Protocol for ecotropic pseudotyped lentiviral transduction of “murinized” human cells while decreasing risk of infection for laboratory personnel

Summary

Lentiviral systems of transduction are valuable tools to stably express transgenes of interest in human cell lines. However, their use risks infection of the lab workers. Here, we present a protocol for lentiviral vector system pseudotyping with the murine ecotropic envelope. We detail steps for producing ecotropic pseudotyped lentiviral particles and transiently expressing the Slc7a1 receptor for murine leukemia virus in target human cells. We then describe procedures for puromycin selection and the characterization of stable cell lines for transgene expression.

For complete details on the use and execution of this protocol, please refer to Iyer-Bierhoff et al.¹

Graphical abstract

Highlights

• •Steps for the production of ecotropic pseudotyped lentiviral particles
• •Instructions for “murinizing” human target cells with the membrane receptor Slc7a1
• •Guide to lentiviral transduction of “murinized” target cells
• •Steps for puromycin selection and characterization of stable transductants

Publisher’s note: Undertaking any experimental protocol requires adherence to local institutional guidelines for laboratory safety and ethics.

Lentiviral systems of transduction are valuable tools to stably express transgenes of interest in human cell lines. However, their use risks infection of the lab workers. Here, we present a protocol for lentiviral vector system pseudotyping with the murine ecotropic envelope. We detail steps for producing ecotropic pseudotyped lentiviral particles and transiently expressing the Slc7a1 receptor for murine leukemia virus in target human cells. We then describe procedures for puromycin selection and the characterization of stable cell lines for transgene expression.

Before you begin

In the associated research paper, the human hepatic cells HepG2 were engineered by CRISPR-Cas9 to knockout the endogenous glucocorticoid receptor (GR; Gene name: NR3C1). These HepG2 GR^−/− cells were used as the target cell line for ecotropic pseudotyped lentiviral transduction to stably express an epitope-tagged version of wild-type and mutant GR via the pCW57-MCS1-2A-MCS2 lentiviral vector.¹ This protocol can be adapted to use in any cell line that is amenable to transient transfection, and to express any transgene, small hairpin (sh)RNAs etc. in any other lenti- or retroviral vector backbone.

In brief, HEK293T packaging cells are transfected with the ecotropic envelope plasmid (pHCMV-EcoEnv), along with the third-generation lentiviral packaging plasmids expressing Gag and Pol (pMDLG/pRRE) and Rev (pRSV-Rev). Concomitantly, the target cells (here HepG2 GR^−/−) are transfected with a construct expressing the murine ecotropic retroviral receptor, Slc7a1 or Cat-1 (pLenti6/UbC/mSlc7a1). Slc7a1 has been reported to interact with murine virus envelope protein, rendering human cells susceptible to ecotropic virus infection.^2,3 Subsequently, HEK293T supernatants containing the ecotropic, pseudotyped lentiviral particles are passed through a virus-permeable filter onto the ‘murinized’ target HepG2 GR^−/− cells transiently expressing Slc7a1. After 24 h, the lentiviral supernatant is replaced with fresh growth medium containing optimal concentration of the antibiotic used as selection marker (here puromycin). Selection and expansion of stably transduced cells is carried out over 2–4 weeks. Successful integration and expression of the transgene can then be monitored by RT-qPCR and western blotting.

For a successful reproduction of this protocol, first, optimize the transient transfection efficiency in the packaging cell line (HEK293T) and the target human cell line of interest (here HepG2 GR^−/−). To determine optimal antibiotic concentration for efficient selection of cells expressing the transgene, the sensitivity of the target human cells to the antibiotic of interest must be tested by performing a kill curve. Lastly, we have described the method details for the transfection of HEK293T with viral components and the transfection of HepG2 GR^−/− cells with murine viral receptor Slc7a1, followed by transduction and selection.

Institutional permissions

All experiments involving the use of genetically modified organisms conform to the relevant regulatory standards of the Friedrich Schiller University Jena under the German Gene Technology Act (GenTG) and Gene Technology Safety Regulation (GenTSV) and were performed at biosafety level 1 (S1). As the definition and classification of risk groups and the corresponding biosafety levels may differ based on the country of experimentation, please refer to local/national guidelines for your laboratories.

Vector quality control

Timing: 1 week

• 1.Before starting the protocol, ensure that your plasmid DNA is of high quality by measuring concentration and purity using a nanodrop spectrophotometer.

