Abstract
Background
Rotavirus A (RVA) is an important pathogen causing acute viral gastroenteritis in young children and various animals. RVA is also recognized as a common cause of gastroenteritis in piglets. Epidemiological studies of porcine RVA (PoRVA) conducted in different settings worldwide reported that the prevalence of PoRVA infection ranged from 9.4% to 74.0% with the predominance of G4P[6], G4P[7], and G5P[7] genotypes. In Thailand, long-term epidemiological surveillance of PoRVA infection is limited. Continuous monitoring of PoRVA infection is required to gain a better understanding the prevalence and evolution of PoRVA. In this study, the prevalence and genetic diversity of PoRVA were investigated by screening of 1,260 stool samples collected from 0 to 5-week-old piglets with acute diarrhea during 2016 to 2023 by using real-time RT-PCR. The G- and P-genotypes of RVA were identified by characterization of the partial VP7 and VP4 genes by using multiplex-PCR, nucleotide sequencing, and phylogenetic analysis.
Results
A total of 303 out of 1,260 (24.0%) samples were positive for PoRVA. Overall, the G5P[23] (28.7%) and G4P[23] (28.4%) were detected as the co-predominant PoRVA genotypes, followed by G5P[13] (9.9%), G3P[23] (9.6%), G9P[23] (8.2%), G4P[13] (7.9%), G9P[13] (3.3%), G3P[13] (1.7%), G4P[6] (1.7%), and G2P[23] (0.3%) genotypes. Additionally, a rare G2P[27] (0.3%) genotype re-emerged approximately 22 years after the initial detection in 2000 in Chiang Mai, Thailand.
Conclusion
Our results revealed the prevalence of wide variety of PoRVA genotypes circulating in piglets with acute diarrhea in Thailand over a study period of seven years. Of these, G5P[23] and G4P[23] emerged as the most predominant genotypes, which were substantially different from previous reports in the same geographical area. The findings offer valuable contribution to a better understanding of molecular epidemiology and evolution of PoRVA in piglets with acute diarrhea.
Keywords: Rotavirus, Porcine, Piglet, Diarrhea, Thailand
Background
Rotaviruses (RVs) are the leading cause of acute diarrhea in young children and various animal species [1, 2]. RVs belong to the genus Rotavirus of the Sedoreoviridae family in the order Reovirales. The viral particle exhibits an icosahedral capsid containing three capsid protein layers of 65 to 75 nm in diameter. The RV genome consists of 11 segments of double-stranded RNA (dsRNA), which encode 6 structural viral proteins (VP1–VP4, VP6, and VP7) and 6 nonstructural proteins (NSP1–NSP6) [3]. RVs are classified into 9 groups (A to D and F to J) based on the molecular and antigenic characteristics of the VP6 protein. Among these, rotavirus A (RVA), RVB, RVC, and RVH have been identified in pig herds worldwide [4, 5]. Among the RV groups, RVA is considered the most common cause of enteric disease in humans and various animal species from a medical and veterinary health perspective, including suckling piglets within the first 8 weeks after birth [6–8]. The RVA strains have been classified by dual classification system based on antigenic and sequence differences of the outer capsid proteins, VP7 and VP4 proteins, into G (glycosylated) and P (protease-sensitive) genotypes, respectively [3].
