Elevated Linoleic Acid Intake Becomes a Risk Factor for Polycystic Ovary Syndrome by Affecting Ovarian Granulosa Cells

ABSTRACT

Polycystic ovary syndrome (PCOS) is one of the most common endocrine and metabolic disorders in females of reproductive age; this condition is particularly concerning due to its potential to cause infertility. Linoleic acid (LA) is an essential and widely consumed n−6 polyunsaturated fatty acid. In the past decades, LA intake has sharply surged, as recommended by dietary guidelines and advances in the food industry. An increasing number of people are questioning the health benefits of LA. In patients with PCOS, dietary management is crucial for improving symptoms to obtain good outcomes with assisted reproductive technology (ART). Diets rich in n−6 fatty acid has become “arch‐criminal” of “silent inflammation.” PCOS is also associated with low‐grade chronic inflammation. Therefore, identification of the relationship between dietary LA and PCOS is urgently required. In this study, we first conducted experiments to observe the effects of different LA concentrations on PCOS‐related phenotypes in mice. The results showed that medium and high concentrations of LA led to PCOS‐like changes in mice, presenting with disordered estrous cycles, polycystic ovaries, and hyperandrogenism. LA is independent of PCOS‐related weight gain and insulin resistance. LA caused systemic inflammation, reduced antioxidant capacity, and increased ovary apoptosis in mice. To explore how LA acts in vivo, we used the ovarian granulosa cell line KGN to detect alterations in the levels of granulosa cells (GCs). In addition to having no impact on endocrine function, LA can decrease the antioxidant capacity, reduce mitochondrial function, increase the apoptotic rate, and induce inflammation in GCs. To obtain more information, the pretreated GCs were subjected to transcriptome sequencing. The abundant RNA‐Seq results make future directions for understanding the mechanism of LA action on GCs in PCOS more explicit. In summary, elevated LA intake is a risk factor for PCOS that affects ovarian GCs. Further studies should focus on establishing a strict intake range for the prevention and treatment of PCOS.

This study explored the relationship between dietary LA intake and PCOS. Animal experiments demonstrated that increased intake of LA led to PCOS‐like changes in mice, presenting with disordered estrous cycles, polycystic ovaries, and hyperandrogenism. LA is independent of PCOS‐related weight gain and insulin resistance, but it caused systemic inflammation, reduced antioxidant capacity, and increased ovarian apoptosis in mice. Cell experiments revealed that in addition to having no impact on endocrine function, LA can decrease the antioxidant capacity, reduce mitochondrial function, elevate the apoptotic rate, and induce inflammation in GCs. The RNA‐Seq results further provided future research directions for understanding the mechanism of LA action on GCs in PCOS.

Abbreviations

ATP

adenosine triphosphate

BP

biological process

CAT

catalase

CC

cellular component

DEGs

differentially expressed genes

GCs

granulosa cells

GO

Gene ontology

GPx

glutathione peroxidase

GR

glutathione reductase

GSH

reduced glutathione

IL‐1β

interleukin‐1β

IL‐6

interleukin‐6

KEGG

Kyoto Encyclopedia of Genes and Genomes

LA

linoleic acid

MDA

Malondialdehyde

MF

molecular function

MMP

mitochondrial membrane potential

MNCs

mononuclear cells

NEFA

non‐esterified fatty acid

OS

oxidative stress

PCOS

polycystic ovary syndrome

PEG 400

polyethylene glycol 400

PUFA

n−6 polyunsaturated fatty acid

ROS

reactive oxygen species

SDS‐PAGE

sodium dodecyl sulfate‐polyacrylamide gel electrophoresis

SOD

superoxide dismutase

TNF‐α

tumor necrosis factor α

1. Introduction

Polycystic ovary syndrome (PCOS) is one of the most common endocrine and metabolic disorders among women of childbearing age, with a global prevalence of approximately 2%–26% [1, 2]. These differences in prevalence may be due to differences in diagnostic criteria, socioeconomic status, access to healthcare, and health awareness. In clinical practice, PCOS can manifest as menstrual disorders, infertility, hyperandrogenism, obesity, hirsutism, acne, or acanthosis nigricans. According to the widely used Rotterdam diagnostic criteria, patients must possess at least two of the following three manifestations: hyperandrogenism, anovulation or oligovulation, and polycystic ovary morphology [3]. Although genetic factors [4], gonadotropin disorders [5, 6], abnormal follicle development [7, 8], insulin resistance and hyperinsulinemia [9, 10], adipose tissue dysfunction [11], and hyperandrogenism [12] are involved in its pathogenesis, the etiology remains unclear.

Linoleic acid (LA) is an essential n−6 fatty acid in humans and the most commonly consumed polyunsaturated fatty acid in the diet [13]. It is widely present in vegetable oils, nuts, seeds, meat, eggs, and various processed and ultraprocessed foods. LA plays crucial roles in energy supply, cellular support, and signal transduction. Studies have shown that a lack of LA can lead to skin scales, growth retardation, changes in plasma fatty acid patterns, and thrombocytopenia [14]. Increased dietary intake or tissue levels of LA are associated with a lower incidence of cardiovascular diseases (mainly coronary artery disease), metabolic syndrome, type 2 diabetes, and cancer [15, 16]. Given the potential long‐term benefits of LA in reducing the incidence of chronic diseases and the risk of premature death, dietary guidelines and public health institutions worldwide have long emphasized the importance of LA intake. Meanwhile, the continuous homogenization of the global dietary structure [17] and spread of processed foods over the past half century [18] have led to a sharp increase in consumption. Currently, LA consumption by the general population in some countries can reach up to 12.5% of the total calorie intake [19].

