Skip to main content
BMC Microbiology logoLink to BMC Microbiology
. 2025 Apr 9;25:205. doi: 10.1186/s12866-025-03928-2

Effects of Bacillus subtilis N24 combined with liquid water-soluble carbon fertilizer on soil chemical properties and microbial community of fresh maize

Xia Deng 1,#, Wenwen Liu 1,#, Peng Huang 2, Yunge Zhang 2, Sasa Zhang 1, Yanbin Guo 3, Shifang Wu 1,, Ziwei Jiao 1,
PMCID: PMC11983975  PMID: 40205354

Abstract

Recent years have witnessed increasingly extensive application of microbial fertilizers in agriculture. However, the effectiveness of microbial fertilizers remains inconsistent because of the significant effects of soil’s physical and chemical properties on microbial colonization. Therefore, exploring the scientific application of microbial fertilizers is of great significance for improving their application effect on crops. This study aimed to investigate the effects of Bacillus subtilis combined with liquid water-soluble carbon fertilizer on soil chemical properties and the rhizosphere microbial community of fresh maize. It employed a pot experiment design, incorporating five distinct treatments: T1 (liquid water-soluble carbon fertilizer), T2 (B. subtilis N24 fermentation solution), T3 (B. subtilis + liquid water-soluble carbon fertilizer), CK0 (clean water), and CK1 (conventional fertilization). Illumina high-throughput sequencing was used to analyze corn potting soil. The results indicated that the fertilization treatments influenced the chemical properties of the rhizosphere soil of fresh maize in the following order: T3 > CK1 > T2 > T1 > CK0. The T3 treatment significantly increased the contents of total nitrogen, available nitrogen, total phosphorus, available phosphorus, potassium, and organic matter (P < 0.05). It enhanced nitrogen availability and effectively preserved phosphorus and organic matter within the soil. Furthermore, the treatment enriched the microbial community diversity in the corn rhizosphere, thereby significantly increasing the abundance of Firmicutes, Acidobacteriota, Bacteroidota, Mortierellomycota, and Basidiomycota (P < 0.05), demonstrating superior effects compared with the individual applications. The soil properties were strongly linked to microbial composition, as shown by the redundancy analysis (P < 0.05). In summary, the combined application of B. subtilis N24 and liquid water-soluble carbon fertilizer enhanced the chemical properties and fertility of the soil for fresh maize while also positively influencing the structure of the microbial community. This study provides a theoretical foundation for developing novel fertilizer application models for corn cultivation.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12866-025-03928-2.

Keywords: Bacillus subtilis, liquid water-soluble carbon fertilizer, microbial diversity, soil chemical properties

Introduction

The rapidly growing global population and the challenges posed by climate change have led to major issues related to food security. Although the application of traditional fertilizers has contributed to short-term increases in crop yields [1], their long-term use has led to a series of environmental problems such as soil degradation, ecological imbalance, water pollution, and biodiversity reduction [2, 3]. Consequently, the pursuit of effective, efficient, and environmentally sustainable alternatives to conventional fertilizers has become a focus of research in contemporary agricultural studies [4].

Liquid water-soluble carbon fertilizers have garnered significant attention from researchers in recent years due to their better nutrient composition and adaptability to environmental conditions [5]. These fertilizers have high amounts of trace elements, amino acids, organic carbon, and high–molecular weight bioactive substances. They effectively supply essential nutrients, such as nitrogen, phosphorus, and potassium [6], and also positively influence the growth of corn and other crops [7]. Furthermore, these fertilizers have been shown to enhance soil organic matter content, improve soil water retention capacity, enhance soil aggregate structure [8], and regulate pH levels, and nutrient availability. Moreover, liquid water-soluble carbon fertilizers stimulate the growth of soil microorganisms, thereby promoting the diversity and abundance of subsurface microbial communities [9, 10]. This, in turn, creates a more favorable growth environment for plant roots, thus supporting healthy crop development, facilitating soil nutrient cycling, and enhancing microbial community stability [11].

Bacillus subtilis has been extensively studied in recent years. It produces various bioactive substances, such as bacteriocins and plant hormones, which promote root growth, improve nutrient uptake, and enhance the disease resistance of plants [12]. Further, B. subtilis improves plant resistance under adverse conditions by producing biofilms and enhancing plant resistance to disease, especially when combined with organic fertilizers. Also, it significantly improves the composition and function of soil microbial communities [1316]. The new B. subtilis bio-organic fertilizer not only reduced the nitrogen loss in agricultural soil as a soil amendment but also significantly promoted the growth of strawberry and blood orange and changed the soil microbial community structure [1719]. The diversity of the microbial community not only enhanced the functionality of the soil but also improved the ecological stability of the soil; consequently, the soil was better able to cope with the changes in the external environment [2022].

The use of microbial fertilizers in agriculture has increased in recent years. This study systematically examined the effects of five different fertilization treatments through a pot experiment, combined with the target crop (maize) and its growing environment, to explore the scientific application of microbial fertilizers. It revealed the mechanism of B. subtilis combined with liquid water-soluble carbon fertilizer in soil improvement and microbial diversity via comparative analysis of the effects of different fertilization methods on soil chemical properties and microbial community structure. The findings of this study may provide a theoretical basis for the practice of scientific management of maize fertilization and a new method for optimizing fertilizer use in agricultural practice.

Materials and methods

Materials

The liquid water-soluble carbon fertilizer used in this study was sourced from Fujian Oasis Biochemical Co., Ltd. The fundamental chemical characteristics of the fertilizer included a pH of 5.8, an organic carbon content of 146 g/L, a total nitrogen (N) content of 22.53 g/L, a phosphorus (P2O5) content of 1.19 g/L, and a potassium (K2O) content of 47.67 g/L. Further, diammonium phosphate and urea were procured from the farmers' market located in Yining City, Xinjiang, China. The corn variety employed in the pot experiment was Fresh Bainuo, a fresh food corn variety sourced from Xinjiang Hewang Seed Industry Co., Ltd.

The strain under investigation was B. subtilis N24, which is cataloged as CCTCC No: M2020873. The fundamental chemical characteristics of the potting soil used in this study were as follows: pH, 8.85; an available phosphorus content, 24.23 mg/kg; available nitrogen content, 20.60 mg/kg; available potassium content, 272.51 mg/kg; total phosphorus content, 0.91 g/kg; total nitrogen content, 0.406 g/g; total potassium content, 11.99 g/kg; and organic matter content, 3.76 g/kg.