For porcine RVA (PoRVA), the estimated prevalence of PoRVA infection in piglets with acute diarrhea reported from several countries worldwide, ranged from 9.4% to 74.0% [9–15]. The G3, G4, G5, G9, and G11 are the common G genotypes and frequently combine with the P[6], P[7], P[13], P[19], P[23], and P[26] genotypes. Globally, G5P[7], G4P[6], and G4P[7] were the most common PoRVA strains found in pigs [6]. During epidemiological surveillance of swines with acute diarrhea in Thailand from 2000 to 2016, the prevalence of PoRVA infection ranged from 9.5% to 23.0% [15–21]. In 2000 and 2001, The G3P[19] was detected as a co-predominant genotype with G4P[6] of PoRVA strains circulating in the Chiang Mai area [16], and a novel G2P[27] genotype was also detected for the first time in this area in 2000 [22]. Okitsu et al. [21] reported that the most widespread genotype observed in diarrheic piglets in Northern Thailand from 2006 to 2008 was G9P[23], followed by G3P[23] and G3P[13]. From 2009 to 2010, the PoRVA strains with a wide variety of G-P combinations were detected in two provinces (Chiang Mai and Lamphun) in Thailand, and the most predominant PoRVA strain was G4P[6], followed by G4P[23] and G3P[23]. Moreover, novel genotype combinations of G4P[19] and G9P[19] were also detected for the first time in piglets with diarrhea [19]. From 2011 to 2014, the G4P[13] genotype was reported as the most dominant PoRVA genotype circulating among piglets with diarrhea in the same area [17]. In addition, from 2011 to 2016, a multi-site surveillance study of PoRVA infection in swine reported the diversity of PoRVA strains in Thailand. The samples were chosen randomly from the RVA-positive samples obtained from commercial pig farms located throughout Thailand, and most of them were G9P[13] and G9P[23] genotypes [18].
According to the previous studies of PoRVA in Thailand, G3P[19], G4P[6], G9P[13], and G9P[23] were identified as dominant genotypes from 2000 to 2016. However, there is a lack of continuous long-term epidemiological surveillance of PoRVA to monitor the changing of PoRVA genotypes circulating in Thailand. Therefore, this study aimed to further investigate the epidemiology of PoRVA and conducted molecular characterization and phylogenetic analysis of PoRVA circulating in piglets with acute diarrhea across several farms in Northern Thailand from 2016 to 2023. Continuous monitoring of PoRVA infections in pigs can improve our understanding of the epidemiology and evolution of these PoRVA strains in the recent years.
Materials and methods
Specimen collection
A total of 1,260 fecal specimens were collected from piglets at the age of newborn to 5 weeks that exhibited acute diarrhea (indicated by watery or loose stools persisting for at least 12 h) raised in 41 commercial pig farms located in Chiang Mai, Lamphun, and Uttaradit provinces in Northern Thailand (Fig. 1). One specimen was collected from one pig pen, and it represented a sample of a litter. The specimen collection periods were from January 2016 to December 2017 and January 2019 to December 2023. Due to the global outbreak of African swine fever (AFS) in 2018, the access to pig farms was prohibited, therefore, the stool specimen of 2018 was not collected, and the time period was excluded from this study. All fecal samples were stored at -20°C until used.
Fig. 1.
Thailand map of the three provinces where the stool specimens were collected
Viral RNA extraction and detection of PoRVA by RT-qPCR
The viral RNA genome was extracted from 10% (w/v) stool suspension in 1X phosphate-buffered saline (PBS) at pH 7.4 by using Geneaid Viral Nucleic Acid Extraction Kit II (Geneaid, Taipei, Taiwan) following the manufacturer's instructions. The extracted viral RNA was denatured by heating in a 50% dimethyl sulfoxide (DMSO) solution at 95 °C for 5 min, followed by cooling on ice. The conversion of viral RNA into complementary DNA (cDNA) was then performed using the RevertAid First Strand cDNA Synthesis kit with random primers (Thermo Scientific, MA, USA). The cDNA was detected by quantitative PCR (qPCR) and a cycle threshold (Ct) value less than 40 was considered positive for PoRVA. Nuclease-free water was used as a negative control. The qPCR reaction mixture (20 μl) consisted of 10 μl of 2 × THUNDERBIRD® Probe qPCR Master Mix (TOYOBO, Osaka, Japan), 10 nM (0.8 μl/reaction) of forward JVKF and reverse JVKR primers, 0.4 μl of JVKP probe and 6.0 μl of nuclease-free water, and 2 μl of cDNA template. The forward primer JVKF (5′- CAGTGGTTGATGCTCAAGATGGA -3′), reverse primer JVKR (5′- TCATTGTAATCATATTGAATACCCA -3′), and probe JVKP (FAM- ACAACTGCAGCTTCAAAAGAAGWGT- MGB) were used for specific detection of PoRVA nucleic acid by targeting on the conserved region within the NSP3 gene [23]. The experiment was performed in a CFX Opus Real-Time PCR System (Bio-Rad, CA, USA). The thermocycling conditions were as follows: 95°C for 1 min, followed by 40 cycles at 95 °C for 15 s and 56 °C for 1 min. The results were analyzed using the CFX Maestro Software. The baseline was automatically set, and the threshold was manually placed during the exponential phase of the amplification reaction.
