Key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | Anti-laminin alpha 1 rabbit polyclonal (1° ab) | Sigma | L9393 | 1:100 |
| Antibody | Anti-laminin 1 mouse monoclonal (1° ab) | DSHB | 3H11 | 1:10 |
| Antibody | Anti-perlecan mouse monoclonal (1° ab) | DSHB | 5C9 | 1:10 |
| Antibody | Anti-nidogen mouse monoclonal (1° ab) | DSHB | 1G12 | 1:10 |
| Antibody | Anti-fibronectin mouse monoclonal (1° ab) | DSHB | VA1(3) | 1:5 |
| Antibody | Anti-fibronectin mouse monoclonal (1° ab) | DSHB | B3/D6 | 1:30 |
| Antibody | Anti-fibronectin rabbit polyclonal (1° ab) | Sigma | F3648 | 1:400 |
| Antibody | Anti-GM130 mouse monoclonal (1° ab) | BD Biosciences | 610822 | 1:250 |
| Antibody | Alexa Fluor 568 goat anti-rabbit (2° ab) | Invitrogen | A-11031 | 1:500 |
| Antibody | Alexa Fluor 647 donkey anti-rabbit (2° ab) | Invitrogen | A32795 | 1:500 |
| Antibody | Alexa Fluor 488 goat anti-mouse (2° ab) | Invitrogen | A32723 | 1:500 |
| Other | DAPI | Thermo Fisher | D1306 | 1:2000, nuclear DNA counterstain |
| Chemical compound, drug | Dextran, Fluorescein, 3000 MW, lysine fixable, anionic | Thermo Fisher | D3306 | |
| Chemical compound, drug | AMD3100-Bodipy | Poty et al., 2015 | 5 mg/ml | |
| Chemical compound, drug | CM-DiI | Invitrogen | C7000 | |
| Chemical compound, drug | SP-DiO | Invitrogen | D7778 | |
| Recombinant DNA reagent | Plasmid for chordin riboprobe (chicken) | Cliff Tabin lab | T691 | |
| Recombinant DNA reagent | Plasmid for lefty1 riboprobe (chicken) | Cepko/Tabin lab | T607 | |
| Recombinant DNA reagent | pCAGEN (plasmid) | Connie Cepko | RRID:Addgene_11160 | |
| Recombinant DNA reagent | pCAG-GFP (plasmid) | Connie Cepko | RRID:Addgene_11150 | |
| Recombinant DNA reagent | pCI-H2B-RFP (plasmid) | Addgene | RRID:Addgene_92398 | |
| Recombinant DNA reagent | Ntn4-AP-His (plasmid) | Addgene | RRID:Addgene_71980 | |
| Sequence-based reagent | F primer for chicken LAMA1 riboprobe from cDNA | This paper | ACGGAGAGTTTGGCAGATGA | |
| Sequence-based reagent | R primer for chicken LAMA1 riboprobe from cDNA | This paper | ATCCTGAGCCCAAATCCCAA | |
| Sequence-based reagent | 5’ primer for cloning Ntn4 coding region out of RRID:Addgene_71980 and into pCAGEN (XhoI and NotI) | This paper | ATGCCTCGAGATATCgccaccatggggagctg | |
| Sequence-based reagent | 3’ primer for cloning Ntn4 coding region out of RRID:Addgene_71980 and into pCAGEN (XhoI and NotI) | This paper |
CTAGCGGCCGCGGATCCATCGATTATTA
CACGCAGTCTCTTTTTAAGATGTGCA |
|
| Commercial assay or kit | PCR cloning kit (with pDrive plasmid) | QIAGEN | 231124 | |
| Other | Fertilized chicken eggs | Westwind Farms (Interlaken, NY, USA, http://chickenhawkfood.com). | Eggs used for embryo manipulation and collection as described in Materials and methods | |
| Other | Veiled chameleon eggs | Reptiles and Aquatics Facility at Stowers Institute for Medical Research | Eggs used for embryo manipulation and collection as described in Materials and methods | |
| Other | AG beads | Bio-Rad | 143-1255 | Resin beads for surgical implantation and drug diffusion as described in Materials and methods |