Skip to main content
NCBI home page
International Journal of Microbiology logoLink to International Journal of Microbiology
. 2025 Apr 21;2025:7818433. doi: 10.1155/ijm/7818433

Characterization and Enzymatic Potential of Bacteria and Fungi From Mwakirunge Dumpsite, Kenya

Beryle Atieno Okoth 1,✉, Huxley Mae Makonde 1, Carren Moraa Bosire 1, Cromwell Mwiti Kibiti 1
PMCID: PMC12037257  PMID: 40297764

Abstract

Accumulation of solid waste is a major global challenge. The conventional waste disposal methods are often ineffective in mitigating solid waste pollution, highlighting the need for other sustainable alternatives. This study is aimed at isolating and identifying potential waste-degrading microorganisms from Mwakirunge dumpsite in Mombasa, Kenya. A total of 16 soil samples were collected using a randomized block design. The samples were inoculated in enriched basal media containing mixed municipal solid waste and incubated at 37°C for 21 days. Microbial identification was conducted using standard morphological, biochemical, and molecular approaches. DNA was extracted using organic isolation methods, and PCR amplification of the 16S rRNA gene for bacteria and the ITS gene for fungi was performed. Phylogenetic analysis grouped bacterial isolates into phylum Bacillota (Firmicutes), Pseudomonadota (Proteobacteria), and Actinomycetota (Actinobacteria) that included members of the genera bacilli, Pseudomonas, brevibacilli, Microbacterium, Ochrobactrum, Paenibacillus, Staphylococcus, Isoptericola, and Streptomyces. Fungal isolates belonged to the genus Aspergillus within the phylum Ascomycota. Three bacterial isolates B4S2 b (MZ571886), B3S1 (MZ571907), and B3S4 B (MZ571915) and one fungal isolate B2S2 a1 (MZ569413) had low sequence similarities with their closely known taxonomic relatives. The ability of the isolates to produce lipase, esterase, cellulase, amylase, and gelatinase enzymes was tested using the agar diffusion method. The results showed a significant level of enzyme production (p < 0.05). Bacillus cereus (MZ571899) exhibited the highest esterase activity; Streptomyces thermocarboxydus (MZ571882) exhibited the highest lipase activity, Bacillus subtilis (MZ571887) exhibited the highest amylase activity, and Bacillus licheniformis (MZ571888) exhibited the highest cellulase activity, while Pseudomonas stutzeri (MZ571900) exhibited the highest gelatinase activity. We recommend further studies to characterize the isolates with low sequence percentage similarities to establish their true identities. In addition, further enzymatic studies are required to quantify, characterize, and purify these enzymes for industrial applications.

Keywords: bacteria, biodegradation, extracellular enzymes, fungi, solid wastes

1. Introduction

The menace of solid waste disposal is a widespread problem affecting both developed and developing countries [1]. Improper disposal strategies lead to environmental degradation and the proliferation of disease and generally affect livelihoods [2, 3]. In many developing countries, MSW management is an ignored part of the whole environmental management plan [4, 5]. In such countries, open dumping and open burning are still being practiced because of a lack of knowledge of the associated health risks, inadequate resources, and lack of political determination to guard and ameliorate environmental and public health [6]). Composting, waste-to-energy conversion, recycling, incineration, and landfilling are common methods of solid waste disposal. Incineration is a good method because the wastes are completely burnt down, but it can lead to the production of heavy toxic fumes of greenhouse gases like dioxins and furans [7]. Recycling provides an environmentally attractive solution. However, it is relatively ineffective and may decrease the quality of the resulting material. The process is expensive and may emit toxic compounds [8, 9]. The new products may also contain higher levels of foreign materials like colorants and additives which may alter the quality of the secondary material [10]. Landfilling is an ancient and simple method but also has limitations like land occupation and groundwater contamination [11–14].

Bioremediation is a more efficient and environmentally friendly approach that involves the use of plants, microorganisms, and their enzymes to break down environmental pollutants [15]. A variety of enzymes are produced by fungi and bacteria that can be useful in the degradation and detoxification of a wide range of wastes [16]. These enzymes include hydrolases such as lipases, proteases, DNases, pullulanases, xylanases, cellulases, amylases, phosphatases, and esterases among other enzymes [17, 18]. Hydrolases disrupt the major chemical bonds such as peptide bonds, esters, and carbon–halide bonds in pollutants, reducing them into less harmful products like water and carbon (IV) oxide [16, 19]. Microbial enzymes are useful in the degradation of environmental pollutants due to their high specificity to a wide range of substrates, tolerance to extreme conditions, high effectiveness at low concentrations of pollutants, and high mobility compared to microorganisms [20, 21]. Hydrolytic enzymes are important in the degradation of industrial wastes, plastic wastes, oil-contaminated soils, agro-based wastes, etc.

They have also found immense importance in industry, especially in the chemical, feed additive, biomedical science, and food industries [17, 22]. Different studies have investigated the ability of fungi to degrade wastes including kitchen wastes, plastic waste, and agricultural wastes among other waste materials. Some of the fungal species that have found importance in waste degradation include those from genera Aspergillus, Fusarium, Penicillium, Trichoderma, Humicola, Mucor sp., Saccharomyces, and Candida [23–27]. Some of the bacterial species that have commonly been associated with solid waste biodegradation include Pseudomonas sp., Bacillus sp., Acetobacter, Lactobacillus sp., Streptococcus sp., Staphylococcus sp., and Actinobacteria. Members belonging to Actinobacteria genera that have been demonstrated to play a role in waste biodegradation include Micrococcus, Thermobifida, Streptomyces, Amycolatopsis, Thermobispora, Planomonospora, Cellulosimicrobium, Saccharopolyspora, Microbispora, Micromonospora, and Thermomonospora [23, 28–30]. The aim of this study was to isolate and characterize potential waste-degrading microorganisms from the Mwakirunge dumpsite in Mombasa, Kenya.

2. Materials and Methods

2.1. Ethical Statement

The National Commission for Science, Technology and Innovation of Kenya (NACOSTI) approved this research study (License No: NACOSTI/P/23/25629). The field studies neither involved endangered nor protected species.

2.2. Study Site

Soil samples were collected from Mwakirunge dumpsite (3°57⁣′0⁣″ South, 39°40⁣′0⁣″ East), in Mombasa County, Kenya. Mwakirunge is the main official dumpsite for Mombasa wastes that was started in the year 2002. The dumpsite is about 15 km from the city center and is located along the flight path for Moi International Airport within the 13 km radius of the airport. The sampling points were randomized as follows: Block 1 (3°56⁣′27.0⁣″ S 39°40⁣′35.5⁣″ E), Block 2 (3°56⁣′27.4⁣″ S 39°40⁣′34.6⁣″ E), Block 3 (−3.941658, 39.672125), and Block 4 (−3.941414, 39.673460).

2.3. Sample Collection

Soil sampling was done using the randomized block design. About 100 g of soil mixed with solid wastes was collected from the dumpsite. The samples were collected from randomly selected blocks. From each block, sampling was done in four randomly selected points approximately 1.5 m apart, giving a total of 16 samples. Soil samples mixed with solid waste materials were collected by scooping at 5 cm depth in sterile Ziploc bags, labelled, and transported to the Kenya Marine and Fisheries Research Institute (KMFRI), where they were stored in the laboratory at 4°C for further analysis.

2.4. Microbial Culture Enrichment

Basal media was prepared following the protocol previously described by [31]. The media was prepared by dissolving (K2HPO4 1 g; KH2PO4 0.2 g; NaCl 1 g, MgSO4 0.01 g; (NH4)2 SO4 1 g; CaCl2.2H2O 0.002 g; FeSO4.7H2O 0.002 g) in 1 L of distilled water and enriched with mixed municipal solid wastes (paper waste, kitchen waste, and maize cobs sliced into small pieces of approximately 1 × 5 cm) that was then sterilized for 15 min at 121°C and 15 psi. Inocula were prepared following the procedure previously described by [24], where 2 g of soil was suspended in 100 mL of 0.85% sterile normal saline. Inoculation was done by adding 1% of the prepared inocula into 100 mL of basal media in a 250-mL Erlenmeyer flask. The negative control contained an uninoculated flask with basal media and waste materials. Incubation was done at 37°C and 130 rpm for 21 days in an orbital shaker. Microbial isolation was done from the enriched cultures in the incubation flasks after 21 days.

2.5. Isolation of Potential Useful Microorganisms

For bacterial cultures, a loopful of culture was spread using a sterile glass spreader on nutrient agar plates and incubated at 37°C for 24 h or up to 1 week for slow-growing bacteria. Pure cultures were obtained by continuously subculturing the mixed cultures on nutrient agar using the same conditions. For fungal cultures, a loopful of culture from the incubation flask was spread using a sterile spreader on potato dextrose agar and incubated at 37°C for a week. Pure fungal cultures were obtained by continuous subculturing of the obtained mixed cultures in PDA at 37°C for a week [24]. Actinomycetes were isolated by spreading a loopful of culture from the incubation flask on starch casein agar (SCA). The plates were incubated at 37°C for a week. Pure actinomycete colonies were obtained by continuous subculturing on SCA using the same conditions [32].