Note: The 260/280 and 260/230 ratios should be greater than 1.8 and 2.0, respectively. High quality DNA preparations are a prerequisite for optimal transfection efficiency.

• 2.Verify your plasmid by performing restriction digestion and agarose gel electrophoresis according to standard laboratory protocols.
• 3.Verify the orientation and accuracy of insert integration via Sanger sequencing.

Optimization of a calcium phosphate-based transfection protocol for HEK293T packaging cells

Timing: 1 week

Alternatives: As HEK293T cells are very amenable to transfections, any other transfection method can be used, if already established in the lab of the reader (e.g., lipofectamine2000 or lipofectamine3000, electroporation,^4,5 CaCl₂/HEPES-buffered saline (HBS)⁶ or polyethylenimine (PEI)-based transfections⁷).

• 4.Prepare fresh 0.25 M Na₂HPO₄(·2 H₂O) buffer.
• 5.Prepare three 2x BES-buffered saline solutions (2x BBS) (100 mL each) with different pH values in the range of 6.93–7.05 (e.g., pH 6.95, 6.98, 7.01) (see materials and equipment).
• 6.Filter-sterilize 2x BBS buffers into freshly autoclaved bottles using a 0.22 μm cellulose mixed ester (CME) filter inside a sterile laminar airflow unit suitable for cell culture work.

CRITICAL: Optimal pH of BBS solution needs to be determined experimentally by testing transfection efficiency of GFP in HEK293T cells (described below under (8)). We test optimal pH with each new batch of 2x BBS buffers to account for day-to-day variability that may arise in pH meter measurements. It is advisable to use a previously optimized 2x BBS buffer preparation as reference measure when determining pH of the fresh solutions, and as an extra condition when testing for transfection efficiency.⁶

• 7.
  Prepare 2.5 mM CaCl₂ solution.

  • a.
    Weigh out 13.87 g CaCl₂ and dissolve in 50 mL ddH₂O.
  • b.
    Filter-sterilize using a 0.22 μm CME filter inside a sterile laminar airflow unit suitable for aseptic cell culture work.
• 8.
  Determine optimal pH of BBS solution and incubation time for precipitate formation by performing test transfections with GFP expression plasmid (e.g., pEGFP-C1) in HEK293T cells as follows.

  • a.
    Day 0: Seed 0.28 x 10⁶ HEK293T cells in 2 mL DMEM (high glucose) supplemented with 10% fetal calf serum (FCS) and 100 U/mL penicillin and 100 μg/mL streptomycin (1% P/S) in each well of a 6-well dish one day prior to transfections to allow cell attachment to occur for approx. 16 h.

    CRITICAL: To achieve highest transfection efficiency in HEK293T cells, use cells that were revived not longer than 1 week prior to transfections and freshly seed cells one day before transfection to achieve 60% confluency on the day of transfection.

  • b.
    Day 1: Next day, prepare transfection mixes as follows. The volume of the transfection mix is 10% that of the culture medium.

    • i.
      Combine plasmid DNA and CaCl₂ in sterile ddH₂O as indicated in Table 1.
    • ii.
      Add equal volume of 2x BBS dropwise to the DNA- CaCl₂ solution while vortexing as indicated in Table 1.
    • iii.
      Incubate for 10–20 min (to be determined empirically for the different pH BBS solutions) at 20°C–25°C to allow precipitate formation.
  • c.
    Add transfection mix dropwise to the cells in culture medium and incubate for at least 8 h up to 16 h in a humidified 37°C, 5% CO₂ incubator.

    Note: HEK293T cells attach only loosely to culture dishes. Therefore, it is necessary to prevent any dissociation while adding the transfection mixes to the HEK293T cells. Prolonged incubation times in precipitate-containing medium can cause cell death.

  • d.
    Discard medium/precipitates and replenish with fresh culture medium. Include an additional well per condition where the transfected HEK293T cells are replenished with the culture medium used for the target cell line (e.g., we used RPMI-1640/10% FCS/1% P/S in case of HepG2 GR^−/− cells).

    Note: This allows to determine whether HEK293T cells tolerate and grow under alternative medium conditions because the supernatant containing the viral particles will be directly transferred to the target cells of interest.

  • e.
    Day 2/3: Monitor GFP expression by fluorescence microscopy after 24–48 h of transfection to determine optimal pH of 2x BBS and the incubation time for precipitate formation.