Experimental design

The greenhouse pot experiment was conducted at the demonstration facility of the Industry-University-Research Institute at Yili Normal University. Planting was conducted on May 30, 2024, following which the soil samples were collected for 1 month latter. Five treatment groups were established in accordance with the principle of fertilization equivalence:

  • CK0 (Clear water control): 50 mL/plant

  • CK1 (conventional fertilization): 0.5 g urea/plant + diammonium phosphate 1 g/plant

  • T1: liquid water-soluble carbon fertilizer, 50 mL/plant

  • T2: 0.1 mL of bacterial solution (1 × 1010 CFU/g) was added to a mixture of 2.5 mL carbon fertilizer stock solution + 47.5 mL of water. The bacterial solution was diluted 100 times with 1 × 1011 CFU/g bacterial powder provided by Genrido Biotechnology Co., Ltd. It was then fermented in a vibration culture apparatus at a constant temperature of 32℃ and 180 rpm for 12 h.

  • T3: 2.5 mL of carbon fertilizer solution + 47.5 mL of water + 0.1 g bacterial powder, five times per treatment.

For the CK1 treatment, 0.5 g of urea and 1 g of diammonium phosphate were added to each pot. After crushing, the soil was mixed and filled into the pot. For the T1 treatment, liquid water-soluble carbon fertilizer was used as the raw material, diluted 20 times, and pH adjusted to 7.0. For the T2 treatment, liquid water-soluble carbon fertilizer was used as the raw material, diluted 20 times, and pH adjusted to 7.0. Then, B. subtilis N24 was added for fermentation and then used when the viable bacteria count reached 2 × 108 CFU/mL. For the T3 treatment, diluted liquid water-soluble carbon fertilizer was prepared as earlier. Then, B. subtilis N24 (viable bacteria count 2 × 108 CFU/mL) was directly added without fermentation. Corn seeds of the same size were selected. The red coat on the surface of the seeds was cleaned with water, disinfected with 75% alcohol for 15 s, soaked in 10% sodium hypochlorite solution for 10 min, and finally rinsed with water three times. Potting soil was prepared in the soils and vermiculite perlite ratio of 3:1:1:1. Then, 2 kg from the mixture was added to a pot. Three seeds were sown in each pot to a depth of about 1 cm. A completely random placement was adopted, and regular and quantitative watering was performed. Plants were thinned 3 days after emergence, and one plant of the same size and height in each pot was retained. After thinning, the T1, T2, and T3 treatments were applied for the first time, and thereafter the fertilizer was applied every seventh day for three applications. The roots of corn were gently dug out with a shovel after 30 days, large soil particles were shaken off, and part of the norhizosphere soil was collected for chemical analysis. The rhizosphere soil adhered to the root surface was put into a sterile bag, sealed, immediately placed in a biological sample sampling box, transported to the laboratory at low temperature, and stored in an ultra-low temperature refrigerator at –80℃.

Determination of soil chemical properties

Soil pH was measured with a pH meter. The soil organic matter contents were determined by the potassium dichromate oxidation method. Kjeldahl method was used for determining soil total nitrogen (TN) content. The soil available nitrogen (AN) content was determined by alkaline hydrolysis diffusion. The molybdenum antimony resistance colorimetric method was employed for determining soil available phosphorus (AP) content. Soil total phosphorus (TP) content was determined by the NaOH alkali fusion method. The flame photometer method was used for determining total potassium (TK) content. The soil available potassium (AK) content was determined by flame spectrophotometry after extracting ammonium acetate solution [2326].

High-throughput sequencing

DNA was extracted using a YH-soil kit following the manufacturer’s protocol. Universal 16S V3–V4 region primers used for PCR amplification were as follows: upstream primer 338F: ACTCCTACGGGAGGCAGCAG; downstream primer 806R: GGACTACHVGGGTWTCTAAT; fungi-specific primer for polymerase chain reaction (PCR) amplification: ITS5-1737F (5'-CTTGGTCATTTAGAGGAAGTAA-3') and ITS2-2043R (5'-GCTGCGTTCTTCATCGATGC-3'). Further, 30 μL of Phusion1 Hi-Fidelity PCR Master Mix (New England Biology Laboratory) was used. The PCR reaction system (30 μL) comprised the following: Fusion Master Mix (2 ×) 15 μL; forward primer (1oul/μL) 1 μL, reverse primer (1oul/μL) 1 μL, DNA (1 ng/μL) 1 g, 10 μL (10 ng) H2O2. The reaction procedure was as follows: pre-denaturation at 98℃ for 1 min; 30 cycles at 98 °C for 10 s; annealing at 50 °C for 30 s; and maintaining at 72 °C for 30 s. The reaction was conducted at 72℃ for 5 min and stopped at 10℃. The PCR products were purified by agarose gel electrophoresis and fully mixed with 1 × TAE at a concentration of 2% and the target DNA (TianGen, China). The libraries were constructed using an NEBNext Ultra DNA library preparation kit (Illumina, CA, USA). The constructed libraries were detected and quantified by quantitative PCR using an Agilent 5400 fragment analyzer (Agilent Technologies Co., USA). The quality check was performed on the constructed libraries, and the libraries were qualified and then sorted online using the Illumina MiSeq PE300/NovaSeq PE250 platform (Illumina, CA, USA). The sequencing of all samples in this study was performed by Shanghai Meiji Biomedical Technology Co., Ltd.

Data analysis

The α- and β-diversities of microbial communities were analyzed using QIIME2 and R software (version 3.5.1) and visualized by nonmetric multidimensional scale ranking. SPSS 27.0 was used to perform one-way analysis of variance, multifactor comparison, and correlation analysis of the samples. The principal coordinate analysis chart was drawn using the R language tool. The orthogonal partial least squares discriminant analysis was used to detect group differences. The microbial diversity was mapped using R software. The redundancy analysis (RDA) was used to analyze the relationship between fungal communities and environmental factors.

Results and analysis

Analysis of soil chemical properties

As illustrated in Table 1, the comparative efficacy of various fertilization treatments in enhancing the chemical properties of rhizosphere soil was ranked as follows: T3 > CK1 > T2 > T1 > CK0. The T1 and T2 treatments significantly increased the TN content of the rhizosphere soil by 24.22% and 51.14%, respectively, compared with the CK0 treatment. The T3 treatment led to a notable increase in the contents of TN, AN, TP, AP, AK, and organic matter, with increases of 78.26%, 12.1%, 22.90%, 21.88%, 43.35%, and 31.79%, respectively. The effects of the T1, T2, and T3 treatments were significant compared with the CK1 treatment. The T1 treatment significantly reduced TN and TP contents by 65.83% and 6.74%, respectively, while simultaneously increasing the AK content by 11.83%. The T2 treatment was associated with significant decreases in the pH level and TN content by 1.48% and 36.30%, respectively, besides an increase in AK content by 10.49%. Furthermore, the T3 treatment significantly enhanced the contents of AP, TP, AK, and organic matter by 10.48%, 7.37%, 13.18%, and 18.84%, respectively.

