Skip to main content
. 2025 Apr 29;12:RP89494. doi: 10.7554/eLife.89494

Key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Antibody Anti-laminin alpha 1 rabbit polyclonal (1° ab) Sigma L9393 1:100
Antibody Anti-laminin 1 mouse monoclonal (1° ab) DSHB 3H11 1:10
Antibody Anti-perlecan mouse monoclonal (1° ab) DSHB 5C9 1:10
Antibody Anti-nidogen mouse monoclonal (1° ab) DSHB 1G12 1:10
Antibody Anti-fibronectin mouse monoclonal (1° ab) DSHB VA1(3) 1:5
Antibody Anti-fibronectin mouse monoclonal (1° ab) DSHB B3/D6 1:30
Antibody Anti-fibronectin rabbit polyclonal (1° ab) Sigma F3648 1:400
Antibody Anti-GM130 mouse monoclonal (1° ab) BD Biosciences 610822 1:250
Antibody Alexa Fluor 568 goat anti-rabbit (2° ab) Invitrogen A-11031 1:500
Antibody Alexa Fluor 647 donkey anti-rabbit (2° ab) Invitrogen A32795 1:500
Antibody Alexa Fluor 488 goat anti-mouse (2° ab) Invitrogen A32723 1:500
Other DAPI Thermo Fisher D1306 1:2000, nuclear DNA counterstain
Chemical compound, drug Dextran, Fluorescein, 3000 MW, lysine fixable, anionic Thermo Fisher D3306
Chemical compound, drug AMD3100-Bodipy Poty et al., 2015 5 mg/ml
Chemical compound, drug CM-DiI Invitrogen C7000
Chemical compound, drug SP-DiO Invitrogen D7778
Recombinant DNA reagent Plasmid for chordin riboprobe (chicken) Cliff Tabin lab T691
Recombinant DNA reagent Plasmid for lefty1 riboprobe (chicken) Cepko/Tabin lab T607
Recombinant DNA reagent pCAGEN (plasmid) Connie Cepko RRID:Addgene_11160
Recombinant DNA reagent pCAG-GFP (plasmid) Connie Cepko RRID:Addgene_11150
Recombinant DNA reagent pCI-H2B-RFP (plasmid) Addgene RRID:Addgene_92398
Recombinant DNA reagent Ntn4-AP-His (plasmid) Addgene RRID:Addgene_71980
Sequence-based reagent F primer for chicken LAMA1 riboprobe from cDNA This paper ACGGAGAGTTTGGCAGATGA
Sequence-based reagent R primer for chicken LAMA1 riboprobe from cDNA This paper ATCCTGAGCCCAAATCCCAA
Sequence-based reagent 5’ primer for cloning Ntn4 coding region out of RRID:Addgene_71980 and into pCAGEN (XhoI and NotI) This paper ATGCCTCGAGATATCgccaccatggggagctg
Sequence-based reagent 3’ primer for cloning Ntn4 coding region out of RRID:Addgene_71980 and into pCAGEN (XhoI and NotI) This paper CTAGCGGCCGCGGATCCATCGATTATTA
CACGCAGTCTCTTTTTAAGATGTGCA
Commercial assay or kit PCR cloning kit (with pDrive plasmid) QIAGEN 231124
Other Fertilized chicken eggs Westwind Farms (Interlaken, NY, USA, http://chickenhawkfood.com). Eggs used for embryo manipulation and collection as described in Materials and methods
Other Veiled chameleon eggs Reptiles and Aquatics Facility at Stowers Institute for Medical Research Eggs used for embryo manipulation and collection as described in Materials and methods
Other AG beads Bio-Rad 143-1255 Resin beads for surgical implantation and drug diffusion as described in Materials and methods