiv. 2019 doi: 10.1101/840991. [DOI]

[bib3] Applebaum DM, Dunlap JC, Morris DR. Comparison of the biosynthetic and biodegradative ornithine decarboxylases of Escherichia coli. Biochemistry. 1977;16:1580–1584. doi: 10.1021/bi00627a008. [DOI] [PubMed] [Google Scholar]

[bib4] Armbruster CE, Hodges SA, Mobley HLT. Initiation of swarming motility by proteus mirabilis occurs in response to specific cues present in urine and requires excess L-glutamine. Journal of Bacteriology. 2013;195:1305–1319. doi: 10.1128/JB.02136-12. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib5] Baba T, Ara T, Hasegawa M, Takai Y, Okumura Y, Baba M, Datsenko KA, Tomita M, Wanner BL, Mori H. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Molecular Systems Biology. 2006;2:e0050. doi: 10.1038/msb4100050. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib6] Chattopadhyay MK, Tabor CW, Tabor H. Polyamines are not required for aerobic growth of Escherichia coli: preparation of a strain with deletions in all of the genes for polyamine biosynthesis. Journal of Bacteriology. 2009;191:5549–5552. doi: 10.1128/JB.00381-09. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib7] Conway C, Beckett MC, Dorman CJ. The DNA relaxation-dependent OFF-to-ON biasing of the type 1 fimbrial genetic switch requires the Fis nucleoid-associated protein. Microbiology. 2023;169:001283. doi: 10.1099/mic.0.001283. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib8] Datsenko KA, Wanner BL. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. PNAS. 2000;97:6640–6645. doi: 10.1073/pnas.120163297. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib9] Duprey A, Groisman EA. DNA supercoiling differences in bacteria result from disparate DNA gyrase activation by polyamines. PLOS Genetics. 2020;16:e1009085. doi: 10.1371/journal.pgen.1009085. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib10] Flores-Mireles AL, Walker JN, Caparon M, Hultgren SJ. Urinary tract infections: epidemiology, mechanisms of infection and treatment options. Nature Reviews. Microbiology. 2015;13:269–284. doi: 10.1038/nrmicro3432. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib11] Fukuchi J, Kashiwagi K, Yamagishi M, Ishihama A, Igarashi K. Decrease in cell viability due to the accumulation of spermidine in spermidine acetyltransferase-deficient mutant of Escherichia coli. The Journal of Biological Chemistry. 1995;270:18831–18835. doi: 10.1074/jbc.270.32.18831. [DOI] [PubMed] [Google Scholar]

[bib12] Hogins J, Xuan Z, Zimmern PE, Reitzer L. The distinct transcriptome of virulence-associated phylogenetic group B2 Escherichia coli. Microbiology Spectrum. 2023a;11:e0208523. doi: 10.1128/spectrum.02085-23. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib13] Hogins J, Zimmern PE, Reitzer L. Genome sequences of seven clade B2 Escherichia coli strains associated with recurrent urinary tract infections in postmenopausal women. Microbiology Resource Announcements. 2023b;12:e0003523. doi: 10.1128/mra.00035-23. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib14] Igarashi K, Kashiwagi K. Polyamines: mysterious modulators of cellular functions. Biochemical and Biophysical Research Communications. 2000;271:559–564. doi: 10.1006/bbrc.2000.2601. [DOI] [PubMed] [Google Scholar]

[bib15] Igarashi K, Ito K, Kashiwagi K. Polyamine uptake systems in Escherichia coli. Research in Microbiology. 2001;152:271–278. doi: 10.1016/s0923-2508(01)01198-6. [DOI] [PubMed] [Google Scholar]

[bib16] Igarashi K, Kashiwagi K. Modulation of protein synthesis by polyamines. IUBMB Life. 2015;67:160–169. doi: 10.1002/iub.1363. [DOI] [PubMed] [Google Scholar]

[bib17] Iwadate Y, Golubeva YA, Slauch JM. Cation homeostasis: coordinate regulation of polyamine and magnesium levels in Salmonella. mBio. 2023;14:e0269822. doi: 10.1128/mbio.02698-22. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib18] Karp PD, Ong WK, Paley S, Billington R, Caspi R, Fulcher C, Kothari A, Krummenacker M, Latendresse M, Midford PE, Subhraveti P, Gama-Castro S, Muñiz-Rascado L, Bonavides-Martinez C, Santos-Zavaleta A, Mackie A, Collado-Vides J, Keseler IM, Paulsen I. The EcoCyc Database. EcoSal Plus. 2018;8:e2018. doi: 10.1128/ecosalplus.ESP-0006-2018. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib19] Keay SK, Birder LA, Chai TC. Evidence for bladder urothelial pathophysiology in functional bladder disorders. BioMed Research International. 2014;2014:865463. doi: 10.1155/2014/865463. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib20] Kelly A, Conway C, O Cróinín T, Smith SGJ, Dorman CJ. DNA supercoiling and the Lrp protein determine the directionality of fim switch DNA inversion in Escherichia coli K-12. Journal of Bacteriology. 2006;188:5356–5363. doi: 10.1128/JB.00344-06. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib21] Keseler IM, Mackie A, Santos-Zavaleta A, Billington R, Bonavides-Martínez C, Caspi R, Fulcher C, Gama-Castro S, Kothari A, Krummenacker M, Latendresse M, Muñiz-Rascado L, Ong Q, Paley S, Peralta-Gil M, Subhraveti P, Velázquez-Ramírez DA, Weaver D, Collado-Vides J, Paulsen I, Karp PD. The EcoCyc database: reflecting new knowledge about Escherichia coli K-12. Nucleic Acids Research. 2017;45:D543–D550. doi: 10.1093/nar/gkw1003. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib22] Kurihara S, Suzuki H, Tsuboi Y, Benno Y. Dependence of swarming in Escherichia coli K-12 on spermidine and the spermidine importer. FEMS Microbiology Letters. 2009;294:97–101. doi: 10.1111/j.1574-6968.2009.01552.x. [DOI] [PubMed] [Google Scholar]

