Skip to main content
Nucleic Acids Research logoLink to Nucleic Acids Research
. 2025 Apr 15;53(7):gkaf306. doi: 10.1093/nar/gkaf306

High-resolution mapping of sigma factor DNA-binding sequences using artificial promoters, RNA aptamers, and deep sequencing

Essa Ahsan Khan 1, Christian Rückert-Reed 2,3, Gurvinder Singh Dahiya 4, Lisa Tietze 5, Maxime Fages-Lartaud 6, Tobias Busche 7,8, Jörn Kalinowski 9, Victoria Shingler 10, Rahmi Lale 11,12,
PMCID: PMC11997794  PMID: 40239990

Abstract

The variable sigma (σ) subunit of the bacterial RNA polymerase holoenzyme determines promoter specificity and facilitates open complex formation during transcription initiation. Understanding σ-factor binding sequences is therefore crucial for deciphering bacterial gene regulation. Here, we present a data-driven high-throughput approach that utilizes an extensive library of 1.54 million DNA templates providing artificial promoters and 5′ untranslated region sequences for σ-factor DNA-binding motif discovery. This method combines the generation of extensive DNA libraries, in vitro transcription, RNA aptamer, and deep DNA and RNA sequencing. It allows direct assessment of promoter activity, identification of transcription start sites, and quantification of promoter strength based on mRNA production levels. We applied this approach to map σ54 DNA-binding sequences in Pseudomonas putida. Deep sequencing of the enriched RNA pool revealed 64 966 distinct σ54 binding motifs, significantly expanding the known repertoire. This data-driven approach surpasses traditional methods by directly evaluating promoter function and avoiding selection bias based solely on binding affinity. This comprehensive dataset enhances our understanding of σ-factor binding sequences and their regulatory roles, opening avenues for new research in biology and biotechnology.

Graphical Abstract

Graphical Abstract.

Graphical Abstract

Introduction

Determining sigma (σ)-factor binding sequences is critical for deciphering bacterial gene regulation. Despite the rapid expansion of sequenced genomes, our knowledge of how genes are regulated at the primary DNA sequence level lags behind. Even in well-studied model organisms like Escherichia coli, the regulation of over half the genes remains unclear [1]. This lack of understanding extends to other organisms, highlighting the need for a genome-wide approach to comprehend promoter regulation across all domains of life.

Transcription initiation, the first step of gene expression, is tightly controlled by σ-factors. In bacteria, RNA polymerase (RNAP) relies on σ-factors to recognize specific promoter sequences and initiate transcription. Different σ-factors exhibit distinct binding preferences, allowing bacteria to fine-tune gene expression in response to environmental cues [2, 3]. However, comprehensive identification of σ-factor binding sequences remains a challenge. This knowledge gap hinders our ability to accurately predict and annotate promoter sequences, ultimately limiting our understanding of bacterial transcriptional regulation.

While traditional methods like DNA footprinting, electrophoretic mobility shift assays, chromatin immunoprecipitation coupled with next-generation sequencing (NGS), and systematic evolution of ligands by exponential enrichment (SELEX) have provided valuable insights into σ-factor binding preferences, they have limitations hindering comprehensive identification [4–7]. These methods either rely solely on binding affinity or lack the resolution to specifically target σ-factor binding sequences within promoters. Additionally, pre-defined sequence libraries in protein-binding microarrays might miss important motifs, and SELEX prioritizes high-affinity binding, which might not be ideal for σ-factors where weak interactions still play an important biological role.

Our data-driven approach presented in this study overcomes many of these limitations by combining a comprehensive library of artificial promoters and the strengths of in vitro transcription (IVT) assays. This approach offers several key advantages. Primarily, we do a direct assessment of promoter activity through IVT reactions rather than relying solely on binding affinity. Additionally, by analyzing the enriched RNA pool, we pinpoint σ-factor binding sequences that initiate actual transcription, thus identifying functional binding sequences. Moreover, the use of an extensive DNA library and deep sequencing facilitates the discovery of a broad spectrum of σ-factor binding motifs, complete with quantitative data. This comprehensive data enables us to establish a genotype-phenotype linkage. Another significant benefit is the breadth of the data span. While identifying functional sequences, our approach also produces a substantial volume of nonfunctional DNA sequences. These nonfunctional sequences provide a crucial negative dataset for model training, which is essential for developing transcriptional models using machine learning. By incorporating both functional and nonfunctional sequences, we provide data allowing the machine learning models to distinguish between active and inactive promoter regions, ultimately improving their effectiveness in “understanding” transcriptional regulation.

To showcase the effectiveness of this approach, we applied it to the Gram-negative bacterium Pseudomonas putida. The experimental efforts reported in this study led to identification of 64 966 distinct σ54 DNA-binding sequences, significantly expanding the known repertoire of DNA-binding motifs for this particular σ-factor. This high-resolution data offers a multifaceted advantage. It not only deepens our understanding of σ54-dependent promoters in P. putida, but also lays the groundwork for developing powerful tools in synthetic biology, among others for rational engineering of promoters, training machine learning models for promoter prediction. Overall, this comprehensive and data-driven approach surpasses traditional techniques for identifying σ-factor binding sequences, paving the way for a deeper understanding of bacterial gene regulation.

Materials and methods

Strains and growth conditions

Escherichia coli DH5α was cultivated in lysogeny broth (LB) medium containing 50 mg/l kanamycin for library plasmids (pHH100-dBroccoli vector).

Composition of the single-stranded random nucleotide oligo

To create the extensive promoter DNA libraries, a 200 nt long stretch of single-stranded Random Nucleotide Oligomers (ss-RaNuqO) was procured from Integrated DNA Technologies (IDT), Inc. (Belgium) in the form of a four nanomole ultramer. The ss-RaNuqOs are equipped with adapters on both ends. Adapter1 carries the BioBrick Prefix, while Adapter2 contains the BioBrick Suffix sequences. Each adapter also incorporates a Type IIS restriction enzyme recognition sequence for BsaI [5′-GGTCTC(N1)/(N5)-3′], accompanied by overhang sequences TGCC in Adapter1 and TACC in Adapter2. These adapters also provide the complementary DNA strand for primers to make double-stranded random nucleotide DNA through polymerase chain reaction (PCR). For further details please see open access publication Lale et al. [8].

Generation and cloning of double-stranded 200 nt long 5′ artificial regulatory sequences (ARES)

To create the double-stranded random nucleotide insert, a 12-cycle PCR was employed, utilizing the ss-RaNuqO as the DNA template and the BBa-Prefix-F and BBa-Suffix-R as primers (Supplementary Table S1). The selection of a limited number of cycles was deliberate, to avoid the potential PCR amplification bias that could otherwise result in reduced sequence diversity.

The double-stranded 200 nt long insert was cloned upstream of the dBroccoli aptamer in the pHH100 vector using Golden Gate cloning. The dBroccoli aptamer was initially extracted from the plasmid pTRA51hd [9] using the BB1-F and BB1-R primers, which include overhangs for Gibson assembly into the pHH100 backbone. The amplified aptamer was subsequently cloned into the pHH100 backbone, which had been pre-amplified with the BB2-F and BB2-R primers. This cloning process was carried out using the Gibson assembly method with the NEBuilder HiFi DNA Assembly Master Mix. The pHH100-dBroccoli backbone was initially amplified with the BB3-F and BB3-R primer sets, which incorporated a Type IIS restriction enzyme recognition sequence for BsaI. This sequence was accompanied by overhang sequences ACGG and ATGG, which are complementary to TGCC in Adapter1 and TACC in Adapter2 of the artificial promoters, respectively. The plasmid DNA library was transformed into E. coli through a heat shock procedure. The library consisted of ∼106 clones. Colonies were scooped from LB agar plates and ARES plasmid library was isolated following the QIAprep Spin Miniprep Kit (Qiagen) protocol.