    Note: Transfection efficiency of a minimum of 70% should be achieved (Figure 1).

Table 1.

Transfection mix for transient transfection of HEK293T cells with GFP

Reagent	Final amount/volume/concentration in 200 μL
pEGFP-C1	0.4 μg
pBlueScript (pBS) (Filler DNA)	3.6 μg (such that total DNA = 4 μg)
2.5 M CaCl2	125 mM CaCl2
ddH2O	fill up to 100 μL
2x BBS (pH 6.95 or 6.98 or 7.01)	100 μL

Note: Any filler plasmid DNA with a small size (< 5 kb) and weak promoter (or in this case only expressed in bacteria), can be used instead of pBS.

Amounts for one well of a 6-well dish.

Figure 1.

Calcium-phosphate transfections of HEK293T cells with pEGFP-C1 using BBS solutions of different pH values

Precipitate formation was allowed for 20 min. Images were acquired 48 h post-transfection. Scale bar: 100 μm.

Optimization of transfection efficiency in the target cell line HepG2 GR^−/−

Timing: 1 week

Optimization of the transient transfection protocol of the target cell line (here HepG2 GR^−/−) is crucial to ensure transduction with pseudotyped lentiviral particles. Transfect HepG2 GR^−/− cells with a GFP-encoding plasmid (e.g., pEGFP-C1) using lipofectamine3000 (Lipo3000) according to the manufacturer’s instructions. Determine optimal DNA to transfection reagent ratios to maximize transfection efficiency as estimated by percentage of GFP⁺ cells using fluorescence microscopy. Here we describe the transfection conditions optimized for HepG2 GR^−/− cells in our lab.

Alternatives: In case your cell line of choice is not amenable to transient transfection with Lipo3000, you may test alternative methods for gene delivery, e.g., lipofectamine2000, electroporation,^4,5 CaCl₂/HBS,⁶ or PEI-based transfections.⁷

• 9.Day 0: Seed 0.27 x 10⁶ HepG2 GR^−/− in 2 mL of RPMI-1640/10% FCS/1% P/S in each well of a 6-well culture dish and allow attachment to occur for approx. 16 h.

Note: Cells should be seeded such that they reach 80–90% confluency only after 3 days (72 h post-seeding which is 48 h post-transfection).

• 10.
  Day 1: Prepare transfection mixes according to Table 2.

  • a.
    Prepare mix A by adding Lipo3000 to Opti-MEM. Vortex and incubate for 5 min at 20°C–25°C.
  • b.
    Prepare mix B by combining Opti-MEM, DNA (2.5 μg total DNA per well of a 6-well dish) and p3000 reagent.
  • c.
    Combine mixes A and B, vortex and incubate for 20 min at 20°C–25°C.
  • d.
    Replace culture medium with 1.7 mL serum-free RPMI-1640/1% P/S.
• 11.Add transfection mix dropwise and swirl.
• 12.Incubate overnight (about 16 h) in a humidified cell culture incubator at 37°C, 5% CO₂.
• 13.Day 2: Change medium to 2 mL RPMI-1640/10% FCS/1% P/S.
• 14.Monitor transfection efficiency via fluorescence microscopy for GFP⁺ cells 48 h post-transfection.

Note: Transfection efficiency of a minimum of 70% should be achieved.

Table 2.

Transfection mix for transient transfection of HepG2 GR^−/− cells with GFP

Mix	Reagent	Amount/Volume
A	Opti-MEM	125 μL
	Lipo3000	3.8 μL
B2	Opti-MEM	125 μL
	p3000	5 μL
	pEGFP-C1	0.8 μg
	pBS (filler DNA) (Total DNA = 2.5 μg)	1.7 μg

Amounts for one well of a 6-well dish.

Puromycin kill curve for the target cell line HepG2 GR^−/−

Timing: 1 week

Owing to the presence of the puromycin resistance gene in the pCW57-MCS1-2A-MCS2 lentiviral vector, we subjected our transduced cells to selection with puromycin. Antibiotic selection kills all non-transduced cells while the stably transduced cells remain viable. The optimal concentration is the lowest concentration at which all non-transduced cells have been killed after 48 h. Most mammalian cells are sensitive to puromycin in the range of 1–10 μg/mL. The optimal puromycin concentration must be determined empirically for each target cell line.

• 15.Day 0: Seed 0.8 x 10⁶ HepG2 GR^−/− cells in RPMI-1640/10% FCS/1% P/S in 6-well dishes and allow cell attachment to take place for approx. 16 h.