[bib23] Kurihara S, Suzuki H, Oshida M, Benno Y. A novel putrescine importer required for type 1 pili-driven surface motility induced by extracellular putrescine in Escherichia coli K-12. The Journal of Biological Chemistry. 2011;286:10185–10192. doi: 10.1074/jbc.M110.176032. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib24] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]

[bib25] McCarthy DJ, Chen Y, Smyth GK. Differential expression analysis of multifactor RNA-Seq experiments with respect to biological variation. Nucleic Acids Research. 2012;40:4288–4297. doi: 10.1093/nar/gks042. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib26] Miller JH. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory; 1972. [Google Scholar]

[bib27] Miyamoto S, Kashiwagi K, Ito K, Watanabe S, Igarashi K. Estimation of polyamine distribution and polyamine stimulation of protein synthesis in Escherichia coli. Archives of Biochemistry and Biophysics. 1993;300:63–68. doi: 10.1006/abbi.1993.1009. [DOI] [PubMed] [Google Scholar]

[bib28] O’Gara JP, Dorman CJ. Effects of local transcription and H-NS on inversion of the fim switch of Escherichia coli. Molecular Microbiology. 2000;36:457–466. doi: 10.1046/j.1365-2958.2000.01864.x. [DOI] [PubMed] [Google Scholar]

[bib29] Puebla-Barragan S, Renaud J, Sumarah M, Reid G. Malodorous biogenic amines in Escherichia coli-caused urinary tract infections in women-a metabolomics approach. Scientific Reports. 2020;10:9703. doi: 10.1038/s41598-020-66662-x. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib30] Robinson MD, McCarthy DJ, Smyth GK. edgeR: a bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics. 2010;26:139–140. doi: 10.1093/bioinformatics/btp616. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib31] Sakamoto A, Sahara J, Kawai G, Yamamoto K, Ishihama A, Uemura T, Igarashi K, Kashiwagi K, Terui Y. Cytotoxic mechanism of excess polyamines functions through translational repression of specific proteins encoded by polyamine modulon. International Journal of Molecular Sciences. 2020;21:2406. doi: 10.3390/ijms21072406. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib32] Satink HP, Hessels J, Kingma AW, van den Berg GA, Muskiet FA, Halie MR. Microbial influences on urinary polyamine excretion. Clinica Chimica Acta; International Journal of Clinical Chemistry. 1989;179:305–314. doi: 10.1016/0009-8981(89)90093-4. [DOI] [PubMed] [Google Scholar]

[bib33] Schneider BL, Reitzer L. Pathway and enzyme redundancy in putrescine catabolism in Escherichia coli. Journal of Bacteriology. 2012;194:4080–4088. doi: 10.1128/JB.05063-11. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib34] Schneider BL, Hernandez VJ, Reitzer L. Putrescine catabolism is a metabolic response to several stresses in Escherichia coli. Molecular Microbiology. 2013;88:537–550. doi: 10.1111/mmi.12207. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib35] Schwan WR. Regulation of fim genes in uropathogenic Escherichia coli. World Journal of Clinical Infectious Diseases. 2011;1:17–25. doi: 10.5495/wjcid.v1.i1.17. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib36] Sudarshan S, Hogins J, Ambagaspitiye S, Zimmern P, Reitzer L. The nutrient and energy pathway requirements for surface motility of nonpathogenic and uropathogenic Escherichia coli. Journal of Bacteriology. 2021;203:e46720. doi: 10.1128/jb.00467-2010.1128/jb.00467-20. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib37] Sugiyama Y, Nakamura A, Matsumoto M, Kanbe A, Sakanaka M, Higashi K, Igarashi K, Katayama T, Suzuki H, Kurihara S. A novel putrescine exporter sapBCDF of Escherichia coli. The Journal of Biological Chemistry. 2016;291:26343–26351. doi: 10.1074/jbc.M116.762450. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib38] Tabor H, Tabor CW. Partial separation of two pools of arginine in Escherichia coli; preferential use of exogenous rather than endogenous arginine for the biosynthesis of 1,4-diaminobutane. The Journal of Biological Chemistry. 1969;244:6383–6387. [PubMed] [Google Scholar]