Phenol-Chloroform purification of the plasmid DNA library

The Miniprep DNA was purified using the Phenol-Chloroform purification protocol. To begin, a one-volume mixture of phenol, chloroform, and isoamyl alcohol (25:24:1) was added to the sample. This mixture was vortexed for 20 s and then centrifuged at room temperature for 5 min. The upper aqueous phase was extracted and transferred to a new tube, ensuring no phenol contamination. The DNA in the aqueous phase was precipitated at –20 °C overnight by adding glycogen (20 μg), ammonium acetate (3.75 M), and 100% ethanol (2.5 times the combined volume of both the sample and ammonium acetate) in the specified order. After precipitation, the sample was centrifuged to pellet the DNA, the supernatant was removed, and two ethanol (70%) washes were performed. Ethanol was thoroughly removed, and the purified DNA was resuspended in nuclease-free water for IVT assays.

IVT with P. putida σ54–RNAP

The proteins required for IVT assays were generously provided by the laboratory of Victoria Shingler at Umeå University. Each protein was purified using established protocols to ensure high quality and functionality. In brief, the core RNAP from P. putida KT2440 was purified using a method originally developed for its E. coli counterpart [10]. The native σ54 protein, essential for σ54-dependent transcription, was obtained following overexpression in E. coli and subsequent purification using a standard protocol [11]. Finally, the constitutively active variant of DmpR (ΔA2-DmpR-His) was purified via immobilized metal affinity chromatography [12].

The IVT assays were conducted at 30 °C in an acetate buffer (AcB) with a composition of 35 mM Tris-acetate (pH 7.9), 70 mM potassium acetate, 20 mM ammonium acetate, 5 mM magnesium acetate, 1 mM dithiothreitol (DTT), and 0.275 mg/ml bovine serum albumin. These assays employed 3 mM ATP and 15 nM supercoiled ARES library plasmid, following established protocols. The final reaction mixture also included P. putida core RNAP (80 nM), σ54 (400 nM), and ΔA2-DmpR (400 nM). Prior to the addition of ATP and the DNA template, the core RNAP and σ54 were pre-incubated for 5 min at 30 °C to facilitate holoenzyme formation. Subsequently, the reaction was incubated with the DNA template and ΔA2-DmpR for an additional 20 min to allow closed-complex formation. Transcription was initiated by introducing NTPs, with final concentrations of 360 nM each for GTP, CTP, ATP, and UTP. Heparin (0.1 mg/ml) was used to prevent re-initiation. To terminate the reaction, 5 μl of a stop load mix [comprising 150 mM EDTA, 1 M NaCl, 14 M urea, 3% glycerol, 0.075% (w/v) xylene cyanol, and 0.075% (w/v) bromophenol blue] was added. Finally, dBroccoli fluorescence was quantified using a Tecan Infinite M1000 Pro Plate Reader.

An IVT assay was also conducted to validate the ARES of a library that generated transcripts containing a promoter sequence for P. putida σ54. Following the sequencing analysis of both the ARES DNA template and IVT-generated transcripts, 18 candidates were selected, named p1–p18 (Supplementary Table S2). The complete 200 nt sequence was cloned upstream of the Mango III aptamer within the pSEVA2311 plasmid, utilizing Golden Gate cloning. Comprehensive details on the primers used for this cloning process, designated as p1–p18 for both the fragment (Frag) and the backbone (BB), can be found in the supplementary section, Supplementary Table S1. Before this, the Mango III aptamer, synthesized by Twist Bioscience, was amplified using the Lib1-F and Lib2-R primers. This amplified aptamer was then cloned into the pSEVA2311 backbone, which had been previously amplified with the Lib3-F and Lib4-R primers, through the Gibson assembly process, employing the NEBuilder HiFi DNA Assembly Master Mix. Successful assembly of the Mango-pSEVA2311 constructs was confirmed through colony PCR with the Lib7-F and Lib8-R primers. To ensure high-quality templates for the IVT reaction, the resulting constructs were purified using a phenol-chloroform extraction method, and subsequently used for the IVT reaction as previously described.

Purification of in vitro transcribed RNA

Plasmid DNA was eliminated from the RNA samples using the Turbo DNAse Kit (Invitrogen). Two successive 15 min DNAse (2 units) treatments were conducted immediately after transcription. Following the second treatment, RNA purification was carried out according to Monarch RNA Cleanup Kit protocol (New England Biolabs), and quantification was performed using Nanodrop (Thermo Fisher).

Sequencing of ARES plasmid library

DNA sequencing was done by creating a custom sequencing library by first amplifying the 200N stretch with the SeqDNA forward primer and the SeqDNA reverse primer using Phusion DNA polymerase (New England Biolabs) for 15 cycles, followed by 10 cycles PCR using again Phusion DNA polymerase and TruSeq index primers. Sequencing was performed using two different sequencing technologies. On the one hand, a MiSeq sequencing platform (Illumina) with a 600 cycle MiSeq Reagent Kit v3 (Illumina) was used to generate 2× 300 nt paired end reads. The Illumina reads were trimmed using cutadapt [13] to trim the 3′-ends with option -a ATGGACGAGC for the R1 reads and -a GGCATCCGAC for the R2 reads, followed by joining of the forward and reverse reads using FLASH [14] with parameters -m 50 -M 295. After read joining, the 200N stretch as well as 10 nt up- and downstream were extracted using cutadapt run with parameters –discard-untrimmed, -a GGCATCCGAC...ATGGACGAGC, and –action retain. On the other hand, the GridION sequencing platform [Oxford Nanopore Technologies (ONT)] was used to sequence a LSK109 library on an R9.4.1 flowcell and the PromethION platform to run a LSK112 library on an R9.4.1 flowcell. Afterwards, the read data was filtered using fastp [15] to remove reads shorter than 250 nt, longer than 600 nt, or with a quality below 5. The remaining reads were trimmed using two chained cutadapt runs with parameters –discard-untrimmed, -g GGCATCCGAC, and –action retain respectively –discard-untrimmed, -a ATGGACGAGC, and –action retain to extract the 200N stretch as well as 10 nt up- and downstream.

All data sets were then de-replicated individually using vsearch [16] in mode --derep_fulllength with the parameters --sizeout. Afterwards, the resulting files were combined, dereplicated again (parameters: --sizeout --sizein), and finally clustered and merged into ARES consensus sequences via --cluster_size with parameters --sizeout --sizein --id 0.90 --clusterout_sort --minseqlength 120. The consensus sequences were finally renamed consecutively based on read abundance.

All ARES consensus sequences without the leading and trailing 10 nt of the vector are available via BioProject PRJNA1054479, SRA accession SRR27486701.