However, in recent years, the “beneficial effects” of LA and its protective properties have become increasingly controversial. In 2023, scientists reported a positive correlation between LA intake and cognitive impairment [20]. In 2016, a reanalysis of unpublished documents and raw data from Minnesota coronary artery experiments conducted between 1968 and 1973 found that incompletely published results led to an overestimation of the benefits of replacing saturated fat with LA‐rich vegetable oils [21]. Increasing evidence has suggested that LA is associated with neurodevelopmental abnormalities, brain inflammation, obesity, colitis, and colon cancer [22, 23, 24, 25]. There are very few reports on LA and reproductive diseases; therefore, little is known about the role of LA in reproductive pathology. Considering the cornerstone role of dietary control in the management of PCOS [26, 27], it is urgent to understand the exact role of LA in the occurrence of PCOS.

This article explores the role of LA in PCOS by administering different concentrations of LA orally to female ICR mice for 21 consecutive days to provide direct experimental evidence of the correlation between LA and PCOS and to provide literature support for dietary management of PCOS.

2. Materials and Methods

2.1. Mice Treatment

SPF‐grade female ICR mice (21 days old) used in the experiment were purchased from Liaoning Changsheng Biotechnology Co. Ltd. and housed in the barrier facility of the Jilin University Experimental Animal Center. The lighting schedule was set from 6:00 to 18:00, with the lights turned off for the remaining 12 h. No low‐intensity red lighting was employed during lights off. Ambient temperature in both the housing area and procedure room was maintained at 22°C ± 2°C and humidity at 60% ± 5%. All animal experiments were approved by the Institutional Animal Ethics and Welfare Committee (IACUC) of Jilin University (No. SY202306040) and conducted under supervision. The mice were randomly divided into four groups: control (Con), low‐concentration LA (L), medium‐concentration LA (M), and high‐concentration LA (H), with 10 mice per group. Each cage housed five female mice. LA was dissolved and diluted with polyethylene glycol (PEG) 400. The mice in the L, M, and H groups were treated with LA at concentrations of 900 mg/kg, 1.8 g/kg, and 3.6 g/kg, respectively. An equal volume of PEG 400 was administered to the control group [28, 29]. The mice were administered oral gavage once a day from the age of 22 days, and their body weights were measured daily. All mice received oral gavage for 21 consecutive days. Starting from the 8th day, vaginal lavage was performed daily to obtain vaginal smears. On the second and third days after the last gavage, a glucose tolerance test (GTT) and an insulin tolerance test (ITT) were conducted sequentially. On the next day after conducting all experiments, blood and ovaries were collected.

2.2. Granulosa Cells (GCs) Treatment

KGN cell line (Riken BioResource Research Center, Cat. No. RCB1154) which was authenticated by short tandem repeat (STR) profiling, was used to study the function of GCs. The cryopreserved KGN cell line was retrieved from liquid nitrogen storage and immediately seeded into a 75 cm² culture flask containing DMEM/F12 medium (10% FBS). The cells were cultured at 37°C in a humidified atmosphere with 5% CO₂ until reaching approximately 80% confluence. For subculturing, cells were detached using 0.25% trypsin–EDTA, resuspended in fresh DMEM/F12 medium (10% FBS), and seeded onto cell culture plates at a density adjusted according to experimental requirements. When the cells in culture plates grew to 60%–70% confluence, the DMEM/F12 medium containing 10% FBS was replaced with DMEM/F12 medium containing 2% FBS. The cells were divided into two groups. KGN cells in the LA group were treated with 75 μM LA. KGN cells in the control group received an equal amount of PBS. The LA concentration was selected based on our previously published experimental results [30]. After replacing the culture medium and adding medication, the cells were stimulated for 24 h, and samples were collected for subsequent tests.

2.3. Glucose Tolerance Test (GTT) and Insulin Tolerance Test (ITT)

On the day of the last gavage, mice were fasted at 17:00. After a 16‐h fast, fasting blood glucose was measured at 9:00 the next day, and a 60% glucose solution (2 g/kg) was administered by oral gavage. The concentration of blood glucose in the tail vein was measured 15, 30, 60, 90, and 120 min after glucose gavage.

On the second day, after the completion of the GTT, the mice were fasted for 4 h at 10:00. Blood glucose levels were measured at 14:00, and insulin (0.75 IU/kg, diluted with physiological saline) was injected intraperitoneally. The concentration of blood glucose in the tail vein was measured at 15, 30, 60, 90, and 120 min after injection.

2.4. Ovarian Morphological Assessment

Ovaries were soaked and fixed in 10% formalin solution for 24 h, and then stored in 70% ethanol at 4°C before being embedded in paraffin. Subsequently, 4 μM slices were prepared to perform hematoxylin–eosin (H&E) staining. Finally, ovary morphology was observed using an optical microscope. Classification of ovarian follicle morphology was defined following the recommendations of the National Institute of Child Health and Human Development‐sponsored ovarian nomenclature workshop [31] and ovarian morphology of PCOS in rodent models [32, 33]. Ovarian morphology traits for PCOS include higher numbers of growing follicles and cystic follicles and reduction in the numbers of corpora luteum [34, 35, 36, 37].

2.5. Enzyme‐Linked Immunosorbent Assay (ELISA) for Hormone and Inflammatory Cytokines

The newly collected mouse blood was placed in a refrigerator at 4°C for 2 h, then centrifuged at 3000 rpmor 20 min at 4°C, and the supernatant was carefully collected. The serum samples were kept in a −80°C refrigerator prior to assay. The levels of testosterone (T), estradiol (E₂), progesterone (P), luteinizing hormone (LH), follicle‐stimulating hormone (FSH), interleukin‐6 (IL‐6), interleukin‐1β (IL‐1β), and tumor necrosis factor‐α (TNF‐α) in mouse serum were measured according to the instructions of the corresponding ELISA kit provided by Jiangsu Meimian Industrial Co. Ltd.