Note: Cells should be seeded such that they reach 60–70% confluency the next day, when puromycin treatment is initiated.

• 16.Day 1: Replace culture medium with selection medium containing 0, 0.5, 2.0, 5.0, 7.5 and 10.0 μg/mL puromycin.
• 17.Day 2: Using bright-field microscopy, determine the percentage of rounded, floating cells indicating cell death.
• 18.Day 3 onwards: Replenish puromycin by changing medium every 48 h.
• 19.Culture the cells for one week and check for cell death every 24 h using bright-field microscopy.
• 20.Choose the lowest concentration at which all non-transduced cells died after 48 h of selection after transduction (Figure 2).

CRITICAL: The puromycin kill curve needs to be repeated for each new batch/lot of puromycin.

Figure 2.

Puromycin kill curve in HepG2 GR^−/− cells

HepG2 GR^−/− cells were treated with the indicated doses of puromycin. Brightfield images were acquired 48 h post-treatment. Scale bar: 100 μm.

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
GR (D6H2L) XP Dilution: 1:2,000	Cell Signaling Technology	Cat#12041; RRID:AB_2631286
Beta-Actin Dilution: 1:5,000	Sigma-Aldrich	Cat#A2066; RRID:AB_476693
Goat anti-rabbit-HRP conjugate Dilution: 1:5,000	Jackson ImmunoResearch Labs	Cat#111-035-144; RRID:AB_2307391
Chemicals, peptides, and recombinant proteins
N,N-bis[2-hydroxyethyl]-2-aminoethanesulfonic acid (BES)	Millipore	Cat#391334
Calcium chloride	Roth	Cat#CN93.1
Dimethyl sulfoxide	Roth	Cat#A994.2
DMEM - high glucose	Sigma-Aldrich	Cat#D0819
Doxycycline	Clontech	Cat#631311
di-Sodium hydrogen phosphate dihydrate	Roth	Cat#4984.3
Fetal calf serum	Capricorn Scientific	Cat#FBS-11A (LOT: CP20-3636)
Hexadimethrine bromide	Sigma-Aldrich	Cat#H9268
Penicillin-Streptomycin	Sigma-Aldrich	Cat#P4333
Phosphate-buffered saline, 1x	Sigma-Aldrich	Cat#D5773
Puromycin	Sigma-Aldrich	Cat#P8833
RPMI-1640 medium	Sigma-Aldrich	Cat#R8758
Sodium chloride	Roth	Cat#9265.3
Sodium hydroxide solution, 1 M	Roth	Cat#K021.1
Trypsin-EDTA solution	Sigma-Aldrich	Cat#T3924
Critical commercial assays
Lipofectamine3000	Invitrogen	Cat# L3000015
Experimental models: Cell lines
HepG2	DSMZ	Cat#ACC 180
HepG2 GR−/−	Iyer-Bierhoff et al.1
HEK293T	Gift from I. Grummt, German Cancer Research Center (originally from DSMZ-German Collection of Microorganisms and Cell Cultures)	Cat#ACC 635
NIH/3T3	Gift from H. Bierhoff, Friedrich Schiller University, Jena
Recombinant DNA
pBlueScript	Gift from I. Grummt, German Cancer Research Center (originally from Stratagene)
pCW57-MCS1-2A-MCS2-Ty1-WT-GR	Iyer-Bierhoff et al.1
pLenti6/UbC/mSlc7a1 (mCAT)	Addgene	Cat#17224
pEGFP-C1	Gift from I. Grummt (German Cancer Research Center)
pHCMV-EcoEnv	Addgene	Cat#15802
pMDLg/pRRE	Addgene	Cat#12251
pRSV-Rev	Addgene	Cat#12253
Other
Syringe filters ROTILABO MCE, 0.45 μm	Roth	Cat#KH55.1
Syringe filters ROTILABO MCE, 0.22 μm	Roth (#KH54.1)	Cat#KH54.1
pH Electrode InLab Expert Pt1000	Mettler Toledo	Cat#51343105
pH meter HI9017 microprocessor	Hanna Instruments	discontinued

Materials and equipment

0.25 M Na₂HPO₄(·2 H₂O) buffer

Reagent	Final concentration	Amount
Na2HPO4(·2 H2O)	0.25 M	0.089 g
ddH2O	N/A	2 mL

2x BES-buffered saline (2x BBS)

Reagent	Final concentration	Amount
0.25 M Na2HPO4(·2 H2O)	0.0015 M	0.6 mL
N,N-bis[2-hydroxyethyl]-2-aminoethanesulfonic acid (BES)	0.05 M	1.1 g
NaCl	0.28 M	1.64 g
ddH2O	N/A	Fill up to 80 mL
Adjust pH with NaOH to e.g., pH 6.95, 6.98, 7.01
ddH2O	N/A	Fill up to 100 mL

Store buffers up to 6 months at 4°C.