2.6. Characterization of Bacterial and Fungal Isolates

Identification of bacterial isolates was done based on their morphological, biochemical, and molecular characteristics. Colony morphology characterization was conducted using standard microbiological criteria with special emphasis on pigmentation, shape, form, elevation, and margin formation [33]. Physiological and biochemical analysis was determined using the following tests; Gram staining was done using the procedure described by [34]. Gram-positive organisms appear blue to purple while Gram-negative bacteria appear red to pink [34]. The ability of the bacterial isolates to produce indole from the degradation of tryptophan by the help of the tryptophanase enzyme was tested, and the formation of a red layer at the top of the tubes was an indication of a positive reaction [35]. The ability of the isolates to secrete enzyme catalase, which is responsible for the breakdown of hydrogen peroxide, was tested, and the formation of bubbles resulting from hydrogen peroxide breakdown to water and oxygen was an indication of a positive reaction [36]. The citrate utilization test was carried out as described by [37]. The bacterial growth and formation of a Prussian blue color indicated a positive reaction, while a negative result had no growth of bacteria and remained green. The methyl red (MR) test was done to determine the ability of bacteria to produce mixed acid products resulting from glucose fermentation while the Voges–Proskauer (VP) test was carried out to determine the ability of isolates to produce acetoin, a precursor to 2, 3 butanediol synthesis [38]. Lactophenol cotton blue staining of the fungal isolates was conducted as described by [39], and the presence of fungal hyphae, spores, conidia, and conidiophores was observed under the light microscope.

2.7. Screening Isolates for the Production of Extracellular Enzymes

The following enzymatic assays were conducted in triplicates. Semiquantitative tests for enzymatic (esterase, lipase, amylase, cellulase, and gelatinase) activities were carried out using techniques as previously described. Briefly, the media for the detection of esterase and lipase (on Tween 20 and Tween 80, respectively) were prepared as reported by [40, 41]. The culture plates were then observed for the appearance of clear zones or the presence of a precipitate around the colonies that indicated a positive result [40, 41]. The detection of amylase was prepared as described by [42]. The plates were then observed for the appearance of clear zones/decolorized regions around the colonies after flooding with Gram's iodine solution [42]. For the detection of cellulase and gelatinase activities, the procedures described by [43, 44] were used, respectively. Spot inoculation of test organism at the center of the media plates was done followed by incubation at 37°C for 2 days for the bacterial cultures and up to 5 days for fungal isolates. For gelatinase activity, the plates were flooded with saturated aqueous ammonium sulfate solution (NH4)2SO4) and then observed for halo zones around colonies after removing the excess solution [44], while for cellulase activity, the culture plates were flooded with 0.1% Congo red dye for 15 min followed by flooding with 1 M NaCl. This was discarded after 15 min after which the plates were observed for clearance zones around colonies [43].

2.8. DNA Extraction and PCR Amplification of the 16S rRNA Gene Region

Representative bacterial isolates (30) were selected based on their unique morphological characters for molecular characterization. The isolates were cultured in 25 mL of LB broth in 50 mL flasks for 48 h at 37°C and 130 rpm. The cultures were mixed by shaking and centrifuged in 5 mL falcon tubes at 4500 rpm for 10 min. The supernatant was discarded, and the pellet was retained for DNA extraction as described by [45]. The recovered pure DNA was confirmed by gel electrophoresis using 1% agarose in 1× TAE buffer and viewed under ultraviolet after staining with Sybr Green [45]. PCR was done in a Genesy Thermal Cycler machine (China) using prokaryotic universal primer pair 27F (5⁣′-AGAGTTTGATCMTGGCTCAG-3⁣′) and 1492R (5⁣′-CGGTTACCT TGTTACGACTT-3⁣′) [46]. The PCR was conducted in a reaction mixture containing 10 μL of NEB OneTaq 2X Master Mix with Standard Buffer (BioLabs), 1 μL genomic DNA, 1 μL forward primer (10 μM), 1 μL reverse primer (10 μM), and 7 μL of nuclease-free water (Catalogue No. E476). The PCR was done using the following conditions: initial denaturation at 94°C for 5 min followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 50°C for 30 s, and extension at 72°C for 1 min, followed by final extension at 72°C for 10 min. The integrity of the PCR amplicons was confirmed by visualization on a 1% agarose gel (CSL-AG500, Cleaver Scientific Ltd) stained with EZ-vision Bluelight DNA Dye (AMRESCO, LLC) under a gel documentation chamber.

2.9. DNA Extraction and PCR Amplification of the ITS Gene Region

Fungal mycelia grown for 4 days at 37°C on potato dextrose agar were cut using a sterile scalpel, then frozen in liquid nitrogen, and crushed with the help of a sterile pestle and mortar. The crushed mycelia were then used for DNA extraction following the method previously described by Aamir et al. (2015). Quality of the extracted DNA was checked through gel electrophoresis using 0.8% agarose gel in 1× TAE buffer and viewed under ultraviolet by staining with Sybr Green (Thermo Fisher Scientific). The extracted DNA was stored at −20°C awaiting further applications.

Amplification of the fungal (ITS) regions was done using ITS1F (5⁣′CTTGGTCATTTAGAGGAAGTAA3⁣′) and ITS4R (5⁣′TCCTCCGCTTATGC 3⁣′) primer sets [47]. Amplification was carried out in a 0.2 mL tube and reaction mixture containing 10 μL of NEB OneTaq 2X Master Mix with Standard Buffer (Catalogue No. M0482S), 1 μL Genomic DNA (30-80 ng/μL), 1 μL forward primer (10 μM), 1 μL reverse primer (10 μM), and 7 μL of nuclease-free water (Catalogue No. E476). The PCR was done in Genesy Thermal Cycler machine (China) using the following conditions: initial denaturation at 94°C for 3 min followed by 30 cycles of denaturation at 94°C for 1 min, annealing at 55°C for 1 min, initial extension at 72°C for 3, and final extension at 72°C for 10 min. The quality of the PCR amplicons was confirmed by visualization on a 1% agarose gel (CSL-AG500, Cleaver Scientific Ltd) stained with EZ-vision Bluelight DNA Dye (AMRESCO, LLC) under a gel documentation chamber.

2.10. Purification and Sequencing of PCR Products

Purification of all the PCR amplicons was done using ExoSAP-IT PCR Product Cleanup reagent (Thermo Fisher Scientific) by following the instructions of the manufacturer. Briefly, the Exo/SAP master mix was prepared by adding the following to a 0.6-mL microcentrifuge tube: 50 μL Exonuclease I (20 U/ul) and 200 μL shrimp alkaline phosphatase (1 U/uL). The reaction mixture was prepared by adding 10 μL of the PCR amplicons to 2.5 μL of the previously prepared ExoSAP Mix. These were mixed well and then incubated at 37°C for 15 min. The mixture was then heated at 80°C for 15 min to stop the reaction. The purified amplicons were packaged and sent for sequencing by a commercial service provider at Inqaba Biotech (South Africa).

2.11. Phylogenetic Analysis

Sequences of the isolates were manually edited in chromas (http://www.technelysium.com.au/ChromasPro.html) and checked for the presence of artifacts or sequencing errors using Mallard software [48], an NCBI bioinformatic tool for detecting chimera sequences. A search for similar sequences using BLASTN [49] was performed, and sequence alignment was performed using the CLUSTAL Omega program (http://www.clustal.org) against the nearest neighbors. A neighbor-joining tree of the aligned sequences was constructed [50] using MEGA X software [51]. Evolutionary distances were computed using the maximum composite likelihood method [52]. To obtain statistical support values for the branches, bootstrapping [53] was conducted with 1000 replicates. All sites, including gaps in the sequence alignment, were excluded pairwise in the phylogenetic analysis. Using the resultant neighbor-joining tree, each isolate was assigned to the proper taxonomic group. The taxonomic assignment was confirmed at a 95% confidence level using the RDP Naïve Bayesian rRNA Classifier Version 2.11 on the RDP website [54].

3. Results

3.1. Morphological Characters of Bacterial Isolates

The purified bacterial colonies showed differences in their surfaces, forms, optical characteristics, margins, elevations, and color. About 70% of the colonies were cream, entire, and smooth in nature. The majority of the bacterial isolates (77%) were Gram-positive, out of which 70% were rod shaped and 7% were cocci. The rest (33%) were Gram-negative rods (Figure 1, Table 1).

Figure 1.

Figure 1

Open in a new tab

Plate cultures and Gram staining results of some representative bacterial isolates. (1a–4a) Representatives of bacterial culture plates; (1b) Gram-positive cocci; (2b) Gram-negative cocci; (3b, 4b) Gram-positive rods.

Table 1.

Biochemical characters of the bacterial isolates.