Identification of PoRVA G- and P-genotypes, nucleotide sequencing, and phylogenetic analysis
The semi-nested polymerase chain reaction (PCR) was used to identify G-genotypes (VP7) and P-genotypes (VP4) using specific primers as described previously [24–27]. For G-genotype, the initial PCR was performed by amplifying the partial VP7 gene using the sBeg9 forward primer in combination with the End9(s) reverse primer, yielding a product of 941 bp [26, 28]. The Con3 forward primer and the Con2 reverse primer were used for the P-genotype to amplify the partial VP4 gene with a specific PCR product of 887 bp [29]. Subsequently, multiplex-PCR was performed by using the initial PCR product from semi-nested PCR as the template, and specific primers for G3-G5, and G9 [25, 26] and P[6], P[7], P[13], P[23], and P[19] [16, 17, 21, 26] were used for G- and P-genotyping, respectively. The RVA strains that their G- and/or P-genotypes could not be identified by specific primers were further characterized by nucleotide sequencing and phylogenetic analysis. The PCR products were purified using a Gel/PCR DNA Fragments Extraction Kit using the manufacturer's procedure (Geneaid, Taipei, Taiwan), and then sequenced (First BASE Laboratories Sdn Bhd, Selangor Darul Ehsan, Malaysia). The obtained nucleotide sequences were analyzed using the Basic Local Alignment Search Tool (BLAST) server (http://blast.ncbi.nlm.nih.gov/Blast.cgi) and compared with those of the reference strains available in the GenBank database. The phylogenetic trees of VP7 and VP4 genes of PoRVA were constructed by using Molecular Evolutionary Genetics Analysis version 10 (MEGA X) software based on the maximum likelihood method and selected the best-fit evolutionary model based on the Bayesian information score (BIC) [30]. The models used in this study were Hasegawa-Kishino-Yano + G + I (HKY + G + I) for VP7 and Tamura 3-parameter + G + I (T93 + G + I) for VP4. A bootstrap of 1000 replicates was used to assess the reliability of the branching order.
Statistical analysis
The statistical analyses were performed using IBM SPSS version 27.0 software. Categorical variables were analyzed using the Fisher’s exact test. The p-values for each comparison were also calculated, and p-value less than or equal to 0.05 (≤ 0.05) was considered statistically significant.
Results
Prevalence of PoRVA and distribution of RVA strains in piglets with acute diarrhea
A total of 1,260 stool samples were screened for PoRVA by RT-qPCR and 303 (24.0%) were positive. As shown in Fig. 2, the prevalence of PoRVA infection in Thai swine gradually increased from 4.6% in 2016 to 8.8%, 11.6%, and 27.1% in 2017, 2019, and 2020, respectively. Then, there was a slight decline from 33.3% in 2021 to 29.4% in 2022, followed by a noticeable rise to 39.6% in 2023. Overall, the prevalence of PoRVA infection in piglets with acute diarrhea from 2016 to 2023 was 24.0%. To compare the prevalence trends and to identify the significant changes, the Fisher’s exact test was performed in this study. The statistical analyses revealed that the prevalence of PoRVA in 2023 was significantly higher than those in 2016, 2017, 2019, 2020, 2021, and 2022 with the p-values of < 0.001, < 0.001, < 0.001, < 0.002, 0.001, and < 0.001, respectively. Similarly, the prevalence of PoRVA in each year of 2020, 2021, and 2022 was significantly higher than those of 2016, 2017, and 2019, respectively, with the p-values of ≤ 0.001. The remaining years did not show statistically significant differences. Moreover, the significant increase in PoRVA prevalence was also observed when comparing the early years (2016 to 2019) with the later years (2020 to 2023) with the p-values of 0.0024.
