Table 2. Showing the real-time qPCR oligonucleotide primers that used on qRT-PCR.
| Target gene | Gene bank ID | Primers sequence | product size(bp) |
|---|---|---|---|
| BEFD126 | XM_010993910.1 | FP:GGGAAAATGCAGGAGCATGTG | 131 |
| RP: CGGTAGTTGCCATGGTTGAG |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.