Isolates code Accession no. Gram reaction Catalase MR Citrate Indole
B3S4 A2 MZ571881 GPR + + + −
B2S2 b2 MZ571882 GPR + − + −
B4S4 B1 MZ571883 GPR + − + −
B3S3 b MZ571884 GPR + − + −
B3S4 A1 MZ571885 GPR + + + −
B4S2 b MZ571886 GPR + − + −
B2S1 A2 MZ571887 GPR + − + −
B2S2 b MZ571888 GPR + − + −
B3S4 b1 MZ571896 GNR + + + −
B3S4 f MZ571897 GPR + − + −
B1S4 b MZ571898 GPR + − + −
B2S4 A MZ571899 GPR + + + −
B3S2 b MZ571900 GNR + − − −
B2S3 b1 MZ571901 GPR + + − −
B3S3 1 MZ571902 GPR + + + −
B3S3 2 MZ571903 GPR + + + −
B3S4 b3 MZ571904 GPR + − − −
B3S2 a MZ571905 GPR + + + −
B1S3 A MZ571906 GPR + − + −
B3S1 MZ571907 GPR + + + −
B3S3 b2 MZ571908 GPR + + + −
B4S1 A3 MZ571909 GPR − − + −
B2S2 MZ571910 GNR + + + −
−B4S4 A1 MZ571911 GNR + + − −
B1S2 MZ571912 GNR + + + −
B3S4 b MZ571913 GPR + + + −
B3S4 A2 MZ571913 GNR − − − −
B3S4 bs MZ571915 GPC + + − −
B1S2 A1 MZ571916 GPC + − − −
Open in a new tab

Note: Key: (+) denotes positive; (−) denotes negative.

Abbreviations: GNR, Gram-negative rods; GPC, Gram-positive cocci; GPR, Gram-positive rods.

3.2. Biochemical Characters of Bacterial Isolates

The isolated bacteria were tested for indole production, citrate utilization, catalase production, and MR-VP tests. All the isolated bacteria were catalase-positive except isolates B2S4b, B4S1 A3, and B3S4 A2. All the isolates were citrate positive except isolates B3S2 b, B2S3 b1, B3S4 b3, B1S3 A, B4S1 A3, and B3S4 A2. All the isolates were incapable of producing enzyme tryptophanase which degrades tryptophan to produce indole. Thirteen isolates (B3S4 A2, B3S4 A1, B3S4 b1, B2S4 A, B2S3 b1, B3S3 1, B3S3 2, B3S2 a, B3S1, B3S3 b2, B2S2, B4S4 A1, and B1S2) were MR positive, indicating glucose fermentation ability of the isolates that was characterized by red color upon addition of three drops of MR indicator. All the isolates tested negative for VP (Table 1).

3.3. Morphological Characters of Fungal Isolates

A total of 20 fungi were successfully isolated on PDA, and 80% of the isolated fungi were greenish to gray on the front view and cream-white on the reverse side. These isolates also had a characteristic white border encircling the mycelia. The colonies showed good sporulation and fast growth at 37°C. Microscopically, the conidia, conidiophores, and the hyphae were clearly seen on lactophenol cotton blue staining (Table 2; Figure 2). All the isolates showed erect conidia, branching-septate hyphae, and club-shaped vesicles. A foot cell producing a single conidiophore perpendicular to the long axis of the cell characteristic to the genus Aspergillus was also observed. All the fungal isolates were classified based on their macro and microscopic characteristics as members of the genus Aspergillus (Table 2; Figure 2).

Table 2.

Macroscopic and microscopic features of fungal isolates.

Isolates code Accession no. Macroscopic features Microscopic features Reverse side
B2S3 MZ569410 Greenish with white margin, fast growing, velvety Branching hyphae, septate, and hyaline club-shaped conidiophore Cream
B4S2 MZ569411 Greenish-gray, cottony, fast growing Branching hyphae, septate, and hyaline club-shaped conidiophore Cream
B3S4 b2 MZ569412 Grayish, fast growing, velvety Branching hyphae, septate, and hyaline club-shaped conidiophore Cream
B2S2 a1 MZ569413 Grayish, powdery surface, fast growing Branching hyphae, septate, and hyaline club-shaped conidiophore Cream
B3S2 a MZ569414 Greenish with white margin, powdery texture, fast growing Branching hyphae, septate, and hyaline club-shaped conidiophore Cream
B3S3 b1 MZ569415 Grayish, powdery texture, fast growing Branching hyphae, septate, and hyaline club-shaped conidiophore Cream
B4S4 b MZ569416 Greenish-gray, velvety, fast growing Branching hyphae, septate, and hyaline club-shaped conidiophore Cream
B3S2 b MZ569417 Green with brown appearance at the center, fast growth, cottony Branching hyphae, septate, and hyaline club-shaped conidiophore Cream
B3S2 A MZ569418 Green with white margin, fast growth, cottony Branching hyphae, septate, and hyaline club-shaped conidiophore Cream
B3S1 b MZ569419 Brownish with white margin, wooly appearance, fast growing Branching hyphae, septate, and hyaline club-shaped conidiophore Brown
B3S3 b MZ569420 Olive with shiny white margin, slow growing, velvety Branching hyphae, septate, and hyaline club-shaped conidiophore Brown
B4S2 MZ569421 Grayish with brown center, fast growing, powdery texture Branching hyphae, septate, and hyaline club-shaped conidiophore Cream
B3S4 b2 MZ569422 Greenish, velvety, fast growth Branching hyphae, septate, and hyaline club-shaped conidiophore Brown
B3S1 A MZ569423 Brownish, powdery texture, fast growth Branching hyphae, septate, and hyaline club-shaped conidiophore Brown
B4S4 MZ569424 Surface green with white periphery, slow growing, wooly Branching hyphae, septate, and hyaline club-shaped conidiophore Cream
Open in a new tab

Figure 2.

Figure 2

Open in a new tab

Plate culture and microscopic features of some representative fungal isolates. (1a, 2a; 1b, 2b) The 3-day-old plate cultures on the front and reverse sides, respectively. (1c, 2c) The microscopic features of the respective fungal representatives.

3.4. Affiliations of Bacterial Sequences With Closely Related Taxonomic Relatives

PCR amplification of the 16S rRNA gene region for the bacterial isolates (A1-A8, B1-B22) was successful. Sequence similarity search at the nucleotide sequence database (GenBank) indicated close taxonomic affiliation of the newly obtained sequences with known cultivatable members of different genera belonging to the phyla Actinobacteria, Firmicutes, and Proteobacteria. The 16S rRNA gene sequences of the majority of the isolates had close sequence similarities (97-100%) with known bacterial species isolated from the different habitats, except for isolates B4S2b (MZ571886), B3S1 (MZ571907), and B3S4B (MZ571915) that had sequence similarities with known taxonomic relatives of 93%, 92% and 92%, respectively (Table 3).

Table 3.

Affiliation of bacterial isolates with their closest known taxonomic relatives.

Seq Isolates Accession no. Closest taxonomic relative Source of affiliates Country of isolation % ID
ID Code
AI B3S4 A2 MZ571881 Bacillus paralicheniformis strain CB211 (MT527538) Soil China 99
A2 B2S2 b2 MZ571882 Streptomyces thermocarboxydus strain SDT64(KJ018992) Dark tea China 100
A3 B4S4 B1 MZ571883 Bacillus velezensis strain ROA048(MT525304) Sediment South Korea 100
A4 B3S3 b MZ571884 Isoptericola sp. strain G235TR (MZ182281) Insects Germany 99
A5 B3S4 A1 MZ571885 Bacillus licheniformis strain I97(KU922426) Air China 99
A6 B4S2 b MZ571886 Bacillus sonorensis strain JUG RS2(MK156710) Soil India 93
A7 B2S1 A2 MZ571887 Bacillus subtilis strain MGB4024 (MH261154) Soil China 100
A8 B2S2 b MZ571888 Bacillus licheniformis strain 7B3-13(MK603064) Sediment Brazil 99
B1 B3S4 b1 MZ571896 Pseudomonas putida strain S4k76 (MK737354) Soil Iran 100
B2 B3S4 f MZ571897 Brevibacilli parabrevis strain GF13(KY312740) Intestinal tract China 100
B3 B1S4 b MZ571898 Ochrobactrum pseudintermedium (LR135573) Hermetia illucens Italy 100
B4 B2S4 A MZ571899 Bacillus cereus strain K1M36(MW559327) Air China 100
B5 B3S2 b MZ571900 Pseudomonas stutzeri strain AAK_MD_30 (MT180597) Mule dung India 100
B7 B2S3 b1 MZ571901 Bacillus velezensis strain LZ12-07(MT845849) Soil China 100
B8 B3S3 1 MZ571902 Bacillus cereus strain B236(KF494193) Feces of piglets China 100
B9 B3S3 2 MZ571903 Bacillus paramycoides strain 2914 (MT611870) — China 100
B10 B3S4 b3 MZ571904 Bacillus cereus strain XS 24-5(MT000038) — Southeast China 100
B11 B3S2 a MZ571905 Bacillus albus strain FA26 (MK993444) Soil Pakistan 100
B12 B1S3 A MZ571906 Bacillus subtilis subsp. stercoris strain EGI143 (MN704442) Origanum vulgare L. China 100
B13 B3S1 MZ571907 Ochrobactrum sp strain CSL1 16S(MG008507) — China 92
B14 B3S3 b2 MZ571908 Bacillus cereus strain XaM13 (MW559356) — China 100
B15 B4S1 A3 MZ571909 Pseudomonas stutzeri strain W41 (KT380584) Sediment China 99
B16 B2S2 MZ571910 Pseudomonas sp. strain CR7 (MN087814) Glacier China 99
B17 B4S4 A1 MZ571911 Pseudoxanthomonas indica strain ES-4 (MK537384) Soil India 100
B18 B1S2 MZ571912 Microbacterium paraoxydans strain SMV194#22(KP780213) — Italy 99
B19 B3S4 b MZ571913 Paenibacillus barengoltzii strain THWCS8 (GQ284355) Sediment India 99
B20 B3S4A2 MZ571914 Microbacterium sp. HBUM178961 (KR906353) Medicinal plants Gynura China 99
B21 B3S4 B MZ571915 Staphylococcus epidermidis strain SSR4 (MH889059) Soil Peru 92
B22 B1S2 A1 MZ571916 Staphylococcus epidermidis strain SESURV_p3(CP043801) — United States 97
Open in a new tab

