TABLE 2.
Nucleotide sequence of primers used for RT-PCR amplification
| Gene | Primer | Primer location | PCR product size (bp) |
|---|---|---|---|
| Human genes | |||
| CRH-R2 (common fragment) | First pair of primers | ||
| P152: GCCATCGGCAAGCTCTACTATG (sense) | Exon 10 | ||
| P153: TCTCCATTGAAGAAGCAGTAGAAG (antisense) | Exon 15 | ||
| Nested primers | |||
| P154: CCCCATCATTCTCGTGCTCCTG (sense) | Exon 10 | ||
| P155: TGACGAAGAAGAGCATGTAGGTG (antisense) | Exon 15 | 176 | |
| CRH-R2α | First pair of primers | ||
| P333: ATGGACGCGGCACTGCTCCA (sense) | Exon 4 | ||
| P339: GGTCATACTTCCTCTGCTTGTC (antisense) | Exon 7 | ||
| Nested primers | |||
| P334: AGAGCTGCTCTTGGACGGCT (sense) | Exon 4 | ||
| P340: GTCATCCAAAATGGGCTCACAC (antisense) | Exon 7 | 253 | |
| CRH-R2β | First pair of primers | ||
| P335: ACCATCATGACCCTCACCAAC (sense) | Exon 2 | ||
| P339: GGTCATACTTCCTCTGCTTGTC (antisense) | Exon 7 | ||
| Nested primers | |||
| P336: CATGACCCTCACCAACCTCTC (sense) | Exon 2 | ||
| P340: GTCATCCAAAATGGGCTCACAC (antisense) | Exon 7 | 232 | |
| CRHBP | P354: CCTGGGACACGTAAATGGTC (sense) | Exon 3 | |
| P355: GCGCACCACAGTGTTGTCAC (antisense) | Exon 4 | 187 | |
| URC II | P573: TGTGCTCTGCTGTTGCTGATG (sense) | Exon 1 | |
| P574: GCGATAGGACAATGCGCGAG (antisense) | Exon 1 | 217 | |
| Mouse genes | |||
| CRH-R2 | P236: TGCCTGAGGAATGTGATCCACTG (sense) | Exon 4 | |
| P237: CGTGGTGGATGCTCGTAACTTCG (antisense) | Exon 6 | 462 | |
| CRH-BP | P579: TCTTACCAGAAGGAGCATCAG (sense) | Exon 5 | |
| P580: GTGTCCGAGGGTAAGATCAG (antisense) | Exon 6 | 241 | |
| URC II | P571: GTGGTGTTCGTGGTCCTGATG (sense) | Exon 1 | |
| P572: GGAACATCCAGGGAGAGTATG (antisense) | Exon 1 | 217 | |
URC, Urocortin.