Fig. 2.
Prevalence of porcine rotavirus A in piglets with acute diarrhea in Northern Thailand from 2016 to 2023
Distribution of PoRVA genotypes in piglets with acute diarrhea
The distributions of G- and P-genotype combinations of PoRVA in piglets with acute diarrhea are shown in Table 1. The G5P[23] (28.7%) and G4P[23] (28.4%) were detected with high prevalence. Other genotypes including G5P[13], G3P[23], G4P[13], and G9P[23] were detected at the prevalent rates of 9.9%, 9.6%, 7.9%, and 8.2%, respectively. Moreover, G9P[13] (3.3%), G3P[13] (1.7%), G4P[6] (1.7%), and G2P[23] (0.3%) were detected with less prevalent rates. In addition, the unusual G- and P- genotype, G2P[27], was detected at the prevalence of 0.3%. Notably, even though overall prevalences of G5P[23] and G4P[23] were the most predominant genotypes detected in this study, G5P[23] was undetectable from 2017 to 2021, and suddenly emerged with exceptionally high prevalences from 2022 to 2023. Similarly, G4P[23] was also undetectable during the period of 2016 to 2020 and suddenly emerged with exceptionally high prevalences in 2021 to 2023.
Table 1.
Distribution of G- and P-genotype combinations of porcine rotavirus A strains circulating in piglets with acute diarrhea in Northern Thailand from 2016 to 2023
| RVA genotypes | 2016 (%) | 2017(%) | 2019(%) | 2020(%) | 2021(%) | 2022(%) | 2023(%) | Total (%) |
|---|---|---|---|---|---|---|---|---|
| G2P[23] | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 1 (1.1) | 0 (0.0) | 1 (0.3) |
| G2P[27] | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 1 (1.1) | 0 (0.0) | 1 (0.3) |
| G3P[13] | 1 (7.7) | 0 (0.0) | 0 (0.0) | 1 (5.3) | 0 (0.0) | 1 (1.1) | 2 (1.3) | 5 (1.7) |
| G3P[23] | 9 (69.2) | 2 (20.0) | 0 (0.0) | 12 (63.1) | 0 (0.0) | 0 (0.0) | 6 (4.0) | 29 (9.6) |
| G4P[6] | 0 (0.0) | 2 (20.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 3 (3.4) | 0 (0.0) | 5 (1.7) |
| G4P[13] | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 3 (20.0) | 4 (4.6) | 17 (11.3) | 24 (7.9) |
| G4P[23] | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 12 (80.0) | 27 (30.7) | 47 (31.3) | 86 (28.4) |
| G5P[13] | 1 (7.7) | 5 (50.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 7 (8.0) | 17 (11.3) | 30 (9.9) |
| G5P[23] | 2 (15.4) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 44 (50.0) | 41 (27.3) | 87 (28.7) |
| G9P[13] | 0 (0.0) | 1 (10.0) | 1 (12.5) | 1 (5.3) | 0 (0.0) | 0 (0.0) | 7 (4.7) | 10 (3.3) |
| G9P[23] | 0 (0.0) | 0 (0.0) | 7 (87.5) | 5 (26.3) | 0 (0.0) | 0 (0.0) | 13 (8.8) | 25 (8.2) |
| Total | 13 (4.3) | 10 (3.3) | 8 (2.6) | 19 (6.3) | 15 (5.0) | 88 (29.0) | 150 (49.5) | 303 (100) |
Phylogenetic analysis of VP7 and VP4 genes
The PoRVA positive samples that their G-genotypes and P-genotypes could not be identified by multiplex PCR using genotype-specific primers, their genotypes were identified by nucleotide sequencing and phylogenetic analysis.