2.6. Superoxide Dismutase (SOD), Glutathione Peroxidase (GPx), Glutathione Reductase (GR), Catalase (CAT), Reduced Glutathione (GSH) and Malondialdehyde (MDA) Levels Detection

Cu/Zn‐SOD and Mn‐SOD assay kit with WST‐8 was used to determine the SOD activity, cellular glutathione peroxidase assay kit with NADPH was used to determine the GPx activity, glutathione reductase assay kit with DTNB was used to determine the GR activity, catalase assay kit was used to determine the CAT activity, GSH and GSSG assay kit was used to determine the GSH content and GSH/GSSG ratio, and lipid peroxidation MDA assay kit was used to determine the MDA levels in mouse ovarian tissues. All the kits were purchased from Beyotime Biotechnology (Shanghai, China). Detailed steps are provided in the corresponding instructions.

2.7. Flow Cytometry

The intracellular reactive oxygen species (ROS), apoptosis rate, and mitochondrial membrane potential of pretreated live KGN cells were determined by flow cytometry using the Reactive oxygen species assay kit (Beyotime Biotechnology, China), Annexin V‐FITC apoptosis detection kit (Beyotime Biotechnology, China), and mitochondrial membrane potential assay kit with JC‐1 (Beyotime Biotechnology, China), respectively. MitoSOX Red (Thermo Fisher Scientific) was used to detect the mitochondrial ROS (mito‐ROS).

2.8. Visualized Mitochondrial Membrane Potential

For cells in a six‐well plate, the culture medium was aspirated, and PBS (1 mL/well) was added to wash the cells three times. Next, 1 mL of tetramethylrhodamine ethyl ester (TMRE) staining solution was added to each well and incubated at 37°C for 30 min. After incubation, the supernatant was removed, and the cells were washed twice with a preheated cell culture medium (2% DMEM/F12, 1 mL/well). A preheated cell culture medium (1 mL) was added to each well. The cells were then observed under a fluorescence microscope.

2.9. Caspase 3 Activity Assay

The caspase 3 activity of KGN cells was determined using a Caspase 3 activity assay kit (Beyotime Biotechnology, China). Briefly, cells were harvested and lysed in ice‐cold lysis buffer for 15 min, followed by centrifugation at 16 000 g for 10 min at 4°C to collect the supernatant. Protein concentration was determined using the Bradford Protein Concentration Assay Kit (Beyotime Biotechnology, China). For the assay, 50 μL of cell lysate was mixed with 50 μL of reaction buffer (containing 10 μL of Ac‐DEVD‐pNA substrate [2 mM]) in a 96‐well plate. The mixture was incubated at 37°C for 2 h, and the absorbance was measured at 405 nm using a microplate reader.

2.10. Measurement of Adenosine Triphosphate (ATP) Content

Cellular ATP content was determined using an Enhanced ATP assay kit (Beyotime Biotechnology, China) by strict operation according to the manufacturer's instructions. Briefly, cells were lysed with ATP lysis buffer on ice for 10 min, followed by centrifugation at 12000 g for 5 min at 4°C to collect the supernatant. For the assay, 20 μL of cell lysate was mixed with 100 μL of ATP detection working solution in a 96‐well white opaque plate. A luminometer was used to measure the RLU values.

2.11. Real‐Time Quantitative Reverse Transcription‐Polymerase Chain Reaction (qRT‐PCR)

Total RNA was extracted from tissues and cells for reverse transcription to obtain cDNA. SYBR Green Premix (Roche) was used to configure the amplification system. The primer sequences for the target genes are shown in Table 1. The 2^−ΔΔCt method was used to analyze the Ct results.

TABLE 1.

Sequence of primers.

Gene	Sequence of forward primer	Sequence of reverse primer
Gapdh	5′‐AGGTCGGTGTGAACGGATTTG‐3′	5′‐GGGGTCGTTGATGGCAACA‐3′
Caspase3	5′‐CTGACTGGAAAGCCGAAACTC‐3′	5′‐CGACCCGTCCTTTGAATTTCT‐3′
Il6	5′‐TCTATACCACTTCACAAGTCGGA‐3′	5′‐GAATTGCCATTGCACAACTCTTT‐3′
Il1b	5′‐GCAACTGTTCCTGAACTCAACT‐3′	5′‐ATCTTTTGGGGTCCGTCAACT‐3′
Tnf	5′‐CAGGCGGTGCCTATGTCTC‐3′	5′‐CGATCACCCCGAAGTTCAGTAG‐3′
GAPDH	5′‐ATTTGGCTACAGCAACAGG‐3′	5′‐TTGAGCACAGGGTACTTTATT‐3′
IL6	5′‐ACTCACCTCTTCAGAACGAATTG‐3′	5′‐CCATCTTTGGAAGGTTCAGGTTG‐3′
IL1B	5′‐CAGAAGTACCTGAGCTCGCC‐3′	5′‐AGATTCGTAGCTGGATGCCG‐3′
TNF	5′‐GCAACTGCTGCACGAAATC‐3′	5′‐CTGCTTGTCCTCTGCCCAC‐3′
CASPASE3	5′‐CTGGACTGTGGCATTGAGAC‐3′	5′‐GCAAAGGGACTGGATGAACC‐3′
NFKB2	5′‐GGGCCGAAAGACCTATCCC‐3′	5′‐CAGCTCCGAGCATTGCTTG‐3′
SQSTM1	5′‐GCACCCCAATGTGATCTGC‐3′	5′‐CGCTACACAAGTCGTAGTCTGG‐3′
IGF1R	5′‐AGGATATTGGGCTTTACAACCTG‐3′	5′‐GAGGTAACAGAGGTCAGCATTTT‐3′
SIRT1	5′‐TGTGTCATAGGTTAGGTGGTGA‐3′	5′‐AGCCAATTCTTTTTGTGTTCGTG‐3′
GDF15	5′‐GACCCTCAGAGTTGCACTCC‐3′	5′‐GCCTGGTTAGCAGGTCCTC‐3′
SMAD7	5′‐TTCCTCCGCTGAAACAGGG‐3′	5′‐CCTCCCAGTATGCCACCAC‐3′
TGFB2	5′‐CAGCACACTCGATATGGACCA‐3′	5′‐CCTCGGGCTCAGGATAGTCT‐3′
OSGIN1	5′‐AACCCCATTGACGTGGACC‐3′	5′‐CAAACCTCACGAAGTTGTCCC‐3′