Table 1.

Soil chemical properties

Chemical index pH Rapidly available nitrogen
(mg/kg)
Total nitrogen
(mg/g)
Available phosphorus
(mg/kg)
Total phosphorus
(g/kg)
Whole potassium
(g/kg)
Rapidly available potassium
(mg/kg)
Organic matter
(g/kg)
Treatment group
CK0 8.81 ± 0.01ab 18.27 ± 0.71b 4.83 ± 0.34e 12.11 ± 1.18c 0.83 ± 0.07b 11.05 ± 0.34a 209.57 ± 1.41c 6.70 ± 0.17c
CK1 8.91 ± 0.01a 19.21 ± 1.25ab 9.95 ± 0.43a 13.36 ± 0.44bc 0.95 ± 0.02a 11.05 ± 0.44a 265.42 ± 26.91b 7.43 ± 0.32b
T1 8.68 ± 0.02c 18.97 ± 1.04ab 6.00 ± 0.35d 12.59 ± 0.56bc 0.89 ± 0.08b 11.02 ± 1.45a 296.83 ± 12.35a 8.73 ± 0.06a
T2 8.78 ± 0.05bc 18.39 ± 0.53b 7.30 ± 0.39c 13.73 ± 0.60ab 0.98 ± 0.02a 11.22 ± 0.60a 293.25 ± 8.66a 7.57 ± 0.25b
T3 8.86 ± 0.12ab 20.48 ± 0.44a 8.61 ± 0.44b 14.76 ± 0.42a 1.02 ± 0.01a 11.42 ± 0.44a 300.41 ± 8.64a 8.83 ± 0.75a

Data are expressed as mean ± standard deviation. Different letters indicate significant differences among mean values (P < 0.05)

Changes in soil microbial community structure

Venn diagrams of the sample communities were generated to determine the overall composition of the microbial community. The number of bacteria-specific OTUs in the sample gradually increased after different fertilization treatments. The specific OTU for the CK0, CK1, T1, T2, and T3 treatments was 318, 349, 417, 400, and 362, respectively (Fig. 1A). This result showed that different fertilization treatments significantly promoted the increase in bacterial diversity. Especially, the number of bacterial OTUs reached 417 under the T1 treatment, reflecting the favorable nonselective promoting effect of this treatment on bacterial diversity. The endemic OTU of CK0, CK1, T1, T2, and T3 treatments was 64, 196, 103, 147, and 90, respectively (Fig. 1B). Among these, the number of fungal OTUs under the CK1 treatment was the highest, reaching 196. This indicated that conventional fertilization treatment provided a relatively suitable habitat for fungal growth. Overall, the variation range of fungal OTU was smaller compared with that of bacterial OTU. However, the difference in the number of endemic OTUs among different treatments still reflected the effects of various fertilization treatments on the composition of soil microbial community.

Fig. 1.

Fig. 1

Venn diagram analysis showing common and endemic species (A, bacteria; B, fungi) in soil samples

As illustrated in Figs. 2(f) and 3(f), the coverage across all five treatment groups exceeded 98.5%, thereby accurately representing the soil microbial community composition and affirming the reliability of the sequencing results. The bacterial samples yielded 821,956 valid sequences, with an average sequence length of 415 base pairs. The analysis of bacterial alpha diversity is presented in Fig. 2. The results were as follows: As shown in Fig. 2(a), the Sobs index ranked as T1 > T3 > CK1 > T2 > CK0, with the T1 treatment exhibiting a 6.11% increase compared with the CK0 treatment. As shown in Fig. 2(b, c), the Chao and ACE indices were ordered as T3 > T1 > CK1 > T2 > CK0, with the T3 treatment showing a 5.90% increase compared with the CK0 treatment. As shown in Fig. 2(d), the Shannon index was ordered as T1 > T3 > CK1 > CK0 > T2, As shown in Fig. 2(e), whereas the Simpson index was ranked as T2 > CK1 > CK0 > T3 > T1. The fungal samples produced 1,058,292 valid sequences, with an average sequence length of 248 base pairs. The fungal alpha diversity is depicted in Fig. 3. As shown in Fig. 3(a, b, c) the Sobs, Chao, and ACE indices were ranked as CK1 > T2 > T3 > T1 > CK0, the analysis indicated the CK1 treatment demonstrated a 58.09% increase compared with the CK0 treatment. As shown in Fig. 3(d), the Shannon index was ordered as T3 and T2 > CK0 and CK1 > T1, with the T3 treatment showing a 15.58% increase compared with the T1 treatment. As shown in Fig. 3(e), the Simpson index was ranked as T1 > CK1 > CK0 > T3 and T2.

Fig. 2.

Fig. 2

Analysis of the α-diversity of bacterial communities. Note: The x-axis represents the sample name, whereas the y-axis represents the content. Duncan’s multiple range test was used to compare the significant differences among all groups (P < 0.05; N = 3). a stands for Sobs, b stands for ACE, c stands for Chao, d stands for Shannon, e stands for Simpson, and f stands for coverage

Fig. 3.

Fig. 3

Analysis of the α-diversity of fungal communities. Note: The x-axis represents the sample name, and the y-axis represents the content. Duncan’s multiple range test was used to compare the significant differences among all groups (P < 0.05; N = 3). a stands for Sobs, b stands for ACE, c stands for Chao, d stands for Shannon, e stands for Simpson, and f stands for coverage

Changes in bacterial community

Different fertilization treatments had specific effects on the composition and structure of soil bacterial communities, as shown in Fig. 4A. The COMP1 axis explained the difference in samples by 11.39%. The T1, T2, and T3 treatments displayed significant differences on the COMP1 axis. The COMP2 axis explained 8.37% of the sample differences. The microbial community structure of CK0 and CK1 samples on the COMP2 axis was significantly different from that of T1, T2, and T3 samples. The principal component analysis (PCA) of the bacterial community structure in a single sample was performed at the genus level using R language to verify whether bacterial communities were different, as shown in Fig. 5A. The results indicated that the PC1 and PC2 axes explained 21.26% and 13.86% of the variance, respectively. Significant differences were observed between the soil samples and the control group after various fertilization treatments, indicating that the bacterial community structure changed significantly after application. A total of 13 phyla with relative abundance greater than 1% were identified at the phylum level, as shown in Fig. 6A. Among these, the total relative abundance of Actinobacteriota, Proteobacteria, Chloroflexi, Firmicutes, and Acidobacteriota was greater than 80%. Is the dominant bacteria phylum. Significant differences were found in the abundance of Proteobacteria and Firmicutes under each fertilization treatment (P < 0.05). The abundance of Proteobacteria under the CK1, T1, T2, and T3 treatments increased by 1.1%, 2.8%, 4.7%, and 1%, respectively. The abundance of Firmicutes under the T1, T2, and T3 treatments increased by 1.6%, 1.5%, and 2.5%, respectively. The T1 treatment decreased the abundance of Actinomyces, Chloroflexi, and Gemmatimonadota, but increased the abundance of Proteobacteria, Firmicutes, Acidobacteriota, and Bacteroidota. The T2 treatment reduced the abundance of Actinomyces, Chloroflexi, Acidobacteriota, Gemmatimonadota, and Myxomycota, and increased the abundance of Proteobacteria, Firmicutes, Bacteroidetes, and Cyanobacteria. The T3 treatment decreased the abundance of actinomycota, and increased the abundance of Firmicutes, Acidobacteria, and Bacteroidetes.