The phylogenetic tree of the VP7 gene of PoRVA strains is shown in Fig. 3. The phylogenetic tree of nucleotide sequences of a partial VP7 gene (375 nt) of 34 PoRVA representative strains detected in this study was analyzed together with those of the RVA reference sequences available in the GenBank database. The analysis revealed that 5 different PoRVA genotypes, including G2, G3, G4, G5, and G9 were detected in this study. A G2 PoRVA strain CMP200-22 shared the highest nucleotide sequence identity with the G2 PoRVA strain OH365-055 detected in Canada [31] at 85.5%. Furthermore, the CMP200-22 strain also shared a close genetic relationship with several G2 RVA reference strains detected in pigs and humans reported previously from Thailand [22] and USA [32], with the nucleotide sequence identities ranging from 79.4% to 84.6%. In addition, 8 strains of G3 detected in this study clustered closely with the G3P[19] PoRVA strains CMP096 and CMP099 [16] reported from Chiang Mai, Thailand in 2000 with nucleotide sequence identities of 89.4% and 97.8%, respectively. For G4 genotype, our 2 strains of G4 (CMP97-17 and CMP98-17) detected in 2017 were most closely related to the PoRVA G4P[6] strain SCGY-198 reported from China. The other 8 strains of G4 (CMP01-21, CMP04-21, CMP39-21, CMP176-22, CMP185-22, CMP304-23, CMP325-23, and CMP379-23) clustered closely with G4 reference strains detected in pigs, a wild boar, and humans from Thailand [20], Vietnam [33], and China [34] with the nucleotide sequence identities ranging from 92.9% to 96.4%. Six strains of G5 (CMP31-16, CMP107-17, CMP228-22, CMP238-22, CMP302-22, and CMP355-22) detected in this study were located most closely in the same branch with PoRVA G5P[13] strain CMP-001-12 reported previously from Thailand [17] with the nucleotide sequence identities ranging from 92.9% to 94.7%. The other 4 strains of G5 (CMP25-16, CMP40-17, CMP41-17, and CMP43-17) showed a close genetic relationship with 4 reference strains of G5 reported from China [35] with the nucleotide sequence identities ranging from 94.2% to 96.0%. One of our G9 PoRVA strain CMP106-17 detected in this study displayed high nucleotide sequence identity with the G9P[23] strain previously detected in a wild pig from Taiwan [36] at 85.9%. The other 4 strains of G9 (CMP64-19, CMP66-19, CMP15-20, and CMP17-20) were closely related to those of G9 reference strains circulating Thailand [18, 37, 38] with the nucleotide sequence identities ranging from 98.1% to 100%.
Fig. 3.

Phylogenetic analysis of porcine rotavirus A based on partial nucleotide sequences of VP7 gene (375 nt). The tree was constructed using MEGA X software via the HKY + G + I as the best-fit evolutionary model. The representatives of porcine rotavirus A strains detected in this study are presented in boldface with purple (2016), green (2017), light blue (2019), orange (2020), dark blue (2021), pink (2022), and red (2023) colors filled circles. Bootstrap values above 80 percent are shown at separate nodes
The phylogenetic tree of the VP4 gene of PoRVA strains is shown in Fig. 4. The phylogenetic tree of the VP4 nucleotide sequence (759 nt) of 36 PoRVA representative strains detected in this study was analyzed together with the RVA reference strains. It was found that 5 P different genotypes, including P[6], P[13], P[19], P[23], and P[27] were detected. Three strains of P[6] (CMP97-17, CMP98-17, and CMP274-22) clustered closely together with P[6] human and PoRVA reference strains of P[6] reported from Thailand [18, 39, 40], and Russia [41], with high nucleotide sequence identities ranging from 91.3% to 97.8%. For P[13] genotype, 2 strains of P[13] (CMP43-17 and CMP273-22) were closely related to P[13] reference strains reported from Thailand [20, 40], and China [35] with the nucleotide sequence identities ranging from 92.2% to 96.1%. The other 3 strains of P[13] (CMP302-23, CMP304-23, and CMP361-23) were located closely in the same branch with P[13] reference strains reported from China [35] with nucleotide sequence identities ranging from 93.8% to 97.8%. Moreover, only one strain of P[19] (CMP25-16) PoRVA detected in this study clustered together with P[19] reference strains isolated from a human and pigs in Chiang Mai, Thailand [42] with nucleotide sequence identities ranging from 96.4% to 98.1%. Furthermore, the majority of PoRVA strains detected in this study belonged to the P[23] genotype, and they were closely related to P[23] strains detected in Thailand [18, 21] and other regions, including Vietnam [33] and China [35] with the nucleotide sequence identities sequencing from 83.5% to 96.5%. It was interesting to observe that the VP4 nucleotide sequence of one PoRVA strain CMP200-22 showed the highest nucleotide sequence identity (94.7%) with an uncommon P[27] PoRVA strain CMP034 detected previously in Chiang Mai, Thailand in 2000 [22].