Note: The first letter of the mouse gene name is in uppercase, and the remainder is in lowercase. Reference for the writing format of mouse genes is available at http://www.informatics.jax.org/. All human gene names are capitalized. Reference for writing the format of human genes is available at http://www.genenames.org.

2.12. Western Blotting

The ovarian tissues were homogenized in protein lysates. After centrifuging the homogenate at 4°C, the supernatant was taken as the tissue protein sample. KGN cells were scraped from the cell culture plate with protein lysates, then the collected mixture was centrifuged at 4°C. The supernatant was used as the cellular protein sample. Protein concentrations of the samples were determined using a BCA protein assay kit (Beyotime Biotechnology, China). SDS‐PAGE was used to separate proteins and then different molecular weight proteins were bound to PVDF membranes. Primary antibodies against CASPASE3 (1:1000, Proteintech) were incubated with the membranes overnight at 4°C followed by an HRP‐conjugated secondary antibody for 2 h at room temperature. The blots were detected using ECL chemiluminescence.

2.13. Transcriptome Sequencing

The pretreated cell samples were sequenced by Beijing Biomarker Technologies Co. Ltd. Differentially expressed genes (DEGs) were used for the clustering of orthologous groups of proteins (COG), gene ontology (GO), and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses. The screening criteria for DEGs in this experiment were Fold Change ≥ 2 and False Discovery Rate (FDR) < 0.01.

2.14. Statistical Analysis

Data are presented as mean ± SEM. All experiments were independently repeated at least three times. Statistical differences were calculated using the Independent samples t‐test (two‐group comparison) or one‐way ANOVA with Tukey's post hoc test (multiple comparisons). Statistical significance was set at p < 0.05.

3. Results

3.1. LA Administration Led to PCOS‐Like Changes in Mice

According to the Rotterdam diagnostic criteria for humans, mice exhibit PCOS‐like changes after LA administration. Vaginal smears (Figure 1A) showed that mice in the Con group (Figure 1B) and L (Figure 1C) group had regular 4–5 day estrus cycles, comprising successive proestrus, estrus, metestrus, and diestrus. The M (Figure 1D) and H (Figure 1E) groups had disordered estrus cycles, presented as a prolonged cycle, and remained in the estrus phase (Figure 1G). Observation of HE‐stained sections of mouse ovaries revealed the presence of follicles at every developmental stage in the ovaries of the Con group, and the structure of the follicles was normal (Figure 1H–M). The ovarian parenchyma of the L group of mice was normal, and follicles were observed at different developmental stages (Figure 1H–M). The number of primary follicles in the L group was increased (Figure 1I). The ovaries of mice in the M group had large cystic follicles (Figure 1M), thinner layers of mural granulosa cells, fewer corpora lutea (Figure 1L), and more secondary follicles (Figure 1J). Ovaries from the H group showed a larger proportion of cystic follicles and decreased mural granulosa cell layers of cystic follicles (Figure 1M), with almost no corpus luteum (Figure 1L). The number of secondary follicles (Figure 1J) and antral follicles (Figure 1K) was also increased by high‐dose LA. Plasma testosterone (T) levels were significantly increased in the M and H groups, while the T level in the L group showed no significant difference compared to that in the Con group (Figure 1N).

FIGURE 1.

LA administration led to PCOS‐like changes in mice. (A) Representative vaginal smears for each stage of the mouse estrous cycle. In the proestrus (P) stage, the number of cells is relatively small, and they are mostly nucleated epithelial cells. In the estrus (E) stage, anucleated keratinized epithelial cells are fully in view. White blood cells begin to appear in metestrus (M), and white blood cells, keratinized epithelial cells, and nucleated epithelial cells are presented. In the Diestrus (D) period, almost all of the cells are white blood cells. (B–E) Estrous cycle in each mice group after LA administration. (F) Weight curve of the four animal groups. (G) Percentage of time spent on different estrous cycles in each group of mice. (H) H&E staining images of ovarian sections in each group. (I–M) Numbers of primary follicles, secondary follicles, antral follicles, corpus luteum, and cystic follicles of each group. (N–Q) Effects of different LA concentrations on serum T, E₂, P, and LH/FSH. *p < 0.05 vs. Con group. Con, control group; E₂, estradiol; FSH, follicle‐stimulating hormone; H, high‐concentration LA group; L, low‐concentration LA group; LH, luteinizing hormone; M, medium‐concentration LA group; P, progesterone; T, testosterone.