10 mg/mL puromycin stock

Reagent	Final concentration	Amount
Puromycin	10 mg/mL	10 mg
ddH2O	N/A	1 mL

Aliquot into single-use aliquots and store up to 1 year at −20°C.

10 mg/mL hexadimethrine bromide stock

Reagent	Final concentration	Amount
Hexadimethrine bromide	10 mg/mL	10 mg
ddH2O	N/A	1 mL

Aliquot into single-use aliquots and store up to 1 year at −20°C.

Step-by-step method details

It is critical that transfection of HEK293T cells for lentiviral particle production and the transfection of HepG2 GR^−/− with Slc7a1 expression vector, are performed in parallel in order to carry out the transfer of the supernatant (transductions) accordingly. Start the two steps in parallel and heed the indication of “days” for the individual steps.

Production of ecotropic pseudotyped lentiviral particles by transient transfection of HEK293T cells

Timing: 3 days

HEK293T cells are used to produce the ecotropic pseudotyped lentiviral particles harboring the lentiviral plasmid with the transgene insert.

• 1.
  Day 0: Seed 1.8 x 10⁶ HEK293T cells in 10 cm dishes one day prior to transfections to allow attachment to occur for approx. 16 h.

  • a.
    Seed one dish for GFP control (see Table 3).
  • b.
    Seed in duplicate for each condition so as to procure viral supernatant for target cells (HepG2 GR^−/−) as well as the NIH/3T3 murine cell control.
• 2.
  Day 1: Prepare transfection mixes (for volumes/pipetting scheme see Table 3).

  • a.
    Combine plasmid DNA and CaCl₂ in H₂O.
  • b.
    Add equal volume of 2x BBS dropwise to the DNA-CaCl₂ solution while vortexing.
  • c.
    Incubate for 10–20 min (optimized incubation time for your BBS solution) at 20°C–25°C to allow precipitate formation.
• 3.Add transfection mix dropwise to the cells in 10 mL medium while swirling and incubate the dishes in a 37°C, 5% CO₂ cell culture incubator for 8 h.
• 4.Change medium to 5 mL RPMI-1640/10% FCS/1% P/S (culture medium of HepG2 GR^−/− cell line to be transduced with viral particles) for one dish and to 5 mL DMEM/10% FCS/1% P/S for the NIH/3T3 cells, respectively.

Note: We use half the culture volume (here 5 mL instead of 10 mL in a 10 cm dish) in order to increase viral particle concentration in the supernatant.

• 5.Day 3: Harvest lentiviral particles 48 h after transduction by collecting the medium supernatant.
• 6.Sterile filter through a virus-permeable 0.45 μm CME membrane filter using a sterile 5 mL syringe.
• 7.Add sterile-filtered lentiviral particle-containing medium directly to the HepG2 GR^−/− cells expressing Slc7a1 as indicated in step 17 of the step-by-step protocol or to NIH/3T3, respectively.

Note: In our experience, 48 h are sufficient for HEK293T cells to produce an acceptable viral titer. See ‘problem 5’ in troubleshooting part for references on viral titer and viability measurement.

CRITICAL: We recommend using fresh viral supernatants as freeze-thawing can lower virus quality (see problem 5). Proceed directly to step 17.

Table 3.

Transfection mix for transient transfection of HEK293T cells to produce ecotropic pseudotyped lentiviral particles or with GFP

Reagent	pCW57-Ty1-GR	GFP
	Final amount/volume/concentration in 1 mL	Final amount/volume/concentration in 1 mL
pRSV-Rev	2.5 μg	2.5 μg
pHCMV-EcoEnv	2.5 μg	2.5 μg
pMDLg/pRRE	5 μg	5 μg
Plasmid DNA	10 μg pCW57-Ty1-GR	10 μg pEGFP-C1
2.5 M CaCl2	125 mM CaCl2	125 mM CaCl2
ddH2O	fill up to 500 μL	fill up to 500 μL
2x BBS (optimal pH)	500 μL	500 μL

Amounts for one 10 cm dish.