Fig. 4.
Phylogenetic analysis of porcine rotavirus A based on partial nucleotide sequences of VP4 gene (759 nt). The tree was constructed using MEGA X software via the TN93 + G + I as the best-fit evolutionary model. The representatives of porcine rotavirus A strains detected in this study were presented in boldface with purple (2016), green (2017), light blue (2019), orange (2020), dark blue (2021), pink (2022), and red (2023) colors filled circles. Bootstrap values above 80 percent are shown at separate nodes
Discussion
Rotaviruses can infect young animals of many species, including piglets [43]. The PoRVAs are commonly associated with weaning and post-weaning enteric infections in piglets at the age of 1 to 8 weeks. This infection can lead to diarrhea, dehydration, and retardation of growth rates among piglets [44]. Furthermore, PoRVA causes economic loss to farmers due to treatment costs related to high morbidity and mortality rates [8]. Here, we reported the prevalence and genetic diversity of PoRVA strains circulating in piglets with acute diarrhea in Northern Thailand during the period of 7 years from 2016 to 2017 and 2019 to 2023. It should be pointed out that a period of 2018 was not included in this study due to the global outbreak of AFS, access to the pig farms was prohibited. As a result, none of stool samples were collected in 2018, and therefore the prevalence and distribution of PoRVA genotypes in 2018 were missing. This is a limitation of this study. The overall prevalence of PoRVA infection during this study period was 24.0% (303 out of 1,260), which is obviously higher than those reported previously in Thailand from 2000 to 2016 (ranging from 9.5% to 23.0%) [16–21]. Even though the overall prevalence of PoRVA infection reported in the present study during a period of 2016 to 2023 was high at 24.0% (Table 1), the prevalences from 2016 to 2019 were relatively low, ranging from only 4.6% to 11.6%. The prevalence suddenly increased to as high as 27.1% in 2020 and continued rising to 33.3% in 2021 and up to 39.6% in 2023. The low prevalences of PoRVA infection from 2016 to 2019 (4.6% to 11.6%) observed in the present study are consistent with previous studies reported from several countries in Asia including Taiwan (6.3% in 2014 to 2017) [45], India (10.8% in 2016 to 2017) [46], South Korea (14.1% in 2014 to 2018) [47], and China (16.8% in 2017 to 2019) [48], and also in Africa such as Mozambique (11.8% in 2016) [49]. In addition, the increase in the prevalence of PoRVA to high level at 42% was reported most recently in China during a period of 2021 to 2024 [50]. Altogether, low prevalences of PoRVA infection during a period of 2016 to 2019 and abruptly increased to high prevalences in 2020 to 2023 observed in this study is in line with the global trend of PoRVA prevalence.