Thirteen isolates were associated with the genus Bacillus with sequence identities of 99%–100%, except for isolate B4S2b (MZ571886), which had 93% sequence similarity against B. sonorensis (Table 3). Four isolates (B3S4 b1 (MZ571896), B3S2 b (MZ571900), B4S1 A3 (MZ571909), and B2S1 (MZ571910)) were closely affiliated with members of the genus Pseudomonas with sequence identities of between 99% and 100% (Table 3). Isolate B2S2b2 (MZ571882) was closely affiliated to Streptomyces thermocarboxydus (KJ018992) with a sequence similarity value of 100%. Isolates B3S4b (MZ571913) and B4S4A1 (MZ571911) had 99%–100% sequence identities with members from the genera Paenibacillusand Pseudoxanthomonas, respectively. Two isolates (B1S4b (MZ571898) and B3S1 (MZ571907) had sequence similarities of 100% and 92%, respectively, with members of the genus Ochrobactrum. Other two isolates B1S2 (MZ571912) and B3S4A2 (MZ571914) were affiliated with members from the genus Microbacteria with sequence similarity of 99%. The other isolates B3S4F (MZ571897) and B3S3B (MZ571884) were affiliated (with 99%–100% sequence similarities) to members from the genera brevibacilli and Isoptericola, respectively (Table 3).

3.5. Phylogenetic Analysis of Bacterial Isolates

All the analyzed bacterial sequences were deposited at the primary nucleotide sequence database (GenBank) with the accession numbers (MZ571881-MZ571916). The consensus evolutionary tree constructed based on partial bacterial 16S rRNA sequences grouped the isolates into three major clusters constituting members of the phyla Bacillota (Firmicutes), Pseudomonadota (Proteobacteria), and Actinomycetota (Actinobacteria) (Figure 3a,b). The cluster associated with the phylum Firmicutes included members of the genera Bacillus and Staphylococcus with bootstrap support values of between 99% and 100%. This major cluster had four subclusters constituting species of S. epidermidis, B. paralicheniformis, B. licheniformis, B. sonorensis, B. velezensis, B. subtilis, B. cereus, B. albus, and B. paramycoides (Figure 3a). The other major cluster was represented by members from the phylum Actinobacteria and included members of the genera Microbacterium, Streptomyces, Isoptericola, and Brevibacillus with a bootstrap support value of 91%. The last cluster constituted bacterial members from the phylum Proteobacteria that included members of the genera Ochrobactrum, Pseudomonas, and Pseudoxanthomonas with a bootstrap support value of 83% (Figure 3b). An Archaea Vulcanisaeta disttibuta (NR_040876.1) was used as an outgroup to root the tree.

Figure 3.

Figure 3

Open in a new tab

(a) Consensus phylogenetic tree based on partial bacterial 16S rRNA sequences, inferred by using the maximum likelihood method on Mega X. (b) Consensus phylogenetic tree based on partial bacterial 16S rRNA sequences, inferred by using the maximum likelihood method on MEGAX.

3.6. Affiliations of Fungal Sequences With Closely Related Taxonomic Relatives

The PCR amplification of the ITS gene region of the 15 fungal isolates using universal primers ITS1F and ITS4R was successful. Taxonomic analysis of sequences of the isolates showed the presence of cultivatable members of the genus Aspergillus in the phylum Ascomycota. ITS gene sequences of the isolates indicated high similarity (100%) with sequences of several members of the genus Aspergillus (A. niger, A. nidulans, A. terreus, and A. fumigatus), except isolate B2S2 a1 (MZ569413), which had a percentage sequence similarity of 96% (Table 4).

Table 4.

Affiliation of ITS gene sequences of the isolates with their closest known taxonomic relatives.

Isolates code Accession no. Closest taxonomic relative Source Country of isolation % ID
B2S3 MZ569410 Aspergillus fumigatus isolate ZSY-5-4(MT487775) N/A China 100
B4S2 MZ569411 Aspergillus fumigatus strain N15-2-1-1 (MN704714) N/A China 100
B3S4 b MZ569412 Aspergillus fumigatus isolate ZSY-5-4 (MT487775) N/A China 100
B2S2 a1 MZ569413 Aspergillus fumigatus isolate 19-10-1(HQ149777) Marine environment China 96
B3S2 a MZ569414 Aspergillus fumigatus strain ND108(MH270614) Dairy feeds Zimbabwe 100
B3S3 b1 MZ569415 Aspergillus niger isolate RUF-Asn(MN944460) Soil Iran 100
B4S4 b MZ569416 Aspergillus fumigatus strain N16-1-5-1 (MN704716) N/A China 100
B3S2 b MZ569417 Aspergillus fumigatus isolate ZSY-5-4(MT487775) N/A China 100
B3S2 A MZ569418 Aspergillus fumigatus strain N16-1-5-1 (MN704716) N/A China 100
B3S1 b MZ569419 Aspergillus terreus strain DTO 403-C9(MT316343) Compost pile Italy 100
B3S3 b MZ569420 Aspergillus oryzae strain TF7(MH625703) Soil Nigeria 100
B4S2 MZ569421 Aspergillus fumigatus strain N15-2-1-1(MN704714) N/A China 100
B3S4 b2 MZ569422 Aspergillus fumigatus strain 16FB (MT267796) Soil Iran 100
B3S1 A MZ569423 Aspergillus fumigatus isolate RSO_SP17 (MN634626) Drinking water South Africa 100
B4S4 MZ569424 Aspergillus nidulans strain DTO 402-H2(MT316339) Compost pile Italy 100
Open in a new tab

3.7. Phylogenetic Analysis of Fungal Isolates

The analyzed ITS gene sequences were deposited at the primary nucleotide sequence database (GenBank) with the accession numbers (MZ569410-MZ569424). The inferred phylogenetic tree based on partial ITS gene region sequences grouped the isolates into one major cluster comprising members of the genus Aspergillus in the phylum Ascomycota. The subclusters were represented by species such as A. fumigatus, A. tereus, A. oryzae, and A nidulans (Figure 4). A. fumigatus formed the majority of the members with 100% sequence similarity with known taxonomical relatives (Figure 4 and Table 4).

Figure 4.

Figure 4

Open in a new tab

Consensus phylogenetic tree based on ITS gene regions of the fungal isolates, inferred by using the maximum likelihood method. Nigrospora gorlenkoana is an out-group used to root the tree.

3.8. Extracellular Enzyme Production From Bacterial Isolates

Microbial selection for enzymatic activity was based on preliminary enzymatic assay results. Isolates that showed good activity during preliminary screening were selected for further screening. Ten fungal and 16 bacterial isolates were selected and screened for their potential to secrete useful enzymes. Among the tested bacterial isolates, 11 isolates exhibited amylolytic activity, while cellulase activity was observed in 10 isolates. Only four isolates including Streptomyces thermocarboxydus A2, Bacillus cereus B4, Pseudomonas stutzeri B5, and Paenibacillus barengoltzii B19 exhibited lipolytic activity on Tween 80. Additionally, nine isolates exhibited esterase activity.

Isolate B2S2 b2-Streptomyces thermocarboxydus (MZ571882) tested positive for all the screened enzymes and had a significantly high lipase activity (23.33 ± 1.76 mm) (p < 0.05). Isolates B3S4 A1-Bacillus sp. A5- (MZ571885), B3S3 2- Bacillus sp. B9 (MZ571903), and B1S3 A- Bacillus sp. B12 (MZ571906) tested positive for amylase and cellulase enzymes (Table 5). B2S1 A2-Bacillus sp. (MZ571887) (25 ± 5.13 mm) and B1S3 A-Bacillus sp. (MZ571906) (23.67 ± 0.88 mm) had a significantly high amylase activity (p < 0.05), while B2S2 b-Bacillus licheniformis (MZ571888) (69 ± 2.65 mm) and B3S4 A2-Bacillus sp. (MZ571881) (46.67 ± 5.23 mm) exhibited the highest cellulase activity which was significantly different from all the other isolates (p < 0.05). B2S1 A2-Bacillus sp. (MZ571887) showed some activities for enzymes amylase (25.00 ± 5.13 mm), cellulase (27.33 ± 0.67 mm), and esterase (18.67 ± 0.67 mm). Isolate B3S1-Ochrobactrum sp. (MZ571907) also showed activity for amylase (13.00 ± 1.15 mm), cellulase (28.00 ± 4.16 mm), and esterase (16.33d ± 0.88 mm) (Table 2). Both B2S1 A2-Bacillus sp. (MZ571887) and B3S1-Ochrobactrum sp. (MZ571907) did not show activities for enzymes lipase and gelatinase. B2S4 A-Bacillus cereus (MZ571899) showed some activities for esterase (72.67 ± 1.76 mm), lipase (14.33 ± 1.20 mm), and gelatinase (22.00b ± 2.52 mm) enzymes and no activity for both amylase and cellulase enzymes. It showed the highest esterase activity (72.67 ± 1.76 mm), which was significantly different from all the isolates screened. Isolate B3S2 b- Pseudomonas stutzeri (MZ571900) tested positive for all the enzymes screened except for cellulase and had a significantly high gelatinase activity of (34.67 ± 1 mm) (p < 0.05). Isolates B3S3 1-Bacillus sp. (MZ571902) B8 and B4S4 B1-Bacillus sp. A3 (MZ571883) had positive enzyme activities for all the screened enzymes except for lipase. Isolate B4S4 B1 (MZ571883) showed significantly high cellulase (37.00 ± 1.53 mm) and esterase activities (53.00 ± 1.15 mm). Bacillus albus B11 (B3S2a) and (MZ571905) tested positive for enzymes amylase (20.00 ± 1.15), cellulase (12.67 ± 1.45 mm), and gelatinase (13.00 ± 1.15 mm). B4S4 A1-Pseudoxanthomonas sp. B17 (MZ571911) showed activity for only two enzymes: amylase (7.33 ± 1.33 mm) and gelatinase (12.00 ± 1.00 mm). B3S4 A2 Bacillus sp. A1-(MZ571881) and B2S2 b-Bacillus sp. A8 (MZ571888) tested negative for all the enzymes screened except cellulase. Bacillus sp. A8 had the highest cellulase activity (69 ± 2.65 mm), which was significantly different at (p < 0.05) among all the tested isolates. B3S4 A2-Microbacterium sp. B20 (MZ571914) was positive for esterase enzyme (15.33 ± 1.76 mm) only.