Sequencing of in vitro transcribed RNA

For RNA sequencing, the following protocol was performed: First, the RNA was capped using the RNA capping reagents and protocol M2080 from New England Biolabs. Second, reverse transcription and template switching with resulting capped RNA was done using two biotinylated oligos (CCGACCGTCTCAGATGGACC and ACTCGACATCTGAGCCCAC) with the Template Switching RT Enzyme Mix M0466 (New England Biolabs) and the DNA–RNA TS-oligomer CCCTACACGACGCTCTTCCGATCGArGrG+G (IDT). Third, after first strand synthesis, the RNA–DNA hybrid was first purified using the QIAGEN MinElute kit according to the manufacturer’s instructions with an elution volume of 25 μl, followed by coupling to 25 μl M280 streptavidin-coated magnetic beads (Invitrogen) prepared according to the manufacturer’s protocol. The beads were then washed twice with 100 μl 0.1 M NaOH (1 min incubation), twice with 200 μl 1× binding and wash buffer, twice with 200 μl water and finally resuspended in 25 μl water. Fourth, 10 μl bead suspension were used for complementary DNA (cDNA) amplification using the SeqRNA forward primer and the SeqRNA1 reverse primer and SeqRNA2 reverse primer. Finally, the PCR product was used in conjunction with the SQK-LSK114 library kit (ONT) to prepare a sequencing library that was run on a PromethION R10.4.1 flowcell.

Mapping of transcribed RNA with ARES plasmid library

The reads were preprocessed using cutadapt with parameters –discard-untrimmed and -g CCCTACACGACGCTCTTCCGATCGAGGG to remove the TSO sequence. For mapping to the ARES consensus sequences minimap2 was used with parameters -a -x map-ont --secondary=no --sam-hit-only. The results were filtered to remove hits not mapping in forward direction and those mapping starting in the vector sequence. Together with the FASTA file containing the ARES sequences, the filtered read data were then used as input for a custom Perl script (markTSS.pl) to identify each position with at least three mapped reads.

Data handling and analysis of promoter motifs in the ARES of the library

Data analysis was conducted using Python, leveraging various libraries such as BioPython, Pandas, and NumPy for efficient processing, manipulation, and bioinformatics-specific tasks. The function fasta_to_dataframe of biopython library serves as a useful tool for converting bioinformatics data in FASTA format into a structured tabular form for further analysis and manipulation using Pandas. This function extracted metadata from sequence identifiers, including centroids, sequences, sizes, positions, and mapping statuses, and compiled them into a Pandas DataFrame.

The to_parquet function of Pandas enables the storage of DataFrames in the efficient Parquet format. This columnar storage file format is specifically designed for optimal performance within big data processing frameworks. Another function, pd.read_parquet, excels in efficiently reading data stored in the Parquet file format.

BioProspector, a C program, was utilized to analyze the upstream region of transcription start site (TSS) in the ARES of a library, searching for promoter sequence motifs. BioProspector employs background models, ranging from zero to third-order Markov models, with parameters that are customizable by the user or can be estimated from a specified sequence file [17]. We have used the negative dataset—composed of nonfunctional sequences—to create a background profile, which BioProspector uses to generate probability distributions of A, C, T, and G characters in the given dataset. In the present study, the parameters were taken from experimentally verified σ54 promoters in various species of Pseudomonas [18]. The significance of identified motifs is evaluated through a motif score distribution, determined using a Monte Carlo method [17].

The parsing of motifs involved identifying blocks and patterns within the sequence data, achieved through a custom parsing function. This function interpreted lines from input files to extract relevant information about positions, blocks, and consensus sequences. The parsed motifs were then converted into comprehensive DataFrames, which provided detailed overviews of the motifs, including their positions, consensus sequences, and degeneracies.

Sequence logos were generated using the seqlogo library to visualize motif patterns, while additional visualizations were created using Matplotlib to represent data distributions and relationships effectively.

Results

Construction of an extensive plasmid DNA library with diverse regulatory sequences

A critical component of our approach is the generation of extensive DNA libraries containing diverse 5′ regulatory sequences. Here, we employed our previously developed Gene Expression Engineering (GeneEE) platform for the creation of artificial 5′ regulatory sequences (ARES), containing both promoter and 5′ untranslated regions (UTR) [8]. GeneEE has been successfully utilized to generate functional ARES in vivo in various bacterial species including Corynebacterium glutamicum, E. coli, P. putida, Streptomyces albus, S. lividans, Thermus thermophilus, Vibrio natriegens, and even Baker’s yeast [8, 19]. This platform allows for the generation of highly diverse 200 nt long random DNA sequences serving as promoter and 5′-UTRs, exceeding the total number and natural sequence variations observed in genomes for these regulatory elements.

The 200 nt long insert with the random DNA composition was cloned upstream of the RNA aptamer dBroccoli serving as a transcription reporter vector (see supplementary for plasmid maps). The RNA aptamer dBroccoli has the ability to bind tightly to a specific fluorogenic ligand [(Z)-4-(3,5-difluoro-4-hydroxybenzylidene)-1,2-dimethyl-1H-imidazol-5(4H)-one, DFHBI] that facilitates accurate and sensitive RNA detection, an essential feature in transcription analysis [20]. This aptamer is useful for the real-time observation of RNA synthesis and processing because its fluorescence upon ligand binding provides direct visualization of RNA molecules during transcription.

For efficient assembly of the plasmid library, we employed Golden Gate cloning [21] (Fig. 1A). To achieve a large library size, we performed multiple parallel transformations into chemically competent E. coli DH5α cells (Fig. 1B). Following library construction, we confirmed the presence and correct size of the inserted DNA fragments using colony PCR on a few randomly selected colonies with the primer pair GG-Col-F and GG-Col-R (for primer sequences please see Supplementary Table S1 and Fig. 1C) and Sanger sequencing (Fig. 1D).

Figure 1.

Figure 1.

The schematic representation of the ARES plasmid DNA library construction. Golden Gate cloning using the Type IIS restriction enzyme, BsaI, to insert a 200 nt long ARES fragment into the backbone of a target vector (A). Multiple transformations of E. coli DH5α cells with a mixture of Golden Gate assembly reactions to achieve maximum diversity of ARES plasmid library (B). Agarose gel electrophoresis of the colony PCR-amplified product confirms the successful cloning of a 200 nt long ARES fragment in the plasmid backbone (C). Sanger DNA sequencing is further employed to confirm the successful cloning (D).

DNA sequencing

To identify the DNA template sequences within the extensive ARES plasmid DNA library, we employed NGS platforms from Illumina and ONT. Illumina MiSeq sequencing yielded a total of 15.8 million paired-end reads across two runs. Following quality filtering and dereplication using FLASH [14], we retained 13.8 million high-quality reads for further analysis. ONT sequencing with GridION and PromethION flowcells provided an additional 11.4 million reads. After dereplication across all four runs, a total of 6.4 million unique reads were obtained. Read abundance ranged from 1 to 109 425, with an average of 3.2 reads per sequence.

Clustering these unique sequences with vsearch [16] at a 90% similarity threshold identified 1.54 million unique ARES sequences. Notably, 587 082 of these sequences were supported by at least three independent reads. Utilizing GeneEE, we constructed plasmid DNA libraries harboring ∼1.54 million unique DNA templates.

IVT assays

The ARES plasmid DNA library served as templates in IVT reactions (Fig. 2). These reactions utilized the core RNAP and σ54 factor separately purified from P. putida, along with the activator ΔA2-DmpR following published protocols [22]. ΔA2-DmpR is a modified variant of the DmpR transcription regulator that lacks its regulatory A domain, rendering it independent of specific phenolic activation signal and thus constitutively capable of promoting transcription from the σ54-dependent PO promoter it natively controls [23]. The DNA-binding domain of DmpR mediates high affinity to upstream activator sequences (UAS) located between –127 and –172 within the PO promoter region. While the interaction between DmpR and core promoter elements is essential for initiating transcription, we used ΔA2-DmpR for its ability to promote transcription by σ54–RNAP in the absence of specific DNA-binding sites [22], which enabled unbiased analysis of σ54-dependent promoter activity across our library. A control experiment clearly demonstrated that RNA synthesis does not occur in the absence of ΔA2-DmpR, highlighting its crucial role in transcription initiation (Supplementary Fig. S1). After performing IVT-reactions, the resulting RNA was purified and sequenced for further analysis.