Fig. 4.

Fig. 4

PLS-DA analysis of sample microbial community. (A) Analysis of bacterial and (B) fungal communities at the family level

Fig. 5.

Fig. 5

Principal component analysis (PCA) of β-diversity of soil microbial communities: (A) bacteria and (B) fungi

Fig. 6.

Fig. 6

Composition and structure of soil microbial communities at the phylum level: (A) bacteria and (B) fungi

Changes in the fungal community

Different fertilization treatments also specifically affected the soil fungal community structure, as shown in Fig. 4B. The COMP1 axis explained 10.15% of the sample difference, whereas the COMP2 axis explained 8.61%. The microbial community structure of control soil samples under the CK0 and CK1 treatments significantly differed from that under the T1, T2, and T3 treatments. The difference between the samples fully accounted for the variation in soil microbial community structure between liquid water-soluble carbon fertilizer and conventional fertilizer treatments. The PCA of the soil samples was performed at the fungal genus level, as shown in Fig. 5B. The results showed minimal effect of the treatment with liquid water-soluble carbon fertilizer on the fungal community. As shown in Fig. 6B, five phylum had relative abundance greater than 1%: Ascomycota, Mortierellomycota, unclassified_k__Fungi, Basidiomycota, and Chytridiomycota. The total relative abundance of Ascomycota was greater than 50%, indicating that Ascomycota was the dominant phylum. The abundance of Ascomycota was significantly higher under the T1 treatment compared with other treatments (P < 0.05), with an increase by 7.1%, 8.6%, 10.2%, and 6.6% compared with that under the CK0, CK1, T2, and T3 treatments, respectively. The T1 treatment increased the abundance of Ascomycetes but decreased the abundance of Basidiomycota and Mortierellomycota. The T2 treatment decreased the abundance of Ascomycetes and Basidiomycota and increased the abundance of Mortierellomycota, unclassified_k__Fungi, and Chytridomycota. The T3 treatment increased the abundance of Mortierellomycota and Basidiomycetes.

Correlation analysis between microbial diversity index and soil factors

A certain correlation was detected between the bacterial diversity index and soil chemical properties after different fertilization treatments. As shown in Table 2, the Chao, ACE, and Sobs index of bacteria were significantly positively correlated with AN and AK contents (P < 0.05), and highly significantly positively correlated with organic matter content (P < 0.01). As shown in Table 3, the Chao, ACE, and Sobs indices of fungi were positively correlated with TN (P < 0.01) and AP contents (P < 0.05). In contrast, the Shannon index was positively correlated with AP content (P < 0.01). Therefore, the soil factors that significantly impacted microbial diversity and richness were organic matter, AN, AK, TN, AP, and organic matter.

Table 2.

Correlation analysis between bacterial diversity index and soil factors

Diversity index pH Rapidly available nitrogen Total nitrogen Available phosphorus Total phosphorus Whole potassium Rapidly available potassium Organic matter
Sobs –0.036 0.560* 0.425 0.263 0.260 0.021 0.531* 0.753**
ACE –0.058 0.623* 0.373 0.357 0.330 0.073 0.587* 0.825**
Chao –0.094 0.621* 0.298 0.325 0.286 0.067 0.544* 0.828**
Shannon –0.177 0.317 –0.029 –0.07 –0.206 0.048 0.003 0.426
Simpson 0.371 –0.238 0.211 0.069 –0.147 –0.147 –0.054 –0.409

Positive numbers indicate a positive correlation, whereas negative numbers indicate a negative correlation

*Significant correlation (P < 0.05)

**extremely significant correlation (P < 0.01)

Table 3.

Correlation analysis between fungal diversity index and soil factors

Diversity index pH Rapidly available nitrogen Total nitrogen Available phosphorus Total phosphorus Whole potassium Rapidly available potassium Organic matter
Sobs 0.368 0.032 0.768** 0.583* 0.016 0.016 0.393 –0.035
ACE 0.380 0.026 0.769** 0.571* 0.015 0.015 0.370 –0.065
Chao 0.405 0.039 0.782** 0.593* 0.027 0.027 0.371 –0.065
Shannon 0.405 0.177 0.377 0.649** 0.082 0.082 0.151 –0.110
Simpson –0.361 –0.093 –0.084 –0.435 –0.167 –0.167 0.031 0.192

Positive numbers indicate a positive correlation, whereas negative numbers indicate a negative correlation

*Significant correlation (P < 0.05)

**extremely significant correlation (P < 0.01)

Correlation analysis between soil chemical properties and microbial diversity

The redundancy analysis is shown in Fig. 7, where the blue solid line represents the dominant bacteria and the red solid line represents the eight chemical factors. As shown in Fig. 7A, RDA axis 1 explained 21.72%, whereas axis 2 explained 17.44% of the variance, for a cumulative explanation rate of 39.16%. Among these, TN, TP, AK, and organic matter contents had the most significant effects on bacterial communities. The correlation analysis in Table 4 indicates different correlations between the abundance of each dominant bacterial phyla and soil chemical properties. The abundance of Actinomycetes was negatively correlated with AP and TP contents (P < 0.05) and extremely negatively correlated with AK and organic matter contents (P < 0.01). The abundance of Proteobacteria was positively correlated with AK content (P < 0.05). The abundance of Firmicutes was significantly positively correlated with AP and TP contents (P < 0.05) and highly significantly positively correlated with AK and organic matter contents (P < 0.01). A significant positive correlation was detected between the abundance of Blastomonas and AP content (P < 0.05), whereas a highly significant negative correlation was observed between TN, TP, and AK contents (P < 0.01). The abundance of Bacteroidetes was negatively correlated with pH and positively correlated with AK and organic matter contents. A significant positive correlation was noted between the abundance of Myxomycetes and TN content. As shown in Fig. 7B, RDA axis 1 explained 50.45%, whereas axis 2 explained 12.49% of the variance, with a cumulative interpretation rate of 62.94%. The analysis results in Table 5 show that the relationship between dominant phyla and soil chemical properties was equally important, and the abundance of Mortierella had a significant positive correlation with pH (P < 0.05). Further, a significant positive correlation was found between the abundance of unclassified fungi and TN content (P < 0.05). In conclusion, different treatment modes of liquid water-soluble carbon fertilizer significantly affected the composition of the soil microbial community and its relationship with soil chemical properties.