Table 5.

Enzyme activity of bacterial isolates.

Isolate code Accession no. Enzymatic activities (diameter measured in mm)
Amylase Cellulase Esterase Lipase Gelatinase
B2S2 b2 MZ571882 10.00 ± 1.15e 25.67 ± 1.20c 32.00 ± 1.16b 23.33 ± 1.76f 13.67 ± 0.88d
B3S4 A1 MZ571885 17.67 ± 0.33c 12.67 ± 1.45b 0.00 ± 0.00a 0.00 ± 0.00a 0.00 ± 0.00a
B2S1 A2 MZ571887 25.00 ± 5.13g 27.33 ± 0.67c 18.67 ± 0.67d 0.00 ± 0.00a 0.00 ± 0.00a
B2S4 A MZ571899 0.00 ± 0.00a 0.00 ± 0.00a 72.67 ± 1.76f 14.33 ± 1.20c 22.00 ± 2.52b
B3S2 b MZ571900 17.67 ± 0.88c 0.00 ± 0.00a 31.67 ± 2.03b 20.33 ± 0.88bd 34.67 ± 2.91c
B3S3 1 MZ571902 16.67 ± 2.40c 12.67 ± 1.45b 28.33 ± 2.03b 0.00 ± 0.00a 21.33 ± 1.33b
B3S3 2 MZ571903 9.00 ± 0.58e 21.00 ± 1.00d 0.00 ± 0.00a 0.00 ± 0.00a 0.00 ± 0.00a
B3S2a MZ571905 20.00 ± 1.15f 12.67 ± 1.45b 0.00 ± 0.00a 0.00 ± 0.00a 13.00 ± 1.15d
B1S3 A MZ571906 23.67 ± 0.88fg 13.33 ± 1.67b 0.00 ± 0.00a 0.00 ± 0.00a 0.00 ± 0.00a
B4S4 A1 MZ571911 7.33 ± 1.33e 0.00 ± 0.00a 0.00 ± 0.00a 0.00 ± 0.00a 12.00 ± 1.00d
B3S4 A2 MZ571881 0.00 ± 0.00a 46.67 ± 5.24e 0.00 ± 0.00a 0.00 ± 0.00a 0.00 ± 0.00a
B4S4 B1 MZ571883 11.67 ± 0.88de 37.00 ± 1.53f 53.00 ± 1.15c 0.00 ± 0.00a 22.00 ± 1.15b
B2S2 b MZ571888 0.00 ± 0.00a 69.00 ± 2.65g 0.00 ± 0.00a 0.00 ± 0.00a 0.00 ± 0.00a
B3S4 b MZ571913 0.00 ± 0.00a 0.00 ± 0.00a 12.00 ± 1.73de 18.00 ± 1.73b 21.00 ± 1.7b
B3S4A2 MZ571914 0.00 ± 0.00a 0.00 ± 0.00a 15.33 ± 1.76d 0.00 ± 0.00a 0.00 ± 0.00a
B3S1 MZ571907 13.00 ± 1.15b 28.00 ± 4.16c 16.33 ± 0.88d 0.00 ± 0.00a 0.00 ± 0.00a
Open in a new tab

Note: Mean values (n = 3) ± SEM. Values appended by different superscript letters within a row and column are significantly different (p < 0.05).

3.9. Extracellular Enzyme Production From Fungal Isolates

Ten fungal isolates were qualitatively screened for their potential to secrete enzymes cellulase, lipase, amylase, esterase, and gelatinase. The growth of fungal isolates on the plates was uneven, and therefore, the diameter zone of clearance could not be accurately measured. Low, moderate, and high activities for amylase, cellulase, and gelatinase were detected for some isolates as shown in Table 6.

Table 6.

Enzyme activity in fungal isolates.

Isolate code Isolate accession number Amylase Cellulase Lipase Esterase Gelatinase
B3S4 b MZ569412 ++ +++ − − ++
B2S2 a1 MZ569413 ++ ++ − − ++
B3S2 a MZ569414 +++ +++ − − ++
B3S3 b1 MZ569415 − +++ − − +
B4S4 b MZ569416 +++ ++ − − +++
B3S1 b MZ569419 ++ ++ − − −
B3S3 b MZ569420 +++ + − − ++
B3S4 b2 MZ569422 ++ +++ − − −
B3S1 A MZ569423 ++ ++ − − +
B4S4 MZ569424 ++ − − − ++
Open in a new tab

Note: Key: Enzyme activity in fungal isolates: (+++) high activity, (++) moderate activity, (+) low activity, and (−) no activity.

No esterase and lipase activities were recorded in all the screened fungal isolates. Among the 10 isolates tested, Aspergillus niger F6 (MZ569415) did not exhibit amylolytic activity. Nine isolates tested positive for cellulase activity except Aspergillus nidulans–F15 (MZ569424). Eight isolates exhibited gelatinolytic activity except two isolates Aspergillus terreus F10 (MZ569419) and Aspergillus fumigatus F13 (MZ569422).

4. Discussion

The occurrence and diversity of potentially useful microorganisms vary with environments and geographical locations. Microorganisms interact with waste materials (pollutants) and secrete extracellular enzymes, which catalyze the degradation of the pollutants primarily through oxidative reactions or hydrolytic activity. The ability of the microbes to produce extracellular enzymes indicates their possible roles in waste biodegradation and other biotechnological applications. In this study, microorganisms were isolated after a culture enrichment period that allowed microbes to thrive on media supplemented with mixed municipal solid waste materials.

Phylogenetic analyses of the 16S rRNA gene region in the current study categorized the majority of the isolates (with 47% frequency) as members of the genus Bacillus (Table 3). About 50% of Bacillus species were capable of multiple enzyme production, indicating their possible implications in municipal solid waste degradation. Notably, bacilli species are capable of producing thick-walled endospores resistant to heat, radiation, and other harsh environmental conditions which may be the reason for their frequent occurrence [24]. This is consistent with the studies conducted by [24, 55] where Bacillus species were among the most frequently isolated soil bacteria. Some members from this genus have ecological significance including implications in nutrient cycling, improvement of stress tolerance to plants, and in waste degradation [18]. Bacillus species also have potential for industrial applications due to their ability to secrete extracellular enzymes. They are an affordable source of enzymes because they are widely distributed, they are safe to work with, they are easy to cultivate, and they are susceptible to genetic transformations [56] and have found importance in the agricultural, biomedical, feed and additive, food, and the chemical industry [49–52].

In the present study, a number of bacilli sp. demonstrated esterase and lipase activities. Production of lipase and esterase enzymes by these isolates suggests their potential to degrade oil-based waste materials and even plastic wastes [41, 57–61]. These results are in agreement with other studies, where Bacillus species have been reported to produce lipolytic enzymes [34, 55, 56, 62]. Moreover, some Bacillus isolates indicated cellulase activity that is consistent with the results reported by [57, 58]. The production of cellulases by the isolates suggest their importance in plant-biomass/cellulosic waste degradation [63, 64]. It should be noted that municipal solid wastes constitute about 40%–50% of cellulose, which provides a good environment for the growth of cellulose-degrading microorganisms [26].

Pseudomonas stutzeri B5 (MZ571900) isolated from this study had the highest protease activity and was capable of producing multiple enzymes. The multiple enzyme secretion indicates its possible role in the degradation of a variety of wastes. Pseudomonas species have often been implicated in the decomposition of organic matter degradation of plastic waste and wastewater degradation among other waste [65–67]. Good enzyme production abilities by both bacilli and Pseudomonas species indicate their significant role in waste decomposition. Also, Streptomyces thermocarboxydus had activity for all the screened enzymes (Table 5). High diversity of enzymes in Streptomyces spp. was also reported by [68]. A lipase-producing Streptomyces sp. was reported by [69] while a cellulolytic Streptomyces sp. was isolated from composting materials by [70]. Members of the phylum actinobacteria have been associated with the secretion of many useful bioactive compounds and enzymes [71, 72].