3.2. LA Administration Brought Other PCOS‐Related Changes in Mice

After continuous gavage with different concentrations of LA, the weight of mice continued to increase, but the growth rate of mice in group H was slower than that of mice in Con, L, and M groups, indicating that high‐dose LA significantly inhibited weight gain in mice (Figure 1F). Compared with the control group, the above three kinds of concentrations of LA did not increase body weight in the mice, suggesting that LA is not associated with the weight gain phenotype related to PCOS. Regarding other PCOS‐related endocrine hormones, there were no significant changes in plasma E₂ and P levels, regardless of LA concentration (Figure 1O,P). The LH/FSH ratio increased in the M and H groups, whereas the L group showed no significant changes (Figure 1Q). The GTT and ITT results showed that LA did not affect glucose or insulin tolerance in the mice (Figure 2A,B). Inflammation cytokines IL‐6, IL‐1β, and TNF‐α in plasma were significantly increased in the M and H groups, which were confirmed by mRNA levels (Figure 2C–F). The levels of oxidative stress (OS) markers in ovarian tissues also changed. The activity of the antioxidant enzyme SOD significantly decreased in all LA administration groups, but CAT showed no significant changes after LA gavage (Figure 2G). The antioxidant activities of GPx and GR were significantly lower in the ovaries of the M and H groups (Figure 2H). The GSH concentration in the mouse ovaries also decreased in the M and H groups (Figure 2I). The GSH/GSSG ratio decreased in both groups (Figure 2I). Markers of lipid peroxidation, MDA, were increased in mice in the medium‐ and high‐concentration LA groups (Figure 2G). Western blot results suggested that the protein levels of cleaved CASPASE3 isoforms, which are the executors of apoptosis, significantly increased in the M and H groups, indicating that LA increased the level of apoptosis in the ovarian tissue (Figure 2J).

FIGURE 2.

LA administration brought other PCOS‐related changes in mice. (A, B) Glucose tolerance test (GTT) and insulin tolerance test (ITT) of different LA concentration groups were of no significant differences. (C–E) Medium and high concentrations of LA caused the serum level of inflammatory cytokines IL‐6, IL‐1β, and TNF‐α to significantly increase. (F) The mRNA expression showed an increase of inflammatory cytokines in the M and H groups. (G) The activity of antioxidant enzyme SOD was decreased in all LA‐treated groups, while the activity of CAT showed no significant changes in the three groups. The marker of lipid peroxidation, MDA, demonstrated no alteration regardless of LA concentrations. (H) The activity of antioxidant enzyme GPx and GR in ovaries both declined under medium and high concentration LA administration rather than under the low‐concentration of LA. (I) The GSH concentration of ovaries was reduced by medium and high concentration LA gavage, and the ratio of GSH/GSSG presented the same alterations as GSH. (J) The protein level of cleaved CASPASE3 isoforms significantly increased in the M and H groups. *p < 0.05 vs. Con group. CAT, catalase; cleaved CASP3: Cleaved cysteine‐aspartic acid protease 3 isoform; Con, control group; GAPDH, glyceraldehyde‐3‐phosphate dehydrogenase; GPx, glutathione peroxidase; GR, glutathione reductase; GSH, reduced glutathione; H, high‐concentration LA group; L, low‐concentration LA group; M, medium‐concentration LA group; MDA, Malondialdehyde; SOD, superoxide dismutase.

3.3. LA Treatment Affected KGN Cells in Intracellular Redox Balance, Mitochondrial Function, Cell Apoptosis, and the Level of Inflammation, but Had no Impact on Endocrine Function

To further ascertain the effect of LA, we used the human ovarian granulosa cell line KGN to determine whether LA influences ovarian granulosa cells. The ELISA results suggested that LA did not affect E₂ and P secretion, which was verified by the mRNA levels of the hormone‐related genes CYP19A1, STAR, CYP11A1, and HSD3B1 (Figure 3A–C). Flow cytometry revealed a significant increase in the intracellular ROS levels in GCs stimulated with LA (Figure 3D). The levels of the antioxidant enzymes SOD, GPx, and GR significantly decreased, and the levels of intracellular GSH and the ratio of GSH/GSSG also declined (Figure 3E–G). However, the levels of MDA and CAT in KGN cells were not affected by LA treatment (Figure 3E,G). Since mitochondria are crucial sites for oxidative reactions in cells and are an important source of intracellular ROS, we further investigated mitochondrial function. The mitochondrial membrane potential (MMP) of KGN cells significantly decreased after LA stimulation (Figure 3H). Pictures of the TMRE probes provided a visual display of the loss of MMP (Figure 3I). LA significantly reduced the relative production of ATP in the mitochondria (Figure 3J). MitoSOX probes targeting mitochondrial ROS showed that LA caused a dramatic increase in mitochondrial ROS (Figure 3K). In addition, LA treatment increased the apoptosis rate of KGN cells by nearly two times (Figure 4A). Caspase3 activity significantly increased (Figure 4B). The mRNA expression of CASPASE3 and the protein levels of cleaved CASPASE3 also increased (Figure 4C,D). ELISA and qRT‐PCR data exhibited a significant increase in the secretion and transcription of inflammatory cytokines IL‐6, IL‐1β, and TNF‐α (Figure 4E–H).

FIGURE 3.

The influence of LA treatment on KGN cells in intracellular redox balance, mitochondria function, and endocrine function. (A, B) The secretion of E₂ and P by KGN cells showed no changes after LA treatment. (C) Genes related to synthesis and secretion of E₂ and P showed no significant differences at the transcription level confirming that LA had no impact on the endocrine function of GCs. (D) Intracellular ROS increased after LA stimulation. (E) Intracellular SOD activity was reduced by LA, while MDA level was not altered under LA incubation. (F) LA led to the activity/content of GPx, GR, and GSH to be significantly decreased in GCs. (G) The ratio of GSH/GSSG decreased after LA treatment, while the intracellular activity of CAT did not change. (H, I) Flow cytometry results suggested the decreased of mitochondrial membrane potential (MMP) in the LA group, and TMRE probes visualize the loss of MMP. (J) LA caused lower ATP production by the mitochondria. (K) Flow cytometry results suggested that ROS produced by the mitochondria was increased in LA group GCs. *p < 0.05 vs. Control group.