Fig. 7.

Fig. 7

RDA analysis between microbial communities and environmental factors (A, bacteria; B, fungi)

Table 4.

Correlation analysis between the abundance of dominant bacterial flora and soil chemical properties

Dominant bacteria phylum pH Rapidly available nitrogen Total nitrogen Available phosphorus Total phosphorus Whole potassium Rapidly available potassium Organic matter
Actinobacteriota 0.377 –0.286 –0.095 0.521* 0.574* –0.145 0.840** 0.717**
Proteobacteria –0.446 –0.202 0.018 0.151 0.307 0.011 0.620* 0.253
Chloroflexi 0.499 0.326 0.061 0.049 –0.115 0.051 0.620* –0.144
Firmicutes –0.313 0.444 0.063 0.554* 0.542* 0.172 –0.494 0.801**
Acidobacteriota −0.155 0.283 –0.186 –0.254 –0.380 –0.061 0.765** 0.346
Gemmatimonadota –0.259 –0.179 0.750** 0.594* 0.773** –0.092 –0.122 –0.227
Bacteroidota 0.536* 0.193 0.089 0.076 0.156 –0.024 0.717** 0.731**
Myxococcota 0.484 0.472 0.673** 0.195 0.199 –0.006 0.067 0.232

Positive numbers indicate a positive correlation, whereas negative numbers indicate a negative correlation

*Significant correlation (P < 0.05)

**extremely significant correlation (P < 0.01)

Table 5.

Correlation analysis between dominant fungal flora and soil chemical properties

Dominant fungal phylum pH Rapidly available nitrogen Total nitrogen Available phosphorus Total phosphorus Whole potassium Rapidly available potassium Organic matter
Ascomycota –0.327 0.145 –0.206 –0.044 –0.274 –0.237 0.005 0.198
Mortierellomycota 0.556* 0.186 0.373 0.314 0.291 0.404 –0.034 0.106
unclassified_k__Fungi 0.333 –0.143 0.525* 0.204 0.265 –0.007 0.179 –0.195
Basidiomycota –0.104 –0.188 –0.297 –0.369 –0.043 –0.054 –0.199 –0.280
Chytridiomycota –0.095 –0.217 −0.018 0.082 0.194 0.235 0.262 –0.108

Positive numbers indicate a positive correlation, whereas negative numbers indicate a negative correlation

*Significant correlation (P < 0.05)

**extremely significant correlation (P < 0.01)

Discussion

This study found that the T3 treatment had the best effect in terms of improving the chemical properties of maize soil. Compared with the CK0 treatment, the T1 and T2 treatments significantly increased the TN content of rhizosphere soil. This might be attributed to the enhanced soil microbial activity after fertilization, which promoted nitrogen mineralization and transformation, thus improving nitrogen availability [16]. The T3 treatment not only improved the nitrogen supply but also allowed effective retention of phosphorus and organic matter in the soil, thus providing more comprehensive nutritional support for plant growth [27, 28]. The high content of organic matter and soluble nutrients under the T3 treatment maintained soil sustainability and plant health [29, 30]. The findings showed that the combination of B. subtilis and liquid water-soluble carbon fertilizer not only enhanced nutrient cycling in the soil but also increased soil nutrients for plant growth, thereby providing a more ideal growth environment for plants due to the improvement in microbial community diversity [12, 31].

The bacterial diversity analysis showed that the Chao and ACE indices of the combination of B. subtilis combined with liquid water-soluble carbon fertilizer were the highest, indicating that the T3 treatment had the most significant impact on species abundance and richness. The potential reason was that the addition of B. subtilis guided the structure of the soil microbial community and enhanced its potential ecological function [32, 33]. The fungal diversity analysis revealed high fungal diversity under the T3 and T2 treatments, indicating that the combined application of B. subtilis and liquid water-soluble carbon fertilizer could improve ecological complexity [34, 35]. Increased diversity of bacterial communities may promote the stability and functionality of soil ecosystems, whereas the changes in fungal communities may be closely related to specific environmental conditions [20].

Soil fertilization management can influence the diversity and community structure of microbial populations. The findings of this study indicated that the application of a liquid water-soluble carbon fertilizer in conjunction with B. subtilis led to significant alterations in the composition of the soil microbial community, consistent with previous findings [34]. Actinomycetes decompose organic matter and enhance soil health, and thus are widely acknowledged as crucial contributors to soil ecological functions and nutrient cycling [20, 35]. In this study, the abundance of Actinomycetes was reduced in different treatments (T1, T2, and T3), suggesting that the application of water-soluble fertilizer might have altered the soil environment and inhibited the growth of Actinomycetes [36]. This study found that the T1, T2, and T3 treatments increased the abundance of Proteobacteria, which enhanced soil fertility through nitrogen fixation and denitrification processes [37]. This increase might be related to the abundance of available nutrients in the liquid water-soluble carbon fertilizer, providing a favorable living environment for Proteobacteria [38]. Firmicutes are crucial in soil organic matter decomposition and nutrient release [39]. In this study, the increased relative abundance of Firmicutes under the T1, T2, and T3 treatments enhanced the competitiveness of Firmicutes and promoted the reproduction of their communities [40]. The abundance of Gemmatimonadota decreased significantly under T2 treatment, possibly due to nutrient competition for fertilization and the interaction between the flora. Gemmatimonadota generally predominates in nutrient-poor soils, but this relatively “low-tolerance” flora may be replaced by one more adapted to the dominant environment with nutrient supply [41]. In addition, the abundance of Acidobacteriota is also affected, which may reflect the negative impact of the changes in soil pH on its growth. Acidobacteria usually act as the decomposers of organic matter in soil and help regulate the soil’s acidic environment [42]. The fertilizer application could significantly reduce the abundance of specific soil microorganisms, possibly due to nutrient competition, changes in soil pH, or other changes in physical and chemical properties [43]. The abundance of Firmicutes, Acidobacteria, and Bacteroidetes increased under the T3 treatment, further suggesting a synergistic effect of the combination of liquid water-soluble carbon fertilizer and B. subtilis [4446].