Analysis of the fungal ITS gene regions in this study indicated that 73% of the isolates were associated with Aspergillus fumigatus (Table 4). These results are in agreement with previous studies conducted by [73, 74]), where A. fumigatus was reported as the most common fungal species in waste and compost. A. fumigatus is, however, known to be the most prevalent airborne fungal pathogen that may cause aspergillosis and other lung infections, especially in immunosuppressed individuals. The abundant development of A. fumigatus in waste and compost is, therefore, a matter of concern due to their potential of causing disease. The consistent exposure and inhalation of fungal particles pose a risk of aspergillosis and other lung infections among the people living and working in the waste disposal areas [75]. Aspergillus species including A. flavus, A. terreus, A. fumigatus, and A. niger were isolated from compost by [74]. Aspergillus niger, A. flavus, and A. terreus capable of decomposing green household waste were also isolated by [76]. The ability of these fungal isolates to produce extracellular hydrolases including cellulase, amylase, and gelatinase is of ecological importance. Contrary to other studies, no lipase nor esterase activity was detected in all the fungal isolates screened. Previous studies have, however, reported lipolytic activity in Aspergillus species [77–80]. All the isolates screened were cellulase-active except isolate F15- A. nidulans (MZ569424). Cellulase production in Aspergillus species has been widely reported in previous studies. In a study by [81], two Aspergillus species including A. niger and A. flavus isolated from waste dumpsite were reported to have cellulase activity. Amylase production in A. niger has been described by several researchers [82–84], whereas amylase production in Aspergillus fumigatus was reported by [85]. Amylase production by Aspergillus species implicates them in the degradation of starch-based waste and also their importance in industrial applications. Protease production in Aspergillus species has also been reported in previous studies. Saline-tolerant protease secreted by Aspergillus sp. isolated from soil was reported by [86]. In another study by [87], A. oryzae, commonly used in the manufacture of Chinese soy sauce, was reported to be capable of producing three types of extracellular proteases [88] and reported good protease activity in A. flavus and A. fumigatus isolated from a local rice husk dumpsite.

In this study, three bacterial isolates, B4S2 b (MZ571886), B3S1 (MZ571907), and B3S4 B (MZ571915), and one fungal isolate, B2S2 a1 (MZ569413), had low sequence percentage similarity based on the partial 16S rRNA gene region analysis. Therefore, a further polyphasic approach including analysis based on other housekeeping genes and/or full genome sequencing is required to establish the true identity of these isolates. This study corroborates that municipal solid waste dumpsite is a potential source for a wide spectrum of bacteria and fungi with the potential of producing a variety of enzymes that can have diverse industrial applications.

4.1. Study Limitations

It should be noted that all culture experiments were conducted under laboratory settings; hence, the growth conditions used in this study may have limited the growth of other microorganisms that require specific growth environments. Also, considering the paradigm that only 1% of microorganisms is culturable [89], such limitation affected this study.

The analysis of the 16S rRNA and ITS gene regions alone was not sufficient to declare the novelty of the isolates recovered from this study, which had a low percentage similarity with their closely known taxonomic relatives. Also, the study had fund limitations that could not allow us to perform specific experiments to demonstrate the degradation of specific waste materials.

Acknowledgments

This research was supported by a research grant (Number, TUM/PRI/RP/18-19/VOL ΙΙ 25 (145) from the Office of Registrar, Research, Partnership, and Extension from the Technical University of Mombasa.

Data Availability Statement

The data that support the findings of this study are openly available in NCBI at https://ncbi.nlm.nih.gov/.

Disclosure

This paper contains content adapted from the author's thesis, previously published at https://ir.tum.ac.ke in fulfillment of the degree requirements at the Technical University of Mombasa [90].

Conflicts of Interest

The authors declare no conflicts of interest.

Funding

This work was supported by the Office of the Registrar, Research, Partnership, and Extension from the Technical University of Mombasa (grant number: TUM/PRI/RP/18-19/VOL ΙΙ 25 (145)).