Figure 2.

Figure 2.

A schematic overview of the study. A random DNA plasmid library, containing ARESs to drive the expression of the RNA aptamer dBroccoli in relation to σ54–RNAP, was used during IVT assays. The generated RNA was isolated, sequenced, and mapped to the sequenced ARESs using 5′-UTR. In silico platforms were employed to identify P. putida σ54-associated promoter motifs. TSS, transcription start site

RNA sequencing analysis

Deep sequencing of the 5′-enriched cDNA library generated from the in vitro-transcribed RNA yielded over 10 million reads. Following adapter trimming and alignment of these reads to the ARES sequences using BLASTn [24], we identified over 2.7 million high-quality alignments corresponding to the template DNA. Filtering for reads mapped in the forward orientation and located within the defined ARES boundaries resulted in a set of 2.6 million valid alignments. These alignments identified a total of 152 992 potential TSS. To enhance confidence, we applied a threshold of at least three reads mapping to a single position, resulting in a final set of 71 952 high-confidence TSS.

Mapping RNA transcripts to DNA library

To identify the σ54 DNA-binding sequences within ARES, we mapped the RNA transcripts back to their corresponding DNA templates. This process relied on the 5′-UTR sequence present in the transcribed RNA (Fig. 2). By utilizing our knowledge of the DNA sequences of the RNA aptamer dBroccoli, the ARES—harboring the 5′-UTR obtained from RNA sequencing—we were able to accurately link the 5′-UTR sequences in the RNA transcripts to their originating DNA templates within the ARES library.

Although the cloning process initially used 200 nt single-stranded DNA sequences, DNA sequencing revealed that the ARES in the library range in size from 50 to ∼250 nt, with the majority (around 0.8 million sequences) being 200 nt in length (Fig. 3A). The size variation observed in the ARES library, with sequences shorter or longer than the expected 200 nt, likely results from cloning artifacts and variability during oligonucleotide synthesis (shorter sequences) and improper ligation during cloning (longer sequences). In total, 48 916 unique DNA templates were found to produce transcripts that could be mapped back to the ARES in the library.

Figure 3.

Figure 3.

Overview of ARES Library and Transcript Mapping. (A) Size distribution of ARES in the library. (B) Distribution of TSS along the whole length of ARES.

Some of the TSS were mapped to the very beginning of the ARES region, suggesting that certain sequences in the plasmid backbone may also function as weak promoters, allowing the σ54 transcriptional machinery to initiate transcription. The distribution of TSS along the entire length of the ARES is shown in Fig. 3B. The σ54–RNAP recognizes promoters with conserved regions at positions −12 and −24 relative to the TSS [25]. Given their upstream location relative to the TSS, we established a threshold to include only those ARES where transcripts begin mapping at position 40 or beyond. After applying this threshold, 64 966 TSS were shortlisted. The distribution of these TSS, starting at or beyond position 40, is illustrated in Fig. 3B.

Identification of P. putida σ54-binding motifs

To identify the motifs in the 40 base pair (bp) region upstream of TSS in the ARES library, we used the Gibbs sampling algorithm BioProspector [17]. Our search focused on two motif regions at positions −12 and −24, each with a width of 6 bp, separated by a spacer ranging from 6 to 15 bp. These parameters were based on experimentally verified σ54 promoters in various species of Pseudomonas [18].

The motif search was conducted on 48 916 unique DNA templates with 64 966 identified TSSs. This discrepancy arises because some ARES harbor multiple TSS. Several motifs were identified at both the −12 and −24 positions. While the exact positions of these two motifs are not strictly defined and their distance from the TSS vary, we still refer to them as the −12 and −24 positions, following the established naming convention. In the 40 bp stretch across all 64 966 templates, motifs were distributed as expected: the −12 motif was located from −26 to −5, peaking specifically at positions −16 to −14, whereas the −24 motif spanned from position −39 to −17, with a predominant presence from positions −29 to −26 (Fig. 4A). For instance, in E. coli σ54 promoters, the average distance from the center of the −12 box to the TSS is 7 nt, although this distance can vary from 1 to 12 nt [26]. The spacer length between the two promoter boxes also varies, ranging from 15 to 21 nt for a wide selection of σ70 endogenous promoters, but extending up to 23 nt in synthetically designed promoters [27].

Figure 4.

Figure 4.

Comprehensive analysis of σ54 promoter motifs in P. putida. (A) Distribution of motifs in a 40-bp stretch of ARES mapped with RNA. (BE) Sequence logos representing the refined σ54-specific −12 and −24 promoter motifs, derived from an extensive analysis of 64 966 unique DNA templates. (F) Frequency analysis of nucleotide occurrences at the σ54 TSS in P. putida. (G) Graphical representation of the RNA read distribution across the ARES in the library. (H) Distribution of motifs in a 40-bp stretch in the most highly transcribed ARES (top 15%) within the library. (I, J) Two pair of −12 and −24 motifs identified in the high-expressing group. (K) Frequency of nucleotides at their TSS.

BioProspector analysis identified combinations of both −12 and −24 consensus sequences. At the −12 position, two consensus sequences (TTGAAT and TTGCAT) were identified, while at −24, two consensus sequences (TTGGTA and TTGGCA) were observed (Fig. 4BE). In total, four pairs of these motifs were identified: TTGGTA/TTGAAT, TTGGTA/TTGCAT, TTGGCA/TTGAAT, and TTGGTA/TTGAAT (Fig. 4BE). Although the first and last motif combination pairs share identical sequences, they are differentiated by the probability distributions of nucleotide occurrences at specific positions within the motifs.

The RNA sequencing performed in this study also yielded quantitative data, including the count of RNA reads mapped to each ARES in the library. Fig. 4G depicts how RNA reads are distributed across the shortlisted 64 966 unique DNA templates. The top 15% of ARES, comprising 9451 sequences with high RNA read counts ranging from 45 to 11 469, were analysed using BioProspector to detect conserved motifs within the 40 bp region upstream of the TSS. Similarly, the motifs were predominantly located around the −12 and −24 positions (Fig. 4H) for this dataset as well. However, unlike the broader search across all 64 966 templates, this targeted analysis on ARES leading to high levels of transcripts distinctly highlighted the two promoter boxes at their respective positions. At the −12 position, the consensus sequence (TTGCAT) was exclusively identified. At the −24 position, two consensus sequences (TTTGGT and TTGGCA) were noted. In conclusion, two motif pairs were distinguished: TTGGCA/TTGCAT and TTTGGT/TTGCAT (Fig. 4I and J).

To evaluate the effect of window size on motif identification, we extended our analysis to 97 bp upstream of the TSS. While this broader search captured additional motifs, the peak occurrence of the −24 motif remained unchanged. The extended window also resulted in the identification of noncanonical sequences and a reduction in unique DNA templates, indicating increased background noise. Given the well-established relevance of the 40 bp upstream region for σ54-dependent promoters, we maintain this window as the most informative range for identifying functional motifs. Additional figures (see Supplementary section: Expanding the Motif Search Window) illustrate motif distribution and occurrence trends across the 97 bp window.