Ascomycetes are the most abundant and diverse phyla of soil fungi and usually play a key role in organic decomposition and nutrient cycling [47, 48]. This study showed that the T1 treatment significantly increased the abundance of Ascomycetes. This might be related to the abundant carbon source in liquid water-soluble carbon fertilizer, which provided sufficient nutrients for the growth of Ascomycetes and increased the competitiveness of their community [49, 50]. The decrease in the abundance of Ascomycetes under the T2 treatment also indicated that B. subtilis inhibited the propagation of Ascomycetes [51]. The T1 and T2 treatments significantly reduced the abundance of Basidiomycetes. This was possibly because Basidiomycetes preferred substrates rich in lignin and cellulose. However, the application of liquid water-soluble carbon fertilizer changed the nutrient structure and organic composition of the soil, thus impacting the living conditions of Basidiomycetes [5254]. The abundance of Mortierellomycota decreased under T1 treatment, possibly due to its slightly different water and nutrient requirements compared with Ascomycota [55, 56]. The abundance of Mortierellomycota increased significantly under the T2 treatment. Previous studies have shown that the microbial fermentation liquid can effectively stimulate the activity of soil microorganisms and optimize microbial interactions, thereby improving soil biodiversity and enhancing plant nutrient absorption capacity [57, 58]. The T3 treatment increased the abundance of Ascomycetes, Basidiomycetes, and Mortierellomycota, indicating that the combination of B. subtilis and liquid water-soluble carbon fertilizer can provide abundant available carbon sources for soil. Related studies have shown that liquid fertilizer and microbial agents can enhance the interaction of soil microorganisms, increase the proportion of specific fungi and stimulate metabolic activity. This, in turn, increases their abundance and activity in the soil and improves the utilization of microorganisms [5962].

Conclusions

This study systematically assessed the impact of various fertilization treatment modalities on the chemical characteristics and microbial community composition of corn rhizosphere soil. The findings indicated that implementing diverse fertilization strategies significantly enhanced soil quality. The combination of B. subtilis N24 and liquid water-soluble carbon fertilizer (T3) demonstrated the most pronounced effects, thereby improving soil fertility and microbial activity. Furthermore, both species abundance and richness were notably high. Thus, the synergistic application of liquid water-soluble carbon fertilizer and B. subtilis is a novel fertilization approach for enhancing soil ecosystems and facilitating the growth of fresh maize, while also serving as an effective strategy for optimizing corn fertilization management.

Supplementary Information

Supplementary Material 1. (118.2MB, zip)
Supplementary Material 2. (131.4MB, zip)

Acknowledgements

This study was performed by the staff of the Key Laboratory of Xinjiang Lavender Conservation and Utilization of Yili Normal University with the support of the College of Biological Science and Technology of Yili Normal University.

Authors’ contributions

Xia Deng wrote, analyzed and mapped the original manuscript, Wenwen Liu sorted out the experimental data, Ziwei Jiao and Shifang Wu examined and revised the original manuscript. Ziwei Jiao, Peng Huang, Yunge Zhang, Yanbin Guo and Sasa Zhang supervised the experiment.

Funding

This study was financially supported by the Key Research and Development Project of Xinjiang Uygur Autonomous Region (2022B02021-2), the YZ2023A05 Science and Technology Plan Project of Yili Prefecture, and the Key Talents Project of Agriculture, Rural Areas of Autonomous Region (2023SNGGGCC015).

Data availability

We have deposited the data into the NCBI database with the accession number PRJNA1215788.

Declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Xia Deng and Wenwen Liu contributed to the work equally and should be regarded as co-first authors.

Contributor Information

Shifang Wu, Email: wusf6898@163.com.

Ziwei Jiao, Email: jiaziwei123@163.com.