References

  • 1.Abdel-Shafy H. I., Mansour M. S. Solid waste issue: sources, composition, disposal, recycling, and valorization. Egyptian Journal of Petroleum . 2018;27(4):1275–1290. doi: 10.1016/j.ejpe.2018.07.003. [DOI] [Google Scholar]
  • 2.Abubakar I. R., Maniruzzaman K. M., Dano U. L., et al. Environmental sustainability impacts of solid waste management practices in the global south. International Journal of Environmental Research and Public Health . 2022;19(19):p. 12717. doi: 10.3390/ijerph191912717. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Massoud M. A., Mokbel M., Alawieh S., Yassin N. Towards improved governance for sustainable solid waste management in Lebanon: centralised vs decentralised approaches. Waste Management & Research . 2019;37(7):686–697. doi: 10.1177/0734242X19836705. [DOI] [PubMed] [Google Scholar]
  • 4.Anand S. Solid waste management . Mittal Publications; 2010. [Google Scholar]
  • 5.Demirbas A. Waste management, waste resource facilities and waste conversion processes. Energy Conversion and Management . 2011;52(2):1280–1287. doi: 10.1016/j.enconman.2010.09.025. [DOI] [Google Scholar]
  • 6.Lissah S. Y., Ayanore M. A., Krugu J. K., Aberese-Ako M., Ruiter R. A. Managing urban solid waste in Ghana: perspectives and experiences of municipal waste company managers and supervisors in an urban municipality. PLoS One . 2021;16(3) doi: 10.1371/journal.pone.0248392.e0248392 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Sharma R., Sharma M., Sharma R., Sharma V. The impact of incinerators on human health and environment. Reviews on Environmental Health . 2013;28(1):67–72. doi: 10.1515/reveh-2012-0035. [DOI] [PubMed] [Google Scholar]
  • 8.Webb H. K., Arnott J., Crawford R. J., Ivanova E. P. Plastic degradation and its environmental implications with special reference to poly (ethylene terephthalate) Polymers . 2013;5(1):1–18. doi: 10.3390/polym5010001. [DOI] [Google Scholar]
  • 9.Bardají D. K. R., Moretto J. A. S., Furlan J. P. R., Stehling E. G. A mini-review: current advances in polyethylene biodegradation. World Journal of Microbiology and Biotechnology . 2020;36(2):1–10. doi: 10.1007/s11274-020-2808-5. [DOI] [PubMed] [Google Scholar]
  • 10.Singh G. K., Gupta K., Chaudhary S. Solid waste management: its sources, collection, transportation and recycling. International Journal of Environmental Science and Development . 2014;5(4):347–351. doi: 10.7763/IJESD.2014.V5.507. [DOI] [Google Scholar]
  • 11.Han Z., Ma H., Shi G., He L., Wei L., Shi Q. A review of groundwater contamination near municipal solid waste landfill sites in China. Science of the Total Environment . 2016;569:1255–1264. doi: 10.1016/j.scitotenv.2016.06.201. [DOI] [PubMed] [Google Scholar]
  • 12.Mukherjee S., Mukhopadhyay S., Hashim M. A., Sen Gupta B. Contemporary environmental issues of landfill leachate: assessment and remedies. Critical Reviews in Environmental Science and Technology . 2015;45(5):472–590. doi: 10.1080/10643389.2013.876524. [DOI] [Google Scholar]
  • 13.Siddiqua A., Hahladakis J. N., Al-Attiya W. A. K. An overview of the environmental pollution and health effects associated with waste landfilling and open dumping. Environmental Science and Pollution Research . 2022;29(39):58514–58536. doi: 10.1007/s11356-022-21578-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Vaverková M. D. Landfill impacts on the Environment—Review. Geosciences . 2019;9(10):p. 431. doi: 10.3390/geosciences9100431. [DOI] [Google Scholar]
  • 15.Sinha R. K., Valani D., Sinha S., Singh S., Herat S. Solid waste management and environmental remediation . Nova Science Publishers, Inc.; 2009. Bioremediation of contaminated sites: a low-cost nature’s biotechnology for environmental clean up by versatile microbes, plants & earthworms. [Google Scholar]
  • 16.Saravanan A., Kumar P. S., Vo D.-V. N., Jeevanantham S., Karishma S., Yaashikaa P. A review on catalytic-enzyme degradation of toxic environmental pollutants: microbial enzymes. Journal of Hazardous Materials . 2021;419 doi: 10.1016/j.jhazmat.2021.126451.126451 [DOI] [PubMed] [Google Scholar]
  • 17.Alemu F. Isolation and screening of protease enzyme producing bacteria from cheese at Dilla University, Ethiopia. International Journal of Nutrition and Food Sciences . 2015;4(2):234–239. doi: 10.11648/j.ijnfs.20150402.25. [DOI] [Google Scholar]
  • 18.Saxena S. Applied microbiology . New Delhi: Springer; 2015. Microbial enzymes and their industrial applications. [DOI] [Google Scholar]
  • 19.Sharma B., Dangi A. K., Shukla P. Contemporary enzyme based technologies for bioremediation: a review. Journal of Environmental Management . 2018;210:10–22. doi: 10.1016/j.jenvman.2017.12.075. [DOI] [PubMed] [Google Scholar]
  • 20.Karigar C. S., Rao S. S. Role of microbial enzymes in the bioremediation of pollutants: a review. Enzyme Research . 2011;2011(1) doi: 10.4061/2011/805187.805187 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Bhandari S., Poudel D. K., Marahatha R., et al. Microbial enzymes used in bioremediation. Journal of Chemistry . 2021;2021(1) doi: 10.1155/2021/8849512.8849512 [DOI] [Google Scholar]
  • 22.Gurung N., Ray S., Bose S., Rai V. A broader view: microbial enzymes and their relevance in industries, medicine, and beyond. BioMed Research International . 2013;2013(1) doi: 10.1155/2013/329121.329121 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Emmanuel U., Ifeanyichukwu I., Chika E., Chike O., Chinyere N. Isolation and characterization of bacteria and fungi associated with biodegradation of municipal solid wastes in Abakaliki Metropolis, Nigeria. International Journal of Environment, Agriculture and Biotechnology . 2017;2(3)238795 [Google Scholar]
  • 24.Muhonja C. N., Makonde H., Magoma G., Imbuga M. Biodegradability of polyethylene by bacteria and fungi from Dandora dumpsite Nairobi-Kenya. PLoS One . 2018;13(7) doi: 10.1371/journal.pone.0198446.e0198446 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Jain A., Yadav S., Nigam V. K., Sharma S. R. Fungal-mediated solid waste management: a review. Mycoremediation and Environmental Sustainability . 2017;1:153–170. doi: 10.1007/978-3-319-68957-9_9. [DOI] [Google Scholar]
  • 26.Gautam S., Bundela P., Pandey A., Jamaluddin A. M. K., Sarsaiya S. Diversity of cellulolytic microbes and the biodegradation of municipal solid waste by a potential strain. International Journal of Microbiology . 2012;2012(1) doi: 10.1155/2012/325907.325907 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Lokhande S., Musaddiq M. Microflora degrading the municipal wastes by fungi. Indian Journal of Life Sciences . 2014;4(1):p. 13. [Google Scholar]
  • 28.Partanen P., Hultman J., Paulin L., Auvinen P., Romantschuk M. Bacterial diversity at different stages of the composting process. BMC Microbiology . 2010;10(1):1–11. doi: 10.1186/1471-2180-10-94. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Shivlata L., Satyanarayana T. Thermophilic and alkaliphilic Actinobacteria: biology and potential applications. Frontiers in Microbiology . 2015;6:p. 1014. doi: 10.3389/fmicb.2015.01014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Zhao Y., Lu Q., Wei Y., et al. Effect of actinobacteria agent inoculation methods on cellulose degradation during composting based on redundancy analysis. Bioresource Technology . 2016;219:196–203. doi: 10.1016/j.biortech.2016.07.117. [DOI] [PubMed] [Google Scholar]
  • 31.Pramila R., Ramesh K. V. Biodegradation of low density polyethylene (LDPE) by fungi isolated from marine water a SEM analysis. African Journal of Microbiology Research . 2011;5(28):5013–5018. doi: 10.5897/AJMR11.670. [DOI] [Google Scholar]
  • 32.Radhakrishnan S., Varadharajan M. Isolation, identification, and screening of polyene antifungal compound producing streptomyces sampsonii MDCE7 from Agroforestry Soil. In: Dharumadurai D., editor. Methods in actinobacteriology . Humana, New York, NY: Springer Protocols Handbooks; 2022. [DOI] [Google Scholar]
  • 33.Ismail Y., Yulvizar C., Mazhitov B. Characterization of lactic acid bacteria from local cow´s milk kefir. IOP Conference Series: Earth and Environmental Science . 2018;130(1) doi: 10.1088/1755-1315/130/1/012019.012019 [DOI] [Google Scholar]
  • 34.Tripathi N., Sapra A. Gram staining . StatPearls; 2020. [PubMed] [Google Scholar]
  • 35.MacWilliams M. P. Indole test protocol . Washington, DC: American Society for Microbiology; 2012. [Google Scholar]
  • 36.Reiner K. Catalase test protocol. American Society for Microbiology . 2010;1(1) [Google Scholar]
  • 37.MacWilliams M. P. Citrate test protocol . American Society for Microbiology; 2009. [Google Scholar]
  • 38.McDevitt S. Methyl red and voges-proskauer test protocols. American Society for Microbiology . 2009;8 [Google Scholar]
  • 39.Nakei M. D. Isolation and identification of plastics-degrading microorganisms From soils of Morogoro, Tanzania . Doctoral dissertation, Sokoine University of Agriculture; 2015. [Google Scholar]
  • 40.Peng Q., Wang X., Shang M., et al. Isolation of a novel alkaline-stable lipase from a metagenomic library and its specific application for milkfat flavor production. Microbial Cell Factories . 2014;13:1–9. doi: 10.1186/1475-2859-13-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Lee L. P., Karbul H. M., Citartan M., Gopinath S. C., Lakshmipriya T., Tang T.-H. Lipase-secreting Bacillus species in an oil-contaminated habitat: promising strains to alleviate oil pollution. BioMed Research International . 2015;2015(1) doi: 10.1155/2015/820575.820575 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Alariya S. S., Sethi S., Gupta S., Lal G. B., Lal G. Amylase activity of a starch degrading bacteria isolated from soil. Archives of Applied Science Research . 2013;5(1):15–24. [Google Scholar]
  • 43.Shivani D., Kumar J. S. Extracellular enzymatic profile of fungal deteriogens of historical palace of Ujjain. International Journal of Current Microbiology and Applied Sciences . 2015;4:122–132. [Google Scholar]
  • 44.Dela Cruz T. E. E., Torres J. M. O. Gelatin hydrolysis test protocol . American Society for Microbiology; 2012. [Google Scholar]
  • 45.Sambrook J. Molecular Cloning: A Laboratory Manual . Cold Spring Harbor Laboratory Press; 1989. [Google Scholar]
  • 46.Huang L.-N., Zhou H., Zhu S., Qu L.-H. Phylogenetic diversity of bacteria in the leachate of a full-scale recirculating landfill. FEMS Microbiology Ecology . 2004;50(3):175–183. doi: 10.1016/j.femsec.2004.06.008. [DOI] [PubMed] [Google Scholar]
  • 47.Saleemi M. K., Khan M. Z., Khan A., et al. Molecular identification of black aspergilli isolated from poultry feeds by sequencing their ITS-regions. Pakistan Veterinary Journal . 2012;32(2) [Google Scholar]