Our long-time (2016 to 2023) characterization of G- and P-genotypes of PoRVA strains circulating in piglets with acute diarrhea in Northern Thailand revealed that the G2, G3, G4, G5, and G9 genotypes, and P[6], P[13], P[23], and P[27] genotypes detected in this study (Table 1) were the common G- and P-genotypes circulating in several countries worldwide, including Thailand [17, 19], Japan [51], Vietnam [52], China [35], UK [27], Italy [53], Belgium [10], and Brazil [54]. Most PoRVA strains detected in this study carried P[23] (75.2%) and P[13] (22.8%) as the most predominant P-genotypes of 98.0%, while carried P[6] and P[27] at 1.7% and 0.3%, respectively, as shown in Table 1. The P[13] in combination with G4 and G5 genotypes were detected for the first time in this geographical area (Chiang Mai province, Thailand) in 2000 [16], while P[23] genotype was detected for the first time in this area in 2008 as the most predominant genotype [21]. The follow-up study during a period of 2011 to 2014 revealed that P[13] and P[23] continued to exist in this area as the most predominant genotypes at 40.6% and 34.4%, respectively and the P[13] combined with G3, G4, G5, and G11, whereas P[23] combined with G3, G4, G5, and G9 genotypes [17]. In the present study, the surveillance of 2016 to 2023, P[23] and P[13] continued circulating in this area as the most predominant genotypes at 75.2% and 22.8%, respectively. Altogether, the findings indicate that P[13] and P[23] in combination with various G-genotypes, including G2, G3, G4, G5, G9, and G11 remained circulating in piglets with acute diarrhea over two decades in this geographical area of Thailand. Previous studies revealed that P[13] and P[23] are related to high virulence strains. The PoRVA strains bearing P[13] and P[23] are host-restricted, predominantly found in pigs, and rarely identified in other animal sources or humans [20, 50, 55]. Therefore, the findings of P[13] and P[23] in acute diarrheic piglets in this study imply that P[13] and P[23] in combination with a great variety of G-genotypes of PoRVA are adapted well to maintain in piglets as the major PoRVA genotypes associated with diarrhea in piglets in this area. In addition, G3P[23], G4P[6], and G9P[23]were identified as the dominant genotypes from 2016 to 2020, then G5P[23] and G4P[23] became more prevalent during 2021 to 2023. Remarkably, G5P[23] emerged as the most prevalent genotype over seven years period in this study (Table 1). The emergence of G5P[23] and G4P[23] as the predominant genotypes have been reported in domestic pigs worldwide, especially in Asia, which is consistent with this study [6, 13]. The emergence of G5P[23] and G4P[23] may also be explained by lacking of herd immunity against these viral genotypes in pig population and probably linked to incomplete cross-protection from natural immunity [6].
The PoRVA strain CMP200-22 detected in this study was identified as G2P[27] genotype and closely related to the G2P[27] Thai strain CMP034, which was isolated previously in the same geographical area (Chiang Mai, Thailand) in 2000 to 2001 [22]. The PoRVA G2P[27] genotype was detected for the first time in a diarrheic piglet of 49 days old at a farm located in Mae Rim district, Chiang Mai province, in 2000. Since then, G2P[27] genotype was not detected in Thailand until approximately 22 years later, it was detected again in this study. To the best of our knowledge, G2P[27] genotype is a unique genotype isolated from pigs and seldom detected only in a few countries worldwide, such as Thailand, Italy, Japan, Slovenia, and Belgium [22, 51, 56–58]. The findings suggest that G2P[27] maintains in pig population in this geographical area with less replication efficiency compared to the other PoRVA genotypes. Although G2 strains are commonly associated with human infections, the P[27] genotype is seldom detected and has been predominantly identified in pigs. This uncommon combination of G2P[27] indicates that this genotype may have occurred from a zoonotic spillover event. Moreover, previous studies have shown that G2P[27] strains possess gene segments closely related to both human and animal RVAs [22, 59, 60]. This genetic diversity can lead to the emergence of novel strains with enhanced virulence and adaptability.
Nevertheless, to gain more information about the epidemiology and evolution of G2P[27], continued surveillance of PoRVA in this area is essential and full-genome nucleotide sequence of G2P[27] should be analyzed to gain the genetic backgrounds of unusual RVA strains and interspecies transmission between pigs and humans.
Conclusions
The present study conducted PoRVA surveillance over the period of seven years from 2016 to 2023 in acute diarrheic piglets in Thailand and a wide variety of G- and P-genotype combinations of PoRVA were detected. Most PoRVA strains detected in this study contained P[23] and P[13] genotypes in combination with various G-genotypes. In addition, a rare genotype of G2P[27], which was reported for the first time in 2000, was detected again in this study after disappearing for more than two decades.
Acknowledgements
We are grateful to the official staff of the Department of Food Animal Clinic, Faculty of Veterinary Medicine, Chiang Mai University for the help with specimens’ collection.