References

  • 1.FAO, ITPS, GSBI, SCBD, EC. State of knowledge of soil biodiversity - Status, challenges and potentialities, Report 2020. Rome: FAO; 2020. 10.4060/cb1928en.
  • 2.Singh TB, Ali A, Prasad M, Yadav A, Shrivastav P, Goyal D, Dantu PK. Role of organic fertilizers in improving soil fertility. In: Contaminants in agriculture: sources, impacts and management. 2020. p. 61–77.
  • 3.Verma B, Pramanik P, Bhaduri D. Organic fertilizers for sustainable soil and environmental management. In: Nutrient dynamics for sustainable crop production. 2020. p. 289–313.
  • 4.Lin W, Lin M, Zhou H, Wu H, Li Z, Lin W. The effects of chemical and organic fertilizer usage on rhizosphere soil in tea orchards. PLoS One. 2019;14(5): e0217018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Zhao S, Wang D, Li Y, Wang W, Wang J, Chang H, Yang J. The effect of modifier and a water-soluble fertilizer on two forages grown in saline-alkaline soil. PLoS One. 2024;19(2): e0299113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Das SK, Choudhury BU, Hazarika S, Mishra VK, Laha R. Long-term effect of organic fertilizer and biochar on soil carbon fractions and sequestration in maize-black gram system. Biomass Conversion and Biorefinery. 2024;14(19):23425–38. [Google Scholar]
  • 7.Zaki MK, Komariah K, Rahmat A, Pujiasmanto B. Organic amendment and fertilizer effect on soil chemical properties and yield of maize (Zea mays L.) in rainfed condition. Walailak Journal of Science and Technology (WJST). 2020;17(1):11–7. [Google Scholar]
  • 8.Liu FJ, Tian HD, Zhang C, Chen YX, Li X, Zhang XY, Cai YH, Chen HD. Effects of organic fertilizer replacing part of nitrogen fertilizer on maize yield and soil physical and chemical properties under the condition of straw incorporation. 2022.
  • 9.Gezahegn AM. Effect of organic fertilizers on maize (Zea mays L.) production and soil physical and chemical properties. World Applied Sciences Journal. 2021;39(1):11–9. [Google Scholar]
  • 10.Cercioglu M. The role of organic soil amendments on soil physical properties and yield of maize (Zea mays L.). Communications in soil science and plant analysis. 2017;48(6):683–91. [Google Scholar]
  • 11.Li H, Luo N, Ji C, Li J, Zhang L, Xiao L, She X, Liu Z, Li Y, Liu C. Liquid Organic Fertilizer Amendment Alters Rhizosphere Microbial Community Structure and Co-occurrence Patterns and Improves Sunflower Yield Under Salinity-Alkalinity Stress. Microb Ecol. 2022;84:423–38. 10.1007/s00248-021-01870-0. [DOI] [PubMed]
  • 12.Blake C, Christensen MN, Kovács ÁT. Molecular aspects of plant growth promotion and protection by Bacillus subtilis. Mol Plant Microbe Interact. 2021;34(1):15–25. [DOI] [PubMed] [Google Scholar]
  • 13.Flemming H-C, Wingender J, Szewzyk U, Steinberg P, Rice SA, Kjelleberg S. Biofilms: an emergent form of bacterial life. Nat Rev Microbiol. 2016;14(9):563–75. [DOI] [PubMed] [Google Scholar]
  • 14.Qiao J, Yu X, Liang X, Liu Y, Borriss R, Liu Y. Addition of plant-growth-promoting Bacillus subtilis PTS-394 on tomato rhizosphere has no durable impact on composition of root microbiome. BMC Microbiol. 2017;17:1–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Wei F, Hu X, Xu X. Dispersal of Bacillus subtilis and its effect on strawberry phyllosphere microbiota under open field and protection conditions. Sci Rep. 2016;6(1):22611. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Saeid A, Prochownik E, Dobrowolska-Iwanek J. Phosphorus solubilization by Bacillus species. Molecules. 2018;23(11): 2897. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Liu L, Li X, Li T, Xie Y, Cao Z, Fang P. Bio-organic fertilizer with Bacillus subtilis F2 promotes strawberry plant growth and changes rhizosphere microbial community. J Soil Sci Plant Nutr. 2022;22(3):3045–55. [Google Scholar]
  • 18.Qiu F, Liu W, Chen L, Wang Y, Ma Y, Lyu Q, et al. Bacillus subtilis biofertilizer application reduces chemical fertilization and improves fruit quality in fertigated Tarocco blood orange groves. Sci Hortic. 2021;281:110004. [Google Scholar]
  • 19.Sun BO, Gu L, Bao L, Zhang S, Wei Y, Bai Z, et al. Application of biofertilizer containing Bacillus subtilis reduced the nitrogen loss in agricultural soil. Soil Biol Biochem. 2020;148:107911. [Google Scholar]
  • 20.Trivedi P, Leach JE, Tringe SG, Sa T, Singh BK. Plant–microbiome interactions: from community assembly to plant health. Nat Rev Microbiol. 2020;18(11):607–21. [DOI] [PubMed] [Google Scholar]
  • 21.Mercado-Blanco J, Abrantes I, Barra Caracciolo A, Bevivino A, Ciancio A, Grenni P, Hrynkiewicz K, Kredics L, Proença DN. Belowground microbiota and the health of tree crops. Front Microbiol. 2018;9: 1006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Barra Caracciolo A, Grenni P. Bioremediation of Soil Ecosystems from Triazine Herbicides. In: Rodríguez-Cruz MS, Sánchez-Martín MJ, (eds). Pesticides in Soils. The Handbook of Environmental Chemistry, vol 113. Cham: Springer; 2021. 10.1007/698_2021_804.
  • 23.McLean EO. Soil pH and lime requirement. In: Methods of soil analysis: part 2 chemical and microbiological properties. 1983. p. 199–224.
  • 24.Mingorance MD, Barahona E, Fernandez-Galvez J. Guidelines for improving organic carbon recovery by the wet oxidation method. Chemosphere. 2007;68(3):409–13. [DOI] [PubMed] [Google Scholar]
  • 25.Bremner JM. Nitrogen-total. In: Methods of soil analysis: part 3 chemical methods, vol. 5. 1996. p. 1085–1121.
  • 26.Ashworth J, Mrazek K. “Modified Kelowna” test for available phosphorus and potassium in soil. Commun Soil Sci Plant Anal. 1995;26(5-6):731–9. 10.1080/00103629509369331.
  • 27.Freitas MA, Medeiros FH, Carvalho SP, Guilherme LR, Teixeira WD, Zhang H, Pare PW. Augmenting iron accumulation in cassava by the beneficial soil bacterium Bacillus subtilis (GBO3). Front Plant Sci. 2015;6:596. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Zhang H, Sun Y, Xie X, Kim MS, Dowd SE, Pare PW. A soil bacterium regulates plant acquisition of iron via deficiency-inducible mechanisms. Plant J. 2009;58(4):568–77. [DOI] [PubMed] [Google Scholar]
  • 29.Hou JQ, Li MX, Mao XH, Hao Y, Ding J, Liu DM, Xi BD, Liu HL. Response of microbial community of organic-matter-impoverished arable soil to long-term application of soil conditioner derived from dynamic rapid fermentation of food waste. PLoS One. 2017;12: e0175715. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Dordas CA, Lithourgidis AS, Matsi T, Barbayiannis N. Application of liquid cattle manure and inorganic fertilizers affect dry matter, nitrogen accumulation, and partitioning in maize. Nutr Cycl Agroecosyst. 2007;80:283–96. [Google Scholar]
  • 31.Ji R, Dong G, Shi W, Min J. Effects of liquid organic fertilizers on plant growth and rhizosphere soil characteristics of chrysanthemum. Sustainability. 2017;9: 841. [Google Scholar]
  • 32.Alina SO, Constantinscu F, Petruta CC. Biodiversity of Bacillus subtilis group and beneficial traits of Bacillus species useful in plant protection. Romanian Biotechnological Letters. 2015;20(5):10737–50. [Google Scholar]
  • 33.Yang W, Li C, Wang S, Zhou B, Mao Y, Rensing C, Xing S. Influence of biochar and biochar-based fertilizer on yield, quality of tea and microbial community in an acid tea orchard soil. Appl Soil Ecol. 2021;166: 104005. [Google Scholar]