FIGURE 4.

The effects of LA treatment on KGN cells in apoptosis and inflammation. (A) Flow cytometry results showed an increased apoptotic rate in the LA group. (B) The activity of Caspase3 was increased by LA. (C) The mRNA expression of CASPASE3 also increased contributed by LA. (D) Western blot results demonstrated that the level of cleaved CASPASE3 isoforms, which is the executor of apoptosis, increased significantly after LA treatment. (E–H) The protein and mRNA levels of inflammatory cytokines IL‐6, IL‐1β, and TNF‐α in KGN cells were all enhanced by LA. *p < 0.05 vs. Control group.

3.4. Analysis of Transcriptome Sequencing on Treated KGN Cells

To further investigate the intracellular molecular mechanisms of the above phenotypes, transcriptome sequencing (RNA‐Seq) was performed on the treated KGN cells in Control and LA groups (part of the results refer to Table 2). Volcano plots indicated that there were 1688 DEGs between the groups, of which 1273 were upregulated and 395 were downregulated (Figure 5A). The hierarchical clustering heatmap showed different expression patterns between the two groups (Figure 5C). Three methods of enrichment analysis were used to analyze the RNA‐Seq data. First, according to the COG analysis, the three major functions with the highest number of DEGs in this experiment were signal transduction mechanisms, posttranslational modifications, protein turnover, chaperones, and general function prediction only (Figure 5B). The second analysis method was GO classification enrichment, in which the database divided gene functions into three parts: biological process (BP), cellular component (CC), and molecular function (MF) (Figure 5D). Further enrichment analysis of the functions that DEGs may participate in the three functional groups mentioned above indicated that the DEGs involved in the “regulation of transcription, DNA templated” were the highest proportion in BP (Figure 5E), while the DEGs involved in the “regulation of apoptotic process” had the most significant differences (Figure 5F). The DEGs related to the nucleus had both the highest proportion and the most significant differences in the CC (Figure 5G,H), and the DEGs linked to DNA binding had both the highest proportion and the most significant differences in MF (Figure 6A,B). The third method of RNA‐Seq analysis was KEGG analysis, which has the advantage of comprehensively annotating the signaling pathways involved in known genes. The KEGG classification annotation of the pathways involving the DEGs in this experiment mainly contained five aspects: cellular processes, environmental information processing, genetic information processing, human diseases, and organismal systems (Figure 6C). Apoptosis was one of the enriched pathways in the cellular processes. The estrogen signaling pathway was one of the enriched pathways in organismal systems. We focused on the top 20 enriched DEGs pathways produced by KGN cells after LA treatment. The results are shown as follows (Figure 6E,F), and the top 20 pathways were ranked according to DEGs number and significance. From the two charts, the OS‐related FoxO signaling pathway, inflammation‐related TNF signaling pathway, and NF‐kappa B signaling pathway were among the top 20 pathways and were located in the front positions. To validate the RNA‐Seq results, we selected eight DEGs and found that the experimental results were consistent with the sequencing results, indicating that the sequencing results were accurate and reliable (Figure 6D).

TABLE 2.

Example of RNA‐Seq results for DEGs.

Gene ID	Gene name	Mean FKPM (Control)	Mean FKPM (LA)	Log2FC	FDR	Regulated
ENSG00000161011	SQSTM1	173.8	715.8	2.10344064431863	0	up
ENSG00000077150	NFKB2	14.52	39.68	1.54902421952793	1.9969309221E‐90	up
ENSG00000140961	OSGIN1	11.38	65.74	2.60522837241196	0	up
ENSG00000096717	SIRT1	7.291	29.30	2.079390895584	2.36010102159079E‐207	up
ENSG00000140443	IGF1R	1.146	4.839	2.05650634529857	1.27646174960676E‐112	up
ENSG00000101665	SMAD7	8.255	20.15	1.38419591211676	1.69988733699454E‐98	up
ENSG00000130513	GDF15	4.525	202.6	5.58204364116826	2.74763308007679E‐162	up
ENSG00000092969	TGFB2	28.68	55.17	1.0454956209599	7.78530560259734E‐109	up

FIGURE 5.

RNA expression profiles in treated KGN cells, and DEGs analyzed via the COG and GO databases. (A) Volcano plots showing the upregulated (in red) and downregulated (in blue) DEGs between the two groups. (B) COG analysis of DEGs. (C) The hierarchical clustering heatmap visualizes different expression patterns between the two groups. (D) GO classification of DEGs. (E, F) The enrichment of DEGs involved in biological process (BP) of GO analysis. (G, H) The enrichment of DEGs involved in cellular component (CC) of GO analysis.

FIGURE 6.

DEGs analysis from the GO and KEGG databases, and the validation of RNA‐Seq results. (A, B) The enrichment of DEGs involved in molecular function (MF) of GO analysis. (C) The KEGG classification annotation of the pathways involved in DEGs in this experiment. (D) The validation of RNA‐Seq results by experiments. (E, F) The top 20 enriched KEGG pathways of DEGs. The order of Figure E was ranked by the number of DEGs. The order of Figure F was ranked by the significance of DEGs. *p < 0.05 vs. Control group.