To explore the relationship between motif positioning and transcriptional strength, we conducted statistical analyses assessing the influence of motif distances on the expression levels. Linear regression and Spearman correlation analyses were applied to evaluate potential dependencies (see Supplementary section for further details). Across all motifs, R2 values were negligible, and Spearman correlation coefficients were weak, indicating that motif distances (−12 to −24) and their proximity to the TSS do not meaningfully impact transcriptional strength. Although statistical significance was detected due to the large dataset, the effect sizes were too small to hold biological relevance. These results further support the conclusion that motif positioning alone does not play a decisive role in regulating expression strength.

In addition to the presence of core promoter motifs, UASs are associated with binding to the transcriptional activator DmpR [23]. In this study, we employed ΔA2-DmpR, which can activate transcription without requiring specific UAS interaction [22, 28]. Although ΔA2-DmpR does not bind to its specific UAS within the current experiment, we also sought to explore unique sequence patterns in regions beyond the previously analysed 40 bp segment for core promoter motifs. We performed a motif search for the occurrence of a single conserved motif within a 97 bp region upstream of the TSS in the ARES library, for motifs ranging from 6 to 11 nt in length. For the top 15% of ARES, composed of 5767 sequences (the increase in the upstream sequence length from 40 to 97 nt reduced the number of templates from 9451 to 5767), known for high transcript expression in vitro, our search for a 6 bp motif identified the consensus sequence (TTGCAT) previously noted at the −12 position in core promoter analysis, but peaking at the −17 position (Supplementary Fig. S2A). By incrementally extending these motifs by 1 nt, the motifs consistently appeared at the same location, displaying almost identical sequences with an added T nucleotide at the beginning (Supplementary Fig. S2B–F). Despite this flexibility, the software consistently identified the −12 motif and localized it at the same position, confirming that this motif is indeed prominent within this region. This approach thus provides a more comprehensive understanding of potential motifs and their locations, rather than restricting the search to specific, predefined motifs. Furthermore, an analysis within the 40 bp region upstream of the TSS among the highest expressing ARES subset reaffirmed the presence of the same motif (TTGCAT), aligning with earlier findings from core promoter studies (Supplementary Fig. S3).

In this study, we also conducted an extensive frequency analysis to assess nucleotide occurrences at the σ54 TSS in P. putida. Our analysis indicates that guanine (G) is the most frequent nucleotide, found in ∼55% of the ARES within our library, as shown in (Fig. 4F and K). This prevalence of G at the TSS is consistent with findings from previous studies on Pseudomonas species. Genes such as algC, algD, cpg2, flesR, oprE, and xylS, which are all regulated by σ54, typically show a high occurrence of G at the TSS. Further comparative analyses of σ54-dependent promoter sequences across various bacterial species also consistently identify G as the dominant nucleotide at the TSS [25].

IVT-based validation of transcript-producing ARES

To validate the functionality of positive ARES that showed an affinity for binding with the σ54–RNAP complex and generating transcripts, we performed IVT reactions with reconstructed plasmid DNA. For this validation experiment, eight ARES, each 200 nt long (Supplementary Table S2), were randomly selected and cloned into the Mango-pSEVA2311 plasmid. The transition from the dBroccoli to the RNA aptamer Mango III was motivated by two main factors: Firstly, the Mango III aptamer offers a superior signal-to-noise ratio [29], enhancing the quality of readouts across a wide range of promoter activities from low to high. Secondly, it is more suitable for microfluidics-based IVT reactions, which are being conducted as a part of the same project. We conducted parallel experiments using both negative and positive controls. The negative control consisted of all reaction components except the DNA template, while the positive control used the σ54-dependent PO promoter [28], which demonstrated the highest transcriptional activity, as measured by the fluorescence intensity of the RNA aptamer Mango III (Fig. 5).

Figure 5.

Figure 5.

Evaluation of transcript-producing ARES in IVT reactions. Fluorescence intensity measurements of the RNA aptamer Mango III for the first eight randomly selected ARES, performed in triplicate alongside both positive and negative controls. Data are presented as mean ± standard deviation (SD) for n= 3 technical replicates. Bars marked with asterisks (*) indicate statistically significant differences from the Negative Control.

To evaluate the statistical significance of transcript production, we conducted a statistical analysis. An analysis of variance (ANOVA) test produced an F-statistic of 738.84 (P < .0001), indicating a strong variance among the groups. Post-hoc comparisons using Tukey’s honestly significant difference test showed that all experimental conditions, including the Positive Control and various test groups (S1, S2, S3, S4, S5, S6, S7, S8), differed significantly from the Negative Control, with adjusted P-values below .001 for all comparisons. These findings are visually presented in Fig. 5, where mean values, and SDs are marked with asterisks to indicate statistically significant differences from the Negative Control.

Predicting the occurrence of IVT generated σ54–RNAP-binding motifs in the P. putida KT2440 genome

Building on the insights gained so far, we sought to explore how these findings can be applied to annotate the genome of P. putida KT2440. Our search revealed that the only online database currently annotating σ54 promoters is the BioCyc genome database collection [30]. However, within this database, the annotation for P. putida KT2440 includes only ten σ54 promoters (as seen in https://biocyc.org/gene?orgid=PPUT160488&id=G1G01-1026#REGULONBioCyc_rpoN). This limited annotation underscores the need for a more comprehensive approach to identifying σ54–RNAP-binding motifs across the genome. For this purpose, we used the Find Individual Motif Occurrences (FIMO) software [31]. We applied FIMO to search a 150 nt stretch upstream of all coding sequences (CDSs) in the P. putida KT2440 genome (Genome accession number: https://www.ncbi.nlm.nih.gov/nuccore/NC_002947.4/NC_002947.4) for σ54–RNAP-binding motifs reported in this study. This software calculates a log-likelihood ratio score for every position in a specified sequence dataset, utilizing dynamic programming techniques to convert this score into a P-value [32]. A stringent P-value threshold of .005 was set to determine the significant presence of σ54 DNA-binding motifs.

Using this criteria and considering a spacing of four to 7 nt between the −12 and −24 motifs, 68 genes were identified (Supplementary Table S3). A sub-selection of the identified genes, along with their molecular functions and the sequences of the −12 and −24 motifs located within the 150 nt stretches, is displayed in Table 1. While σ54-regulated genes in P. putida are not extensively documented [33, 34], several of the genes we identified have been reported to be regulated by σ54 in other bacterial species, such as Bacillus subtilis, Desulfovibrio vulgaris, E. coli, Paraburkholderia phumatum, Pseudomonas aeruginosa, Vibrio parahaemolyticus, and Xanthomonas oryzae [35–41].

Table 1.