  • 34.Bhatt MK, Labanya R, Joshi HC. Influence of long-term chemical fertilizers and organic manures on soil fertility-a review. Universal Journal of Agricultural Research. 2019;7(5):177–88. [Google Scholar]
  • 35.Mahapatra S, Yadav R, Ramakrishna W. Bacillus subtilis impact on plant growth, soil health and environment: Dr. Jekyll and Mr. Hyde. Journal of applied microbiology. 2022;132(5):3543–62. [DOI] [PubMed] [Google Scholar]
  • 36.Dang P, Li C, Lu C, Zhang M, Huang T, Wan C, Wang H, Chen Y, Qin X, Liao Y. Effect of fertilizer management on the soil bacterial community in agroecosystems across the globe. Agr Ecosyst Environ. 2022;326: 107795. [Google Scholar]
  • 37.Mishra S, Hättenschwiler S, Yang X. The plant microbiome: a missing link for the understanding of community dynamics and multifunctionality in forest ecosystems. Appl Soil Ecol. 2020;145: 103345. [Google Scholar]
  • 38.Dai Z, Su W, Chen H, Barberan A, Zhao H, Yu M, Yu L, Brookes PC, Schadt CW, Chang SX. Long-term nitrogen fertilization decreases bacterial diversity and favors the growth of Actinobacteria and Proteobacteria in agro-ecosystems across the globe. Glob Change Biol. 2018;24(8):3452–61. [DOI] [PubMed] [Google Scholar]
  • 39.Cui J, Yang B, Zhang M, Song D, Xu X, Ai C, Liang G, Zhou W. Investigating the effects of organic amendments on soil microbial composition and its linkage to soil organic carbon: a global meta-analysis. Sci Total Environ. 2023;894: 164899. [DOI] [PubMed] [Google Scholar]
  • 40.Liu Q, Atere CT, Zhu Z, Shahbaz M, Wei X, Pausch J, Wu J, Ge T. Vertical and horizontal shifts in the microbial community structure of paddy soil under long-term fertilization regimes. Appl Soil Ecol. 2022;169: 104248. [Google Scholar]
  • 41.Jiang H, Chen Y, Hu Y, Wang Z, Lu X. Soil bacterial communities and diversity in alpine grasslands on the Tibetan Plateau based on 16S rRNA gene sequencing. Front Ecol Evol. 2021;9: 630722. [Google Scholar]
  • 42.Bhattacharyya SS, Ros GH, Furtak K, Iqbal HM, Parra-Saldivar R. Soil carbon sequestration - an interplay between soil microbial community and soil organic matter dynamics. Sci Total Environ. 2022;815: 152928. [DOI] [PubMed] [Google Scholar]
  • 43.Shu X, He J, Zhou Z, Xia L, Hu Y, Zhang Y, Zhang Y, Luo Y, Chu H, Liu W. Organic amendments enhance soil microbial diversity, microbial functionality and crop yields: a meta-analysis. Sci Total Environ. 2022;829: 154627. [DOI] [PubMed] [Google Scholar]
  • 44.Han M, Zhang Q, Yang YQ, Tai HS, Wu JC, Sarula ZY, Li XN. Effect of straw returning years to field after deep turning back on soil bacterial community in continuous cropping corn field in the West Liaohe Plain. N Chin J Agron. 2023.38(05):148–57.
  • 45.Dinc ILC, Grenni P, Onet C, Onet A. Fertilization and soil microbial community: a review. Appl Sci. 2022;12(3):1198. [Google Scholar]
  • 46.Khmelevtsova LE, Sazykin IS, Azhogina TN, Sazykina MA. Influence of agricultural practices on bacterial community of cultivated soils. Agriculture. 2022;12(3): 371. [Google Scholar]
  • 47.Egidi E, Delgado-Baquerizo M, Plett JM, Wang J, Eldridge DJ, Bardgett RD, Maestre FT, Singh BK. A few Ascomycota taxa dominate soil fungal communities worldwide. Nat Commun. 2019;10(1):2369. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Luo D, Cheng R-M, Liu S, Shi Z-M, Feng Q-H. Responses of soil microbial community composition and enzyme activities to land-use change in the Eastern Tibetan Plateau. China Forests. 2020;11(5):483. [Google Scholar]
  • 49.Bhattacharyya SS, Ros GH, Furtak K, Iqbal HM, Parra-Saldívar R. Soil carbon sequestration–an interplay between soil microbial community and soil organic matter dynamics. Sci Total Environ. 2022;815: 152928. [DOI] [PubMed] [Google Scholar]
  • 50.Chen X, Henriksen TM, Svensson K, Korsaeth A. Long-term effects of agricultural production systems on structure and function of the soil microbial community. Appl Soil Ecol. 2020;147: 103387. [Google Scholar]
  • 51.Mahanta D, Bhattacharyya R, Mishra PK, Gopinath KA, Channakeshavaih C, Krishnan J, Raja A, Tuti MD, Varghese E, Pandey BM. Influence of a six-year organic and inorganic fertilization on the diversity of the soil culturable microrgansims in the Indian mid-Himalayas. Appl Soil Ecol. 2017;120:229–38. [Google Scholar]
  • 52.Lin Y, Ye G, Kuzyakov Y, Liu D, Fan J, Ding W. Long-term manure application increases soil organic matter and aggregation, and alters microbial community structure and keystone taxa. Soil Biol Biochem. 2019;134:187–96. [Google Scholar]
  • 53.Sun Y, Chen L, Zhang S, Miao Y, Zhang Y, Li Z, Zhao J, Yu L, Zhang J, Qin X. Plant interaction patterns shape the soil microbial community and nutrient cycling in different intercropping scenarios of aromatic plant species. Front Microbiol. 2022;13: 888789. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Tedersoo L, Bahram M, Polme S, Koljalg U, Yorou NS, Wijesundera R, Ruiz LV, Vasco-Palacios AM, Thu PQ, Suija A. Global diversity and geography of soil fungi. Science. 2014;346(6213):1256688. [DOI] [PubMed] [Google Scholar]
  • 55.Zhang X, Li Q, Zhong Z, Huang Z, Bian F, Yang C, Wen X. Changes in soil organic carbon fractions and fungal communities, subsequent to different management practices in Moso bamboo plantations. Journal of Fungi. 2022;8(6): 640. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Fu H, Guo M, Shan X, Zhang X, Sun Z, Liu Y, Li T. 13 cycles of consecutive tomato monoculture cropping alter soil chemical properties and soil fungal community in solar greenhouse. Horticulturae. 2023;9(4): 505. [Google Scholar]
  • 57.Yin Y, Yuan Y, Zhang X, Huhe CY, Borjigin S. Comparison of the responses of soil fungal community to straw, inorganic fertilizer, and compost in a farmland in the Loess Plateau. Microbiology Spectrum. 2022;10(1):e02230–e02221. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Zhang Z, Shi Z, Yang J, Hao B, Hao L, Diao F, Wang L, Bao Z, Guo W. A new strategy for evaluating the improvement effectiveness of degraded soil based on the synergy and diversity of microbial ecological function. Ecol Ind. 2021;120: 106917. [Google Scholar]
  • 59.Dincă LC, Grenni P, Onet C, Onet A. Fertilization and soil microbial community: a review. Appl Sci. 2022;12(3):1198. [Google Scholar]
  • 60.Molefe RR, Amoo AE, Babalola OO. Communication between plant roots and the soil microbiome; involvement in plant growth and development. Symbiosis. 2023;90(3):231–9. [Google Scholar]
  • 61.Zainuddin N, Keni MF, Ibrahim SAS, Masri MMM. Effect of integrated biofertilizers with chemical fertilizers on the oil palm growth and soil microbial diversity. Biocatal Agric Biotechnol. 2022;39: 102237. [Google Scholar]
  • 62.Agegnehu G, Srivastava AK, Bird MI. The role of biochar and biochar-compost in improving soil quality and crop performance: a review. Appl Soil Ecol. 2017;119:156–70. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material 1. (118.2MB, zip)
Supplementary Material 2. (131.4MB, zip)

Data Availability Statement

We have deposited the data into the NCBI database with the accession number PRJNA1215788.


Articles from BMC Microbiology are provided here courtesy of BMC

RESOURCES