Transient transfection of HepG2 GR^−/− cells with Slc7a1 expression vector

Timing: 3 days

HepG2 GR^−/− cells are transiently transfected with a construct expressing the membrane-bound murine Slc7a1 (Cat-1) receptor to allow transduction by ecotropic lentiviral particles. HepG2 GR^−/− cells transiently transfected with pEGFP-C1 serve as negative control for transduction, as they should not be susceptible to infection by the ecotropic pseudotyped lentivirus.

• 8.Day 0: Seed 0.6 x 10⁶ HepG2 GR^−/− in 6 cm dishes and allow cells to attach for approx. 16 h.

Note: Seed an extra dish to control for GFP transfection efficiency (see Table 4). Cells should be seeded such that they reach 80–90% confluency only after 3 days (72 h post-seeding which is 48 h post-transfection).

• 9.
  Day 1: Prepare transfection mix according to Table 4.

  • a.
    Prepare mix A by adding Lipo3000 to Opti-MEM. Vortex and incubate for 5 min at RT.
  • b.
    Prepare mix B1 and B2 by combining Opti-MEM, corresponding plasmid DNA and p3000 reagent.
  • c.
    Combine mix A and B, vortex and incubate for 20 min at 20°C–25°C.
• 10.Replace culture medium with 3.5 mL serum-free RPMI-1640/1% P/S.
• 11.Add transfection mix dropwise onto the cells and swirl.
• 12.Incubate for approx. 16 h at 37$°C$, 5% CO_2.
• 13.Day 2: Change medium to 4 mL RPMI-1640/10% FCS/1% P/S.
• 14.Day 3: Monitor transfection efficiency via fluorescence microscopy for GFP-transfected cells in the GFP control sample (at least 70% GFP⁺ cells), before continuing with transductions (see step 15).

Table 4.

Transfection mix for transient transfection of HepG2 GR^−/− cells with Slc7a1 receptor or GFP

Mix	Reagent	Amount/Volume
Aa	Opti-MEM	250 μL
	Lipo3000	7.5 μL
B1	Opti-MEM	250 μL
	p3000	10 μL
	pLenti6/UbC/mSlc7a1 (Cat-1)	5 μg
B2	Opti-MEM	250 μL
	p3000	10 μL
	pEGFP-C1	1.6 μg
	pBS (filler DNA)	3.4 μg

Amounts for one 6 cm dish.

^aPrepare in duplicate so as to generate A + B1 and A + B2 mixes.

Transduction of HepG2 GR^−/− cells with lentiviral particles generated by HEK293T cells

Timing: 1 day

HepG2 GR^−/− cells are transduced with lentiviral particles produced in the previous step to generate stable cell lines. HepG2 GR^−/− cells transiently transfected with pEGFP-C1 serve as negative control because they should be refractory to infection by the ecotropic pseudotyped lentiviral particles. Murine NIH/3T3 cells that inherently express Slc7a1 are used as a positive control for transduction.

Alternatives: Any other adherent, murine cell line that is available in the lab can be used for this purpose.

• 15.Day 2: Seed 0.3 x 10⁶ murine NIH/3T3 cells in a 6 cm dish in DMEM/10% FCS/1% P/S.
• 16.Day 3: Discard culture medium from HepG2 GR^−/− cells (transiently expressing Slc7a1 from step 14) and NIH/3T3 cells.
• 17.Supplement virus-containing supernatant from step 6 with 10 μg/mL hexadimethrine bromide/ddH₂O and add 3 mL directly onto the cells from step 14.

CRITICAL: Use fresh hexadimethrine bromide solution. A stock of 10 mg/mL can be prepared and frozen down at −20°C in single-use aliquots. Do not freeze-thaw aliquots!

Note: Although the recommended volume of culture medium for a 6 cm dish is 4–5 mL, use lower volume (here 3 mL) of the filtered lentiviral supernatant to aid virus-target cell contact.

• 18.Incubate for 8 h in a humidified cell culture incubator at 37°C, 5% CO₂.
• 19.Change medium to RPMI-1640/10% FCS/1% P/S for HepG2 and DMEM/10% FCS/1% P/S for NIH/3T3.
• 20.Allow cells to recover for approx. 16 h in the cell culture incubator.