4. Discussion

PCOS is one of the most common reproductive diseases in women of childbearing age worldwide. In addition to metabolic disorders, its profound effects include infertility, cardiovascular disease, and endometrial cancer. However, its etiology remains undetermined. LA is an essential n−6 polyunsaturated fatty acid for the human body; its average requirement is 2% of energy, and its sufficient intake is 2%–3% of energy [38]. Given the advantages of reducing coronary heart disease caused by LA, the American Heart Association recommends that its intake should account for 5% to 10% of energy intake in the diet of adults [39]. As the structure of modern diets has changed, the consumption of refined vegetable oils rich in n−6 fatty acids has increased significantly [40]. The above fact created the outcome that the intake of LA is much higher than that before the 20th century [18] and is also much higher than the recommended intake limit of 10% [41] and the optimal level of 1%–2% in dietary guidelines. It cannot be ignored that the growing LA intake caused a “silent inflammation” in the body, which coincides with the chronic low‐grade inflammation in PCOS patients [40, 42]. Thus, clarifying the direct influence of LA, a common dietary component with a sharp increase in intake in recent years, on PCOS is indispensable for dietary management in its prevention and treatment.

Our animal experimental results suggest that medium and high concentrations of LA led to PCOS‐like changes in mice presenting with disordered estrus cycles, polycystic ovaries, and hyperandrogenism. A case‐controlled cross‐sectional study in 2019 reported that the intake of n−6 polyunsaturated fatty acids directly and positively correlated with higher testosterone concentrations [43]. A cross‐sectional study of Iranian women found that women with PCOS who were diagnosed with “hyperandrogenism+oligomenorrhea/amenorrhea+polycystic ovary morphology (H+O+POM)” had higher average energy and fat intake than those with other phenotypes (only two of which met the criteria) [44]. This is consistent with our results; as the LA concentration increased, the PCOS phenotype became more obvious. In 2022, a case–control study of Spanish women found that the PCOS phenotype characterized by “H+O+POM” is associated with a higher intake of polyunsaturated fats and significantly correlated with higher levels of n−6 fatty acids [45]. The daily energy requirement of a normal adult female is 2000 kcal [38]. According to the dose translation formulas from China [46] and the United States [47], the medium and high LA dose used in mice were near the upper limit of the recommended LA intake. Thus, our animal experimental results have great practical significance. The results of our animal study directly demonstrated that, as the largest source of n−6 fatty acids, increased intake of LA could be a risk factor for developing the core phenotypes of PCOS. PEG 400 is a safe, water‐miscible solubilizer for oral liquids and parenterals [28]. Gavage of PEG 400 for 13 weeks did not lead to chemical side effects or death in rats [29]. The maximum concentration of PEG 400 used in our study was lower than that used in previous reports [48]. Therefore, the use of PEG 400 as the LA solvent in this study is reasonable and safe. Besides T, LA administration influenced the LH/FSH ratio but had no impact on E₂ and P levels, suggesting that LA only has a certain degree of influence on sex hormones. High‐dose LA gavage inhibited weight gain in mice, indicating that LA is not associated with the weight gain phenotype related to PCOS. This may be correlated with the development [25, 49] or inhibition [50, 51] of cancer, or an LA‐rich diet may mimic a ketogenic diet [52]. LA intake was unrelated to glucose and insulin tolerance in mice, indicating that LA was independent of the PCOS‐related insulin resistance phenotype. However, other studies have considered that LA influenced insulin resistance [53, 54]. The contradictory opinions may result from the use of different judgment criteria. These studies determined whether insulin resistance occurred by indirectly observing the relationship between insulin concentration and LA percentage. We determined whether there was a change in glucose levels after LA gavage following the direct injection of insulin. Moreover, medium and high LA concentrations significantly increased inflammation in mice. Consistently, the percentage of dietary n−6 fatty acids was significantly correlated with circulating IL‐6 levels in overweight subjects [55]. It is obvious that elevated proportion of dietary LA indeed causes systemic inflammation. In the meantime, LA reduced the levels of antioxidant markers in a concentration‐dependent manner, implying that LA can cause OS in the ovaries and that OS cannot be compensated for. The interaction among OS, low‐grade inflammation, and hyperandrogenism is involved in ovulatory dysfunction in PCOS and promotes its development [56]. Recent studies have also found that excessive dietary LA may lead to a muscle redox imbalance [57]. The apoptotic level in the ovarian tissue significantly increased after LA induction, further confirming the involvement of LA in alterations of ovarian function in PCOS.