  • 48.Ashelford K. E., Chuzhanova N. A., Fry J. C., Jones A. J., Weightman A. J. New screening software shows that most recent large 16S rRNA gene clone libraries contain chimeras. Applied and Environmental Microbiology . 2006;72(9):5734–5741. doi: 10.1128/AEM.00556-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Altschul S. F., Gish W., Miller W., Myers E. W., Lipman D. J. Basic local alignment search tool. Journal of Molecular Biology . 1990;215(3):403–410. doi: 10.1016/S0022-2836(05)80360-2. [DOI] [PubMed] [Google Scholar]
  • 50.Saitou N., Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution . 1987;4(4):406–425. doi: 10.1093/oxfordjournals.molbev.a040454. [DOI] [PubMed] [Google Scholar]
  • 51.Kumar S., Stecher G., Li M., Knyaz C., Tamura K. MEGA X: molecular evolutionary genetics analysis across computing platforms. Molecular Biology and Evolution . 2018;35(6):1547–1549. doi: 10.1093/molbev/msy096. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Tamura K., Nei M., Kumar S. Prospects for inferring very large phylogenies by using the neighbor-joining method. Proceedings of the National Academy of Sciences of the United States of America . 2004;101(30):11030–11035. doi: 10.1073/pnas.0404206101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Felsenstein J. Confidence limits on phylogenies: an approach using the bootstrap. Evolution . 1985;39(4):783–791. doi: 10.2307/2408678. [DOI] [PubMed] [Google Scholar]
  • 54.Wang Q., Garrity G. M., Tiedje J. M., Cole J. R. Naive Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy. Applied and Environmental Microbiology . 2007;73(16):5261–5267. doi: 10.1128/AEM.00062-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Mandal C., Tabassum T., Shuvo M. J., Habib A. Biochemical and molecular identification of antibiotic-producing bacteria from waste dumpsite soil. Journal of Advanced Biotechnology and Experimental Therapeutics . 2019;2(3):120–126. doi: 10.5455/jabet.2019.d34. [DOI] [Google Scholar]
  • 56.Danilova I., Sharipova M. The practical potential of bacilli and their enzymes for industrial production. Frontiers in Microbiology . 2020;11:p. 1782. doi: 10.3389/fmicb.2020.01782. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Abubakar A., Abioye O., Aransiola S., Maddela N. R., Prasad R. Crude oil biodegradation potential of lipase produced by Bacillus subtilis and Pseudomonas aeruginosa isolated from hydrocarbon contaminated soil. Environmental Chemistry and Ecotoxicology . 2024;6:26–32. doi: 10.1016/j.enceco.2023.12.001. [DOI] [Google Scholar]
  • 58.Prasad M., Manjunath K. Comparative study on biodegradation of lipid-rich wastewater using lipase producing bacterial species . Indian Journal of Biotechnology; 2011. [Google Scholar]
  • 59.Khandare S. D., Agrawal D., Mehru N., Chaudhary D. R. Marine bacterial based enzymatic degradation of low-density polyethylene (LDPE) plastic. Journal of Environmental Chemical Engineering . 2022;10(3) doi: 10.1016/j.jece.2022.107437.107437 [DOI] [Google Scholar]
  • 60.Asiandu A. P., Wahyudi A., Sari S. W. A review: plastics waste biodegradation using plastics-degrading bacteria. Journal of Environmental Treatment Techniques . 2021;9(1):148–157. [Google Scholar]
  • 61.Yamamoto-Tamura K., Hiradate S., Watanabe T., et al. Contribution of soil esterase to biodegradation of aliphatic polyester agricultural mulch film in cultivated soils. AMB Express . 2015;5(1):1–8. doi: 10.1186/s13568-014-0088-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Contesini F. J., Melo R. R., Sato H. H. An overview of Bacillus proteases: from production to application. Critical Reviews in Biotechnology . 2018;38(3):321–334. doi: 10.1080/07388551.2017.1354354. [DOI] [PubMed] [Google Scholar]
  • 63.Chatterjee S., Sharma S., Prasad R. K., et al. Cellulase enzyme based biodegradation of cellulosic materials: an overview. Cellulose . 2015;5(6):271–282. [Google Scholar]
  • 64.Akhtar N., Goyal D., Goyal A. Advances in Biodegradation and Bioremediation of Industrial Waste . USA: CRC Press; 2015. Biodegradation of cellulose and agricultural waste material; pp. 211–234. [Google Scholar]
  • 65.Nanda S., Sahu S., Abraham J. Studies on the biodegradation of natural and synthetic polyethylene by Pseudomonas spp. Journal of Applied Sciences and Environmental Management . 2010;14(2) doi: 10.4314/jasem.v14i2.57839. [DOI] [Google Scholar]
  • 66.Savich V., Novik G. Waste biodegradation and utilization by Pseudomonas species. Journal of Microbiology, Biotechnology and Food Sciences . 2021;6(2):851–857. doi: 10.15414/jmbfs.2016.6.2.851-857. [DOI] [Google Scholar]
  • 67.Sharma S., Pathak H. Pseudomonas in biodegradation. International Journal of Pure & Applied Bioscience . 2014;2(2):213–222. [Google Scholar]
  • 68.Lamilla C., Pavez M., Santos A., Hermosilla A., Llanquinao V., Barrientos L. Bioprospecting for extracellular enzymes from culturable Actinobacteria from the South Shetland Islands, Antarctica. Polar Biology . 2017;40(3):719–726. doi: 10.1007/s00300-016-1977-z. [DOI] [Google Scholar]
  • 69.Al-Dhabi N. A., Esmail G. A., Ghilan A.-K. M., Arasu M. V. Isolation and screening of Streptomyces sp. Al-Dhabi-49 from the environment of Saudi Arabia with concomitant production of lipase and protease in submerged fermentation. Saudi Journal of Biological Sciences . 2020;27(1):474–479. doi: 10.1016/j.sjbs.2019.11.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Amore A., Pepe O., Ventorino V., Birolo L., Giangrande C., Faraco V. Cloning and recombinant expression of a cellulase from the cellulolytic strain Streptomyces sp. G12 isolated from compost. Microbial Cell Factories . 2012;11(1):1–12. doi: 10.1186/1475-2859-11-164. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Gohain A., Manpoong C., Saikia R., De Mandal S. Recent advancements in microbial diversity . Academic Press; 2020. Actinobacteria: diversity and biotechnological applications; pp. 217–231. [DOI] [Google Scholar]
  • 72.Zada S., Xie J., Yang M., et al. Composition and functional profiles of microbial communities in two geochemically and mineralogically different caves. Applied Microbiology and Biotechnology . 2021;105(23):8921–8936. doi: 10.1007/s00253-021-11658-4. [DOI] [PubMed] [Google Scholar]
  • 73.Anastasi A., Varese G. C., Filipello Marchisio V. Isolation and identification of fungal communities in compost and vermicompost. Mycologia . 2005;97(1):33–44. doi: 10.3852/mycologia.97.1.33. [DOI] [PubMed] [Google Scholar]
  • 74.Rouhullah D., Mohammad Ali A., Esmail C., et al. Identification of fungal communities in producing compost by windrow method. Journal of Environmental Protection . 2012;3(1):61–67. [Google Scholar]
  • 75.Krikstaponis A., Lugauskas A., Krysinska-Traczyk E., Prazmo Z., Dutkiewicz J. Enzymatic activities of Aspergillus fumigatus strains isolated from the air at waste landfills. Annals of Agricultural and Environmental Medicine . 2001;8(2):227–234. [PubMed] [Google Scholar]
  • 76.El Barnossi A., Moussaid F., Iraqi H. Study of mycoflora associated with the decomposition of solid green household waste in the natural environment. Asian Journal of Microbiology, Biotechnology and Environmental Sciences . 2019;21:46–53. [Google Scholar]
  • 77.Cihangir N., Sarikaya E. Investigation of lipase production by a new isolate of Aspergillus sp. World Journal of Microbiology and Biotechnology . 2004;20(2):193–197. doi: 10.1023/B:WIBI.0000021781.61031.3a. [DOI] [Google Scholar]
  • 78.Contesini F. J., Lopes D. B., Macedo G. A., da Graça Nascimento M., de Oliveira Carvalho P. Aspergillus sp. lipase: potential biocatalyst for industrial use. Journal of Molecular Catalysis B: Enzymatic . 2010;67(3–4):163–171. doi: 10.1016/j.molcatb.2010.07.021. [DOI] [Google Scholar]
  • 79.Basheer S. M., Chellappan S., Beena P., Sukumaran R. K., Elyas K., Chandrasekaran M. Lipase from marine Aspergillus awamori BTMFW032: production, partial purification and application in oil effluent treatment. New Biotechnology . 2011;28(6):627–638. doi: 10.1016/j.nbt.2011.04.007. [DOI] [PubMed] [Google Scholar]
  • 80.Sethi B. K., Nanda P. K., Sahoo S. Characterization of biotechnologically relevant extracellular lipase produced by Aspergillus terreus NCFT 4269.10. Brazilian Journal of Microbiology . 2016;47(1):143–149. doi: 10.1016/j.bjm.2015.11.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81.Muhammad B. A. O. A. A., Okiki P. A. Cellulase production by fungi isolated from Odo-Aremu dumpsite in Ado-Ekiti, Nigeria. Enzyme . 2016;46 [Google Scholar]
  • 82.Ogbonna C., Okpokwu N., Okafor C., Onyia C. Isolation and screening of amylase producing fungi obtained from garri processing site. International Journal of Biotechnology and Food Science . 2014;2(5):88–93. [Google Scholar]
  • 83.Abdullah R., Shaheen N., Iqtedar M., Naz S., Iftikhar T. Optimization of cultural conditions for the production of alpha amylase by Aspergillus niger (BTM-26) in solid state fermentation. Pakistan Journal of Botany . 2014;46(3):1071–1078. [Google Scholar]
  • 84.Asrat B., Girma A. Isolation, production and characterization of amylase enzyme using the isolate Aspergillus niger FAB-211. International Journal of Biotechnology and Molecular Biology Research . 2018;9(2):7–14. doi: 10.5897/IJBMBR2018.0289. [DOI] [Google Scholar]
  • 85.Ratnasri P., Lakshmi B., Ambika Devi K., Hemalatha K. Isolation, characterization of Aspergillus fumigatus and optimization of cultural conditions for amylase production. International Journal of Research in Engineering & Technology . 2014;3(2):457–463. doi: 10.15623/ijret.2014.0302080. [DOI] [Google Scholar]
  • 86.Su N., Lee M. Screening and characterization of koji molds producing saline-tolerant protease. Journal of Industrial Microbiology and Biotechnology . 2001;26(4):230–234. doi: 10.1038/sj.jim.7000118. [DOI] [PubMed] [Google Scholar]
  • 87.Liang Y., Pan L., Lin Y. Analysis of extracellular proteins of Aspergillus oryzae grown on soy sauce koji. Bioscience, Biotechnology, and Biochemistry . 2009;73(1):192–195. doi: 10.1271/bbb.80500. [DOI] [PubMed] [Google Scholar]
  • 88.Oyeleke S., Egwim E. C., Auta S. Screening of Aspergillus flavus and Aspergillus fumigatus strains for extracellular protease enzyme production. Journal of Microbiology and Antimicrobials . 2010;2(7):83–87. [Google Scholar]
  • 89.Martiny A. C. High proportions of bacteria are culturable across major biomes. The ISME Journal . 2019;13(8):2125–2128. doi: 10.1038/s41396-019-0410-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 90.Atieno B. Bioprospecting for potential useful microorganisms from Mwakirunge dumpsite in Mombasa County, Kenya . Diss. TUM; 2023. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data that support the findings of this study are openly available in NCBI at https://ncbi.nlm.nih.gov/.

Articles from International Journal of Microbiology are provided here courtesy of Wiley

RESOURCES