Significant annotation of IVT-generated σ54–RNAP binding motifs in the upstream regions of genes involved in various biological processes

Gene Product −24 Motifs −12 Motifs References
  Flagellar assembly
flgA Flagellar basal body P-ring formation chaperone FlgA TCGGCA TTGCTT [33, 40]
flgB Flagellar basal body rod protein FlgB TTGGCA TTGCTA [33, 40]
flgF Flagellar basal-body rod protein FlgF TTGGTT TTGCTT [33, 40]
flgG Flagellar basal-body rod protein FlgG ATGGCT TTGCAA [40]
fliE Flagellar hook-basal body complex protein FliE CTGGCA TTGCTT [33]
motA Flagellar motor stator protein MotA TTGGTT TGGCAT [34]
  Metabolism
PP_2783 3-oxoacyl-ACP reductase family protein TGGGCT TGGCAT [41]
eutC Ethanolamine ammonia-lyase subunit EutC TTGGCA TTGCAT [39]
PP_1786 Glycosyltransferase ATGGCA TTGCAT [38]
PP_0859 Amidohydrolase CTGGTA GTGCTT [36]
edd Phosphogluconate dehydratase GTGGCA TTGTTT [40]
PP_2836 Fumarylacetoacetate hydrolase family protein GTGGCT TTGCAA [33]
PP_1946 Glucose 1-dehydrogenase TTGGCA TTGCAA [33]
PP_3486 Cytochrome c ATGGCT GTGCTT [40]
PP_1141 ABC transporter substrate-binding protein TGGGCT TGGCAT [40]
ppx Exopolyphosphatase ATGGCA TTGCAT [42]
PP_3778 Pyrroline-5-carboxylate reductase TTGACA TTGCTA [35]
xdhA Xanthine dehydrogenase small subunit TGGGCA GTGCAT [37]
  Transport
PP_4970 Cytochrome c GTGGCT GTGTTT [40]
ntrB Nitrogen regulation protein NR(II) GTGGTT TTGCAT [40]
  Response to stress
PP_3248 Dyp-type peroxidase TTGATA TTGCAA [38]
PP_3539 MerR family DNA-binding transcriptional regulator GTGGTT TTGAGT [40]
  Transcription regulation
PP_2952 LysR family transcriptional regulator GTGGTT TGGCAT [40]
PP_0952 RNAP σ54 AAGGCA TTGCTT [40]
  Uncharacterized
PP_1450 HlpA activation/secretion protein HlpB GTGGCT TAGCAT [40]

The σ54 complex is known to regulate the expression of flagellar genes to facilitate bacterial motility [40]. Our findings confirm that the σ54–RNAP binding motifs identified via ARES-mediated IVT prominently locate in the promoter regions of flagellar genes in P. putida KT2440 (Table 1). Furthermore, genes encoding metabolic proteins involved in various processes like nucleic acid metabolism, glucose metabolism, oxidative phosphorylation, and amino acid metabolism are regulated by the σ54–RNAP complex, aligning with the observations in other bacterial species [33, 35–38, 42]. Promoters of genes linked to transport, transcription regulation, and stress response in P. putida KT2440 also contain significant σ54–RNAP binding motifs (Table 1). The method of using FIMO software to map ARES-generated motifs sets a new standard in the predictive identification of σ-factor binding motifs within bacterial genomes, enhancing our understanding of the complex roles σ-factors play in regulating bacterial genes and metabolisms.

Discussion

Bacterial σ-factors direct RNAP to specific promoter regions, thereby directly influencing gene expression and cellular responses. The evolutionary adaptation of these nucleotide preferences demonstrates how bacteria respond to environmental pressures, resulting in a diversification of regulatory sequences and strategies across different species. In this study, we employed an ARES library and deep sequencing to map σ54 DNA-binding sequences in P. putida. This approach allowed us to systematically identify and characterize promoter motifs, providing new insights into the mechanism of bacterial transcription.

Our study identified 64 966 distinct σ54 binding motifs, significantly expanding the known repertoire of σ54-dependent promoters. The core −12 and −24 motifs identified in our dataset (TTGAAT, TTGCAT at −12 and TTGGTA, TTGGCA at −24) are highly consistent with previously characterized σ54 binding sites in other bacterial species. Previously, the σ54 regulon in the complete genome of P. putida KT2440 was identified with high confidence [33]. High-scoring σ54 promoters were found upstream of flagella-related genes, including flgB (TTGGCA/TTGCT), fliE (CTGGCA/TTGCT), and fleS (CCGGCA/TTGCT), showing similarity with the consensus sequences identified in the present study. Additionally, some ARES in our dataset contain identical motifs to those identified previously. Cellular metabolic processes, including genes associated with carbon and nitrogen metabolism, are regulated by σ54-dependent promoters [43, 44]. For instance, the top-scoring σ54 promoter with the motif CTGGCA/TTGCT was discovered upstream of glnA, which encodes for glutamine synthetase [33]. This gene serves as a paradigm in σ54-dependent transcription, and its promoter motifs are identical to those earlier described for flagella-related genes. Additionally, the same promoter motifs (YTGGCA/TTGCT) were generated upon compiling 85 experimentally verified σ54 promoter sequences [45]. The observed nucleotide preferences at the TSS, particularly the enrichment of guanine (G), align with previously reported σ54-dependent promoter sequences across various bacterial species [25].

These insights into the promoter specificity of σ-factors are invaluable, not only for understanding transcriptional regulation in bacteria but also for advancing biotechnological applications. This includes the design of synthetic promoters to optimize gene expression and the development of promoter prediction tools. Our study leveraged an extensive DNA library, encompassing over 1.54 million DNA templates, to explore σ-factor interactions across a wide array of constructs. A key outcome of this study sets the groundwork for expanding the research to include other σ-factors from diverse bacterial species enabling the generation of high-quality data that is suitable for training machine learning models for developing among others transcriptional models, promoter prediction tools and re-annotation of genomes. By including both functional and nonfunctional transcription sequences—the latter often overlooked in datasets—we enhance the training of computational models to discern functional from nonfunctional DNA sequences. Such an inclusive approach is crucial for developing more precise predictive models in computational biology, offering a deeper and more holistic understanding of the elements that govern transcriptional regulation. The versatility of this method promises to generate further high-quality data, broadening our comprehension of σ-factor dynamics across various bacterial contexts.

A variety of computational tools have been developed to predict and design promoter sequences, each with unique strengths and limitations in their scope and application. Among these, the Promoter Calculator and iProm-Sigma54 represent notable advances in promoter characterisation and prediction [46, 47]. Specifically, LaFleur et al. (2022) describe an automated approach to designing synthetic promoters, focusing on σ70-dependent systems and employing a statistical thermodynamic framework to predict transcription initiation rates [46]. This framework enables users to engineer new promoter variants with relatively predictable expression levels. However, as LaFleur et al. also note, the availability of high-quality training data and an emphasis on well-characterised σ70-dependent regions limit its utility for other σ-factors—such as σ54—and for discovering entirely new regulatory sequences. Similarly, Shujaat et al. (2023) introduce iProm-Sigma54, which applies machine learning to identify σ54-dependent promoters [47]. Their results indicate high specificity and sensitivity within the known σ54 data space, yet they also acknowledge that broader applicability is constrained by the need for sufficiently large, high-quality datasets. While their predictive model excels at classifying established σ54-regulated promoters, it is less suited to discovering new types of regulatory elements outside the training scope or integrating multiple parameters of promoter functionality. Taken together, these studies illustrate both the power and the current limitations of computational promoter design tools and underscore the need for more comprehensive datasets and models that can address broader transcriptional contexts.

As the field of genomics advances, there is a growing need to expand the capabilities of automated genome annotation tools beyond the prediction of CDSs alone. Current automated genome annotation tools predominantly focus on identifying CDSs, leaving regulatory sequences underexplored. Developing additional tools that can accurately predict and annotate these regulatory sequences is, therefore, crucial for a comprehensive understanding of genome functionality.

In this realm, our approach offers a robust solution for predicting regulatory sequences, significantly enhancing genome annotations. This integration provides a more nuanced understanding of the regulatory landscapes of bacterial genomes, paving the way for future research to explore uncharacterized regions of the genome and potentially uncover novel aspects of bacterial life. By identifying and annotating regulatory elements, we can extend our comprehension of genome functionality, opening new avenues for genetic and microbial research.