The abnormal development of follicles in PCOS is closely related to the dysfunction of cells inside the follicles. Ovarian GCs support follicles, secrete nutrients and cellular cytokines to promote follicle and oocyte maturation, and secrete hormones to regulate follicular development. Patients with PCOS have abnormal GCs proliferation [58], abnormal steroid hormone synthesis, and lipid metabolism [59], which may inhibit follicular development and impair ovulation. To further explore the role of LA in the occurrence and development of PCOS, we used an ovarian granulosa cell line (KGN) to investigate the effects of LA on GCs in the microenvironment. Based on the experimental results of the dose‐dependent effects of LA on KGN cells published by our team [30], an optimal concentration of 75 μM was selected for the subsequent experiment. Endocrine function experiments showed that the secretion levels of E₂ and P in the LA group were not different from those in the control group. Additionally, the expression of the E₂ synthesis‐related gene, CYP19A1, did not exhibit significant changes at the mRNA level. Similarly, the transcription levels of three genes related to P synthesis and secretion, STAR, CYP11A1, and HSD3B1, also remain unchanged. This demonstrates that LA had no effect on the secretion of E₂ and P in KGN cells, which is consistent with the results of E₂ and P in the above animal experiments. In women with PCOS, an increase in ROS and a decrease in total antioxidant capacity and superoxide dismutase in follicular fluid are closely related to decreased oocyte maturation and fertilization rates, poor embryo quality, and decreased pregnancy rates [60]. Changes in intracellular ROS and antioxidant enzyme systems were detected to reflect the OS levels of GCs. LA significantly increased intracellular ROS and the activity/contents of four antioxidant substances, SOD, GPx, GR, and GSH decreased. The CAT and MDA levels did not change. When the balance between ROS production and the regulation of the antioxidant system is disrupted, an OS state occurs. OS can disrupt some signaling pathways in GCs that control cell proliferation, autophagy, and apoptosis, such as PI3K‐AKT, FOXO1, p53/SIRT1, NF‐κB, AMPK/Nrf2 pathways, etc. [61]. Mitochondria are sites of intracellular oxidation–reduction and ROS are important byproducts of this process. Therefore, mitochondrial function was observed during LA‐induced OS in GCs. MMP decreased, ATP synthesis was inhibited, and mitochondrial ROS levels increased, indicating that mitochondria play an important role in the intracellular OS of GCs. A decline in mitochondrial function may lead to decreased steroidogenic ability, fertilization rate, oocyte maturation rate, and oocyte quality, ultimately endangering fertility [62]. GCs apoptosis is a key factor in follicular atresia and determines follicular fate [63, 64]. PCOS is closely associated with increased apoptosis in ovarian GCs. Further exploration of the effect of LA on the apoptosis of GCs revealed that LA increased the apoptosis rate of GCs, which may be an important reason for the involvement of LA in the pathogenesis of PCOS. A low degree of chronic inflammation is an important manifestation of PCOS in women. ELISA and qRT‐PCR were used to detect the secretion of inflammatory cytokines in GCs treated with LA, and it was found that LA significantly exacerbated the expression and secretion of pro‐inflammatory cytokines. It is reasonable to believe that LA in follicles can promote the secretion of inflammatory cytokines by GCs to act on the surrounding cells, damage the follicular microenvironment, and lay the foundation for ovarian dysfunction in PCOS.

To provide guidance for further research, RNA‐Seq was used to comprehensively evaluate the key genes and pathways involved in the role of LA in cellular functional changes. COG classification revealed that the highest number of DEGs were related to signal transduction mechanisms within cells, reflecting the alteration in intracellular physiological functions biased towards signaling networks after LA treatment. GO analysis revealed that the DEGs mainly existed in “biological regulation,” “responses to stimulus,” “signaling,” “binding,” “nucleic acid binding transcription factor activity,” and other functions. In the BP classification, the proportion of DEGs involved in the “regulation of transcription, DNA templated” was the highest, whereas the DEGs involved in the “regulation of apoptotic process” showed the most significant differences. DEGs related to the nucleus were the highest number and had the most significant differences in CC, whereas DEGs related to DNA binding had the same characteristics in MF classification. These results suggested that apoptosis is the most worthwhile phenotype for studying the impact of LA on GCs, and attention should be paid to genes or pathways related to the nucleus, DNA binding, and transcription. KEGG analysis can provide more specific pathway changes. It was discovered that the FoxO pathway related to OS and apoptosis, the NF‐κB pathway and the TNF pathway related to inflammation, and the estrogen pathway related to regulation are all enriched in the top 20 pathways, indicating that they are the most important signal transduction pathways involved by DEGs. OS is one of the most important causes of the dysfunction and apoptosis of GCs [61]. The FoxO pathway is involved in the regulation of many cellular physiological events, such as the cell cycle, apoptosis, autophagy, OS, and energy metabolism. Besides in patients with PCOS [65], the FoxO pathway was also found to be upregulated due to oxidative damage in deoxynivalenol‐induced apoptosis of human GCs [66], type 2 diabetic rats [67], and smoke inhalation injury [68]. Recently, nonesterified fatty acids (NEFA) were reported to induce bovine GCs apoptosis via the ROS‐activated PI3K/AKT/FoxO1 pathway [69]. Furthermore, clinical research has shown that the concentrations of IL‐6, IL‐8, and mature IL‐18 in the follicular fluid are positively related to the levels of fatty acids [70], confirming that fatty acids in the microenvironment contribute to inflammation in the surrounding cells and tissues, as shown in our previous experiments. Inflammation caused by a high LA intake has also been observed in fish [71]. Hyperandrogenism can activate NF‐κB signaling resulting in aberrant regulation of inflammation‐related gene expression [72], and increase TNF‐α release from mononuclear cells (MNCs) of lean healthy reproductive‐age women in a receptor‐dependent fashion. LA participates in the induction of cardiac hypertrophy by activating NF‐κB [73]. Signaling crosstalk between OS and NF‐κB activation has been found in the mechanism of dietary fatty acids on diseases [74]. Given the intricate relationship between OS, apoptosis, and inflammation in PCOS, the specific mechanism of action of LA in GCs requires further exploration.

5. Conclusion

In conclusion, our study demonstrated that a sharp increase in LA intake is a risk factor for PCOS by influencing ovarian GCs. The LA intake in the diet should be reduced, especially in women with PCOS who are preparing for pregnancy. Apart from discovering the detailed mechanism of LA function on GCs, further research should conduct clinical research to set a threshold and reasonable range of LA intake for dietary management strategies in patients with PCOS.

Author Contributions

Fuju Wu: conceptualization, data curation, funding acquisition, project administration, validation, supervision, writing – review and editing. Wenying Zhang: formal analysis, investigation, methodology, resources, software, validation, visualization, writing – original draft.

Conflicts of Interest

The authors declare no conflicts of interest.

Data Availability Statement

All data generated or analyzed during this study are included in this published article.