Puromycin selection of HepG2 GR^−/− transductants

Timing: 4 weeks

Cells with stably integrated insert are selected using puromycin to generate a polyclonal pool of epitope tagged (Ty1-) GR-expressing HepG2 GR^−/− cells.¹

• 21.Start antibiotic selection of insert-harboring cells by adding puromycin at the optimal concentration as predetermined via kill curve (in our case 2 and 7 μg/mL for HepG2 and NIH/3T3, respectively) to the medium of transduced HepG2 GR^−/− cells and NIH/3T3 cells, respectively.
• 22.Replenish with fresh puromycin-containing selection medium every two days.
• 23.Monitor progression of selection and cell death every 24 h via bright-field microscopy.

Note: Rounded, bright dead cells will appear to float in the medium. After 48 h, HepG2 GR^−/− transfected with pEGFP-C1 should all be dead (negative control), while NIH/3T3 cells show a high percentage of survivors (positive control). The percentage of HepG2 GR^−/− transductants that are alive at this stage of selection falls somewhere between the negative and the positive controls. We observe approx. 50% survivors, although this may vary depending on the vector.

• 24.Expand transductants in medium supplemented with optimal puromycin for up to four weeks.

Note: Once cells start expanding, singularize and re-seed in larger dishes for the purposes of characterization and cryopreservation. The time of selection and expansion depends on the number of stable transductants, and the doubling time of the target cell line.

• 25.Cryopreserve in RPMI-1640/30% FCS/10% DMSO freezing medium for long-term storage.

Characterization of newly generated cell lines by western blotting

Timing: 1–2 weeks

The newly generated polyclonal cell lines are tested for doxycycline-inducible transgene expression by western blotting. If the construct is not dox-inducible, a standard western blotting protocol adapted to the aims of the respective experiment should be performed.

• 26.Seed 0.6 x 10⁶ cells of each of the stable cell line in 6 cm dishes. Allow cells to attach for approx. 16 h.
• 27.To test the doxycycline (Dox)- inducible expression of Ty1-GR (WT, K154R and K154Q mutants) in HepG2 GR^−/− cells, cells were left uninduced or treated with 0.5 μg/mL Dox for 24 h.

Note: Wild-type HepG2 expressing endogenous GR (GR^+/+) was used as a control (Figure 3).

Note: Doxycycline concentrations and durations of treatment need to be empirically determined for transgene of interest.

• 28.Harvest cells in cold 1x PBS.
• 29.Prepare lysates, run SDS-PAGE and perform western blotting according to standard laboratory protocols.

Note: Ty1-tagged GR is strongly induced upon Dox treatment in the transductants and migrates slower than the endogenous GR owing to the epitope tag (Figure 3), indicating a successful generation of stable cell lines inducibly expressing the transgene of interest. One may also monitor RNA expression by RT-qPCR. We also monitored the functionality of the NR3C1 (GR) transgene product by performing cellular fractionations, and luciferase assays for GR-dependent gene transactivation in the stable cell lines.¹

Figure 3.

Western blot detection of GR levels in HepG2 wild-type (GR^+/+) cells, and in HepG2 GR knockout (GR^−/−) cells transduced with Ty1-GR in the wild-type (WT) and mutant forms (KR and KQ) respectively

The stable cell lines were either left uninduced or subjected to 0.5 μg/mL doxycycline (Dox) for 24 h. Beta actin (ACTB) serves as loading control.

Expected outcomes

The protocol outlined above demonstrates how to generate stable HepG2 cell lines expressing an epitope-tagged version of the glucocorticoid receptor in its wild-type and mutant forms using ecotropic pseudotyped lentiviral transductions. In our experience, HepG2 cells cannot be subjected to clonal expansion from single cells, therefore instead of multiple clones, several stable cell pools should be generated by independent transductions to ensure phenotypic consistency. This protocol can be adapted to use in any easy-to-transfect cell type to express any transgene in any lentiviral or retroviral vector.

Limitations

The success of the protocol depends on the efficiency of transient transfections of the target cell line. Any of the transient transfection methods mentioned in the ‘before you begin’ section can be used to achieve this for target cells of interest. Since only Slc7a1-expressing cells can be transduced by the pseudotyped viral particles, transfection efficiency should be greater than 70%. This process is generally less efficient than regular transductions using an amphotropic or pan-tropic lentiviral preparation, that poses a higher risk to the lab personnel and may require a higher biosafety level.