Supplementary Material

gkaf306_Supplemental_File

Acknowledgements

We thank Katharina Pflüger-Grau, PhD for providing the plasmid pTRA-51hd harboring the dBroccoli, Victor de Lorenzo, for his support and discussions.

Author contributions: E.A.K. and R.L (Conceptualization). E.A.K., C.R-R., G.S.D., L.T., M.F-L., T.B., J.K., V.S., and R.L. (Data curation and formal analysis). E.A.K., C.R-R., and R.L. (Visualisation). All authors () .

Contributor Information

Essa Ahsan Khan, Department of Biotechnology and Food Science, Faculty of Natural Sciences, Norwegian University of Science and Technology, Trondheim 7491, Norway.

Christian Rückert-Reed, Bielefeld University, Center for Biotechnology (CeBiTec), Technology Platform Genomics, Bielefeld 33615, Germany; Bielefeld University, Medical School OWL, Bielefeld 33615, Germany.

Gurvinder Singh Dahiya, Syngens AS, Trondheim 7089, Norway.

Lisa Tietze, Department of Biotechnology and Food Science, Faculty of Natural Sciences, Norwegian University of Science and Technology, Trondheim 7491, Norway.

Maxime Fages-Lartaud, Department of Biotechnology and Food Science, Faculty of Natural Sciences, Norwegian University of Science and Technology, Trondheim 7491, Norway.

Tobias Busche, Bielefeld University, Center for Biotechnology (CeBiTec), Technology Platform Genomics, Bielefeld 33615, Germany; Bielefeld University, Medical School OWL, Bielefeld 33615, Germany.

Jörn Kalinowski, Bielefeld University, Center for Biotechnology (CeBiTec), Technology Platform Genomics, Bielefeld 33615, Germany.

Victoria Shingler, Department of Molecular Biology, Umeå University, Umeå 90187, Sweden.

Rahmi Lale, Department of Biotechnology and Food Science, Faculty of Natural Sciences, Norwegian University of Science and Technology, Trondheim 7491, Norway; Syngens AS, Trondheim 7089, Norway.

Supplementary data

Supplementary data is available at NAR online.

Conflict of interest

G.S.D. and R.L. are founders of Syngens. However, the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. The remaining authors declare no competing interests.

Funding

We acknowledge the funding from the Research Council of Norway (grant no. 316129); NTNU-Biotechnology, Enabling Technologies Program (personal PhD stipend to L.T.); Faculty of Natural Sciences at NTNU (personal PhD stipend to M.F-L.).

Data availability

All the data and scripts are deposited in the git repository (https://github.com/LaleLab/Publication_Sigma54) and in Zenodo (https://doi.org/10.5281/zenodo.15115153). All ARES consensus sequences without the leading and trailing 10 nt of the vector are available via BioProject PRJNA1054479, SRA accession SRR27486701 (https://www.ncbi.nlm.nih.gov/bioproject/PRJNA1054479/).