[bib39] Tabor CW, Tabor H. Polyamines. Annual Review of Biochemistry. 1984;53:749–790. doi: 10.1146/annurev.bi.53.070184.003533. [DOI] [PubMed] [Google Scholar]

[bib40] Tabor CW, Tabor H. Polyamines in microorganisms. Microbiological Reviews. 1985;49:81–99. doi: 10.1128/mr.49.1.81-99.1985. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib41] Tweeddale H, Notley-McRobb L, Ferenci T. Effect of slow growth on metabolism of Escherichia coli, as revealed by global metabolite pool (“metabolome”) analysis. Journal of Bacteriology. 1998;180:5109–5116. doi: 10.1128/JB.180.19.5109-5116.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib42] van Veen HW, Abee T, Kortstee GJ, Konings WN, Zehnder AJ. Translocation of metal phosphate via the phosphate inorganic transport system of Escherichia coli. Biochemistry. 1994;33:1766–1770. doi: 10.1021/bi00173a020. [DOI] [PubMed] [Google Scholar]

[bib43] Wu WH, Morris DR. Biosynthetic arginine decarboxylase from Escherichia coli. Journal of Biological Chemistry. 1973;248:1687–1695. doi: 10.1016/S0021-9258(19)44245-2. [DOI] [PubMed] [Google Scholar]

[bib44] Yokota T, Gots JS. Requirement of adenosine 3’, 5’-cyclic phosphate for flagella formation in Escherichia coli and Salmonella typhimurium. Journal of Bacteriology. 1970;103:513–516. doi: 10.1128/jb.103.2.513-516.1970. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib45] Yoshida M, Kashiwagi K, Shigemasa A, Taniguchi S, Yamamoto K, Makinoshima H, Ishihama A, Igarashi K. A unifying model for the role of polyamines in bacterial cell growth, the polyamine modulon. The Journal of Biological Chemistry. 2004;279:46008–46013. doi: 10.1074/jbc.M404393200. [DOI] [PubMed] [Google Scholar]

PERMALINK

Control of pili synthesis and putrescine homeostasis in Escherichia coli

Iti Mehta

Jacob B Hogins

Sydney R Hall

Gabrielle Vragel

Sankalya Ambagaspitiye

Philippe E Zimmern

Larry Reitzer

Roles

Abstract

Introduction

Figure 1. Pathways and enzymes of polyamine synthesis.

Results

W3110 surface motility requires pili

Figure 2. Surface motility of W3110.

PDSM required two independent putrescine synthesis pathways

Figure 3. Genetics of surface motility.

Figure 3—figure supplement 1. Growth and swimming of polyamine anabolic mutants.

Figure 4. Nutritional supplementation of ΔspeB mutant.

Loss of putrescine transport systems affected surface motility

Figure 5. Putrescine transport and surface motility.

Putrescine catabolism affected surface motility

Figure 6. Putrescine catabolism and surface motility.

High putrescine reduced the expression of pili genes

Figure 7. Surface motility and pili expression in W3110 and ΔspeB.

Figure 8. Transmission electron micrographs of ΔspeB mutant cells after surface motility.

RNAseq analysis identifies fim operon expression and energy metabolism as targets of putrescine control

RNAseq analysis

Table 1. Pairwise statistical comparisons of transcriptomes.

Figure 9. Visual representation of the results from transcriptomic sequencing of W3110 and the ΔspeB mutant’s gene expression in media with and without 1.0 mM putrescine.

Transcription of the fim operon is reduced in the ΔspeB mutant

Figure 10. Transcriptomic sequencing of genes for the fim region and regulators that control fim gene expression.

Putrescine does not control fim operon phase variation in W3110

Figure 11. Phase variation in parental W3110, W3110 ΔspeB, W3110 Δhns, and MG1655.

Evidence for a putrescine homeostatic network

Table 2. Differentially expressed genes that are proposed to contribute to putrescine homeostasis.

Figure 12. The deduced diversion of metabolism in a speB mutant away from energy metabolism toward putrescine synthesis compared to the parental strain.

Putrescine affects energy metabolism which could account for loss of motility

Discussion

Materials and methods

Key resources table.

Strains

Table 3. Strains.

Media and growth conditions

Surface motility assay

Swim assay

Transmission electron microscopy

ELISA analysis

DNA isolation and genome assembly and annotation for W3110

RNA isolation and quality control

Reverse transcription quantitative PCR

RNAseq analysis

Material availability statement

Acknowledgements

Funding Statement

Contributor Information

Funding Information

Additional information

Competing interests

Author contributions

Additional files

Data availability

References

eLife Assessment

Bavesh D Kana

Roles

Reviewer #2 (Public review):

Anonymous

Roles

Reviewer #3 (Public review):

Anonymous

Roles

Author response

Iti Mehta

Jacob B Hogins

Sydney R Hall

Gabrielle Vragel

Sankalya Ambagaspitiye

Philippe E Zimmern