Since we do not calculate the multiplicity of infection, multiple integrations are possible increasing the transgene dose. On the other hand, integration in heterochromatic regions can result in cell pools with low transgene expression. Therefore, it is critical to generate multiple pools of stable cell lines from independent transductions and adjust the dose and time of doxycycline treatment (in case of using an inducible expression vector) to obtain biologically meaningful representation of the transgenic phenotype.

Troubleshooting

Problem 1

Transfection efficiency in HEK293T is low.

Potential solution

Reasons for low transfection efficiency in HEK293T can be (1) old or too densely grown HEK293T or (2) pH of BBS solution.

Solutions:

• •Thaw a fresh vial of HEK293T and maintain at sub-confluency for no longer than 4 weeks at a time.
• •Recalibrate pH meter before adjusting pH of BBS solution.
• •CaPO₄ transfection protocol optimization (time of incubation for precipitate formation, pH of BBS solution used etc.) is critical!

Problem 2

HEK293T cells do not tolerate the medium required for culture of the target cell line of choice.

Potential solution

Test if your target cell line can be cultured in either DMEM or RPMI medium. Both media are well tolerated by HEK293T cells. If this is not possible, viral supernatants of HEK293T cells can be concentrated by ultrafiltration with molecular weight cutoff spin columns (e.g., Amicon columns from Merck). The concentrate can then be diluted in fresh medium suitable for culture of the target cell line.

Problem 3

All target cells die during the selection.

Potential solution

Confirm transfection efficiency for your target cell line (here HepG2) and HEK293T cells by transfecting cells with pEGFP-C1 and monitoring GFP⁺ cells. Low transfection efficiency in HEK293T cells leads to low virus titer, while low transfection efficiency in HepG2 cells, limits the number of cells that can be infected by the ecotropic viral particles. Confirm expression of murine Slc7a1 mRNA by RT-qPCR in HepG2 cells transiently transfected with the expression vector (RT-qPCR primers: Slc7a1-FOR: CTCCTGGCTTACTCTTTGGTGG, Slc7a1-REV: GATCTAGCTCCTCGGTGGTTCT).

Problem 4

HepG2 cells do not die during the selection (also untransduced, GFP-expressing control cells).

Potential solution

Use puromycin at the lowest concentration at which all untransfected/viral-supernatant treated cells die within 48 h as determined in the kill curve experiment. If cells still do not die, they might be too dense. Split cells at a 1:3 to 1:6 ratio and supplement with fresh puromycin. Optimize puromycin concentration for each new batch of puromycin as we have observed lot-to-lot variation in commercially purchased puromycin. If you adapted this protocol for use in a different cell line, ensure that the target cell line is susceptible to puromycin selection before cloning your transgene of interest into a viral vector with puromycin as selection marker.

Problem 5

A low number of transductants are obtained after puromycin selection.

Potential solution

A poor viral titer or poor viability of viral particles can cause a low number of transductants. Use fresh viral supernatant for transductions. In our experience, freeze-thawing viral supernatants decreases transduction efficiency. This protocol yields stable results without measuring viral titers if transfection efficiency for both HEK293T and HepG2 GR^−/− cells is greater than 70% and fresh viral supernatants are used. However, if you wish to determine the viral titer, please refer to Brown et al.⁸

Resource availability

Lead contact

Further information and requests for reagents should be directed to the lead contact, Aishwarya Iyer-Bierhoff (aishwarya.iyer-bierhoff@uni-jena.de).

Technical contact

Technical questions on executing this protocol should be directed to and will be answered by the lead contact Aishwarya Iyer-Bierhoff (aishwarya.iyer-bierhoff@uni-jena.de).

Materials availability

All DNA constructs and cell lines generated in this study are available from the lead author upon request.

Data and code availability

This study did not generate/analyze datasets or code.

Acknowledgments

This work was supported by funding from the Carl-Zeiss-Stiftung – IMPULS consortium. We thank Sina Marielle Peter for technical assistance. The graphical abstract was created in BioRender. Heinzel, T. (2025) https://BioRender.com/q38w982.

Author contributions

Conceptualization, S.L.K.W. and A.I.-B.; investigation, S.L.K.W. and A.I.-B.; writing – original draft, S.L.K.W. and A.I.-B.; writing – review and editing, all authors; funding acquisition, T.H.; supervision, A.I.-B.

Declaration of interests

The authors declare no competing interests.