References

  • 1. Gama-Castro  S, Jiménez-Jacinto  V, Peralta-Gil  M  et al.  RegulonDB version 9.0: high-level integration of gene regulation, coexpression, motif clustering and beyond. Nucleic Acids Res. 2016; 44:D133–43. 10.1093/nar/gkv1156. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Browning  DF, Busby  SJW  Local and global regulation of transcription initiation in bacteria. Nat Rev Microbiol. 2016; 14:638–50. 10.1038/nrmicro.2016.103. [DOI] [PubMed] [Google Scholar]
  • 3. Iyer  SC, Casas-Pastor  D, Kraus  D  et al.  Transcriptional regulation by σ-factor phosphorylation in bacteria. Nat Microbiol. 2020; 5:395–406. 10.1038/s41564-019-0648-6. [DOI] [PubMed] [Google Scholar]
  • 4. Garner  MM, Revzin  A  A gel electrophoresis method for quantifying the binding of proteins to specific DNA regions: application to components of the Escherichia coli lactose operon regulatory system. Nucleic Acids Res. 1981; 9:3047–60. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Fried  M, Crothers  DM  Equilibria and kinetics of Lac repressor-operator interactions by polyacrylamide gel electrophoresis. Nucleic Acids Res. 1981; 9:6505–25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Johnson  DS, Mortazavi  A, Myers  RM  et al.  Genome-wide mapping of in vivo protein-DNA interactions. Science. 2007; 316:1497–502. [DOI] [PubMed] [Google Scholar]
  • 7. Ishihama  A, Shimada  T, Yamazaki  Y  Transcription profile of Escherichia coli: genomic SELEX search for regulatory targets of transcription factors. Nucleic Acids Res. 2016; 44:2058–74. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Lale  R, Tietze  L, Fages-Lartaud  M  et al.  A universal approach to gene expression engineering. Synth Biol. 2022; 7:ysac017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Wagner  SG, Ziegler  M, Löwe  H  et al.  pTRA–A reporter system for monitoring the intracellular dynamics of gene expression. PLoS One. 2018; 13:e0197420. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Hager  DA, Jin  DJ, Burgess  RR  Use of Mono Q high-resolution ion-exchange chromatography to obtain highly pure and active Escherichia coli RNA polymerase. Biochemistry. 1990; 29:7890–4. 10.1021/bi00486a016. [DOI] [PubMed] [Google Scholar]
  • 11. Johansson  L. UM, Solera  D, Bernardo  L. MD  et al.  σ54-RNA polymerase controls σ70-dependent transcription from a non-overlapping divergent promoter. Mol Microbiol. 2008; 70:709–23. 10.1111/j.1365-2958.2008.06440.x. [DOI] [PubMed] [Google Scholar]
  • 12. O’Neill  E, Wikström  P, Shingler  V  An active role for a structured B-linker in effector control of the σ54-dependent regulator DmpR. EMBO J. 2001; 20:819–27. 10.1093/emboj/20.4.819. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Martin  M  Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet J. 2011; 17:10–12. 10.14806/ej.17.1.200. [DOI] [Google Scholar]
  • 14. Magoč  T, Salzberg  SL  FLASH: fast length adjustment of short reads to improve genome assemblies. Bioinformatics. 2011; 27:2957–63. 10.1093/bioinformatics/btr507. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Chen  S, Zhou  Y, Chen  Y  et al.  fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics. 2018; 34:i884–90. 10.1093/bioinformatics/bty560. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Rognes  T, Flouri  T, Nichols  B  et al.  VSEARCH: a versatile open source tool for metagenomics. PeerJ. 2016; 4:e2584. 10.7717/peerj.2584. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Liu  X, Brutlag  DL, Liu  JS  BioProspector: discovering conserved DNA motifs in upstream regulatory regions of co-expressed genes. Biocomputing 2001. 2000; Singapore: World Scientific; 127–38. [PubMed] [Google Scholar]
  • 18. Liang  Z.-Y, Lai  H.-Y, Yang  H  et al.  Pro54DB: a database for experimentally verified σ54 promoters. Bioinformatics. 2017; 33:467–9. 10.1093/bioinformatics/btw630. [DOI] [PubMed] [Google Scholar]
  • 19. Tietze  L, Mangold  A, Hoff  MW  et al.  Identification and cross-characterisation of artificial promoters and 5′-untranslated regions in Vibrio natriegens. Front Bioeng Biotechnol. 2022; 10:37. 10.3389/fbioe.2022.826142. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Filonov  GS, Moon  JD, Svensen  N  et al.  Broccoli: rapid selection of an RNA mimic of green fluorescent protein by fluorescence-based selection and directed evolution. J Am Chem Soc. 2014; 136:16299–308. 10.1021/ja508478x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Engler  C, Kandzia  R, Marillonnet  S  A one pot, one step, precision cloning method with high throughput capability. PLoS One. 2008; 3:e3647. 10.1371/journal.pone.0003647. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Johansson  LU, Solera  D, Bernardo  LM  et al.  σ54-RNA polymerase controls σ70-dependent transcription from a non-overlapping divergent promoter. Mol Microbiol. 2008; 70:709–23. 10.1111/j.1365-2958.2008.06440.x. [DOI] [PubMed] [Google Scholar]
  • 23. Sze  CC, Moore  T, Shingler  V  Growth phase-dependent transcription of the σ54-dependent Po promoter controlling the Pseudomonas-derived (methyl) phenol Dmp operon of pVI150. J Bacteriol. 1996; 178:3727–35. 10.1128/jb.178.13.3727-3735.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Sayers  EW, Bolton  EE, Brister  JR  et al.  Database resources of the national center for biotechnology information. Nucleic Acids Res. 2022; 50:D20–6. 10.1093/nar/gkab1112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Barrios  H, Valderrama  B, Morett  E  Compilation and analysis of σ54-dependent promoter sequences. Nucleic Acids Res. 1999; 27:4305–13. 10.1093/nar/27.22.4305. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Rangel-Chavez  C, Galan-Vasquez  E, Martinez-Antonio  A  Consensus architecture of promoters and transcription units in Escherichia coli: design principles for synthetic biology. Mol Biosyst. 2017; 13:665–76. 10.1039/C6MB00789A. [DOI] [PubMed] [Google Scholar]
  • 27. Klein  CA, Teufel  M, Weile  CJ  et al.  The bacterial promoter spacer modulates promoter strength and timing by length, TG-motifs and DNA supercoiling sensitivity. Sci Rep. 2021; 11:24399. 10.1038/s41598-021-03817-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Sze  CC, Laurie  AD, Shingler  V  in vivo and in vitro effects of integration host factor at the dmpr-regulated σ54-dependent po promoter. J Bacteriol. 2001; 183:2842–51. 10.1128/JB.183.9.2842-2851.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Trachman  RJ, Autour  A, Jeng  S. CY  et al.  Structure and functional reselection of the Mango-III fluorogenic RNA aptamer. Nat Chem Biol. 2019; 15:472–9. 10.1038/s41589-019-0267-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Karp  PD, Billington  R, Caspi  R  et al.  The BioCyc collection of microbial genomes and metabolic pathways. Brief Bioinform. 2019; 20:1085–93. 10.1093/bib/bbx085. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Grant  CE, Bailey  TL, Noble  WS  FIMO: scanning for occurrences of a given motif. Bioinformatics. 2011; 27:1017–8. 10.1093/bioinformatics/btr064. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Griffin  AM, Griffin  HG, Staden  R  Staden: searching for motifs in nucleic acid sequences. Methods Mol Biol. 1994; 25:93–102. 10.1385/0-89603-276-0:93. [DOI] [PubMed] [Google Scholar]
  • 33. Cases  I, Ussery  DW, De  Lorenzo V  The σ54 regulon (sigmulon) of Pseudomonas putida. Environ Microbiol. 2003; 5:1281–93. 10.1111/j.1462-2920.2003.00528.x. [DOI] [PubMed] [Google Scholar]
  • 34. Leal-Morales  A, Pulido-Sánchez  M, López-Sánchez  A  et al.  Transcriptional organization and regulation of the Pseudomonas putida flagellar system. Environ Microbiol. 2022; 24:137–57. 10.1111/1462-2920.15857. [DOI] [PubMed] [Google Scholar]
  • 35. Peng  Q, Wang  G, Liu  G  et al.  Identification of metabolism pathways directly regulated by σ54 factor in Bacillus thuringiensis. Front Microbiol. 2015; 6:407. 10.3389/fmicb.2015.00407. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Kazakov  AE, Rajeev  L, Chen  A  et al.  σ54-dependent regulome in Desulfovibrio vulgaris Hildenborough. BMC Genom. 2015; 16:919. 10.1186/s12864-015-2176-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Zhao  K, Liu  M, Burgess  RR  Promoter and regulon analysis of nitrogen assimilation factor, σ54, reveal alternative strategy for E. coli MG1655 flagellar biosynthesis. Nucleic Acids Res. 2010; 38:1273–83. 10.1093/nar/gkp1123. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Lardi  M, Liu  Y, Giudice  G  et al.  Metabolomics and transcriptomics identify multiple downstream targets of Paraburkholderia phymatumσ54 during symbiosis with Phaseolus vulgaris. Int J Mol Sci. 2018; 19:1049. 10.3390/ijms19041049. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Lundgren  BR, Sarwar  Z, Pinto  A  et al.  Ethanolamine catabolism in Pseudomonas aeruginosa PAO1 is regulated by the enhancer-binding protein EatR (PA4021) and the alternative sigma factor RpoN. J Bacteriol. 2016; 198:2318–29. 10.1128/JB.00357-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Gu  D, Zhang  Y, Wang  K  et al.  Characterization of the RpoN regulon reveals the regulation of motility, T6SS2 and metabolism in Vibrio parahaemolyticus. Front Microbiol. 2022; 13:1025960. 10.3389/fmicb.2022.1025960. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Yu  C, Chen  H, Tian  F  et al.  A ten gene-containing genomic island determines flagellin glycosylation: implication for its regulatory role in motility and virulence of Xanthomonas oryzae pv. oryzae. Mol Plant Pathol. 2018; 19:579–92. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Gallarato  LA, Sanchez  DG, Olvera  L  et al.  Exopolyphosphatase of Pseudomonas aeruginosa is essential for the production of virulence factors, and its expression is controlled by NtrC and PhoB acting at two interspaced promoters. Microbiology. 2014; 160:406–17. [DOI] [PubMed] [Google Scholar]
  • 43. Powell  BS, Court  DL, Inada  T  et al.  Novel proteins of the phosphotransferase system encoded within the RpoN operon of Escherichia coli: Enzyme IIANtr affects growth on organic nitrogen and the conditional lethality of an erats mutant. J Biol Chem. 1995; 270:4822–39. [DOI] [PubMed] [Google Scholar]
  • 44. Charbit  A  Coordination of carbon and nitrogen metabolism. Res Microbiol. 1996; 147:513–8. [DOI] [PubMed] [Google Scholar]
  • 45. Francke  C, Groot  Kormelink T, Hagemeijer  Y  et al.  Comparative analyses imply that the enigmatic σ54 is a central controller of the bacterial exterior. BMC Genom. 2011; 12:385. 10.1186/1471-2164-12-385. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. LaFleur  TL, Hossain  A, Salis  HM  Automated model-predictive design of synthetic promoters to control transcriptional profiles in bacteria. Nat Commun. 2022; 13:5159. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Shujaat  M, Kim  H, Tayara  H  et al.  iProm-Sigma54: a CNN base prediction tool for σ54 promoters. Cells. 2023; 12:829. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

gkaf306_Supplemental_File

Data Availability Statement

All the data and scripts are deposited in the git repository (https://github.com/LaleLab/Publication_Sigma54) and in Zenodo (https://doi.org/10.5281/zenodo.15115153). All ARES consensus sequences without the leading and trailing 10 nt of the vector are available via BioProject PRJNA1054479, SRA accession SRR27486701 (https://www.ncbi.nlm.nih.gov/bioproject/PRJNA1054479/).


Articles from Nucleic Acids Research are provided here courtesy of Oxford University Press

RESOURCES