Abbreviations
- AFS
African swine fever
- RVA
Rotavirus A
- PoRVA
Porcine RVA
- dsRNA
Double-stranded RNA
- VP
Viral protein
- NSP
Nonstructural protein
- PBS
Phosphate-buffered saline
- DMSO
Dimethyl sulfoxide
- cDNA
Complementary DNA
- PCR
Polymerase chain reaction
- RT-PCR
Reverse transcription polymerase chain reaction
- qPCR
Quantitative polymerase chain reaction
- Ct
Cycle threshold
Authors’ contributions
N.J. wrote manuscript, P.K., K.K. reviewed and edited manuscript, T.L., Z.X., A.Y. performed experiment, P.Y. A.K. collected specimens, Y.A., S.K., S.O., H.U. analyzed data, N.N. designed the experiment. All authors reviewed the manuscript.
Funding
This work was jointly supported by CMU Presidential Scholarship, the Center of Excellence (Emerging and Re-emerging Diarrheal Viruses Cluster) Chiang Mai University (Grant No. 2567), Ministry of Higher Education, Science, Research and Innovation, Thailand (Grant No. FF68), and RCGLID, Oita University, Japan (Grant No. 2024B01 and 2024B02).
Data availability
The nucleotide sequences of PoRVA strains detected in this study were submitted to the GenBank database under accession numbers PQ281214-PQ281283.
Declarations
Ethics approval and consent to participate
This study received approval from Ethical Committee for human rights related to human experimentation, Faculty of Medicine, Chiang Mai University, Chiang Mai, Thailand (MIC-2567–0445).
Consent for publication
Not applicable.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Black RE, Perin J, Yeung D, Rajeev T, Miller J, Elwood SE, et al. Estimated global and regional causes of deaths from diarrhoea in children younger than 5 years during 2000–21: a systematic review and Bayesian multinomial analysis. Lancet Glob Health. 2024;12:919–28. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Tate JE, Burton AH, Boschi-Pinto C, Parashar UD. Global, regional, and national estimates of rotavirus mortality in children <5 years of age, 2000–2013. Clin Infect Dis. 2016;62:96–105. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Sadiq A, Bostan N, Yinda KC, Naseem S, Sattar S. Rotavirus: genetics, pathogenesis and vaccine advances. Rev Med Virol. 2018;28:2003. [DOI] [PubMed] [Google Scholar]
- 4.Matthijnssens J, Attoui H, Bányai K, Brussaard CP, Danthi P, Del Vas M, et al. ICTV virus taxonomy profile: Sedoreoviridae 2022. J Gen Virol. 2022;103:001782. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Molinari BLD, Possatti F, Lorenzetti E, Alfieri AF, Alfieri AA. Unusual outbreak of post-weaning porcine diarrhea caused by single and mixed infections of rotavirus groups A, B, C, and H. Vet Microbiol. 2016;193:125–32. [DOI] [PubMed] [Google Scholar]
- 6.Vlasova AN, Amimo JO, Saif LJ. Porcine rotaviruses: epidemiology, immune responses and control strategies. Viruses. 2017;9:48. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Midgley SE, Bányai K, Buesa J, Halaihel N, Hjulsager CK, Jakab F, et al. Diversity and zoonotic potential of rotaviruses in swine and cattle across Europe. Vet Microbiol. 2012;156:238–45. [DOI] [PubMed] [Google Scholar]
- 8.Saif LJ, Fernandez FM. Group A rotavirus veterinary vaccines. J Infect Dis. 1996;174:98–106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Marthaler D, Homwong N, Rossow K, Culhane M, Goyal S, Collins J, et al. Rapid detection and high occurrence of porcine rotavirus A, B, and C by RT-qPCR in diagnostic samples. J Virol Methods. 2014;209:30–4. [DOI] [PubMed] [Google Scholar]
- 10.Theuns S, Vyt P, Desmarets LMB, Roukaerts IDM, Heylen E, Zeller M, et al. Presence and characterization of pig group A and C rotaviruses in feces of Belgian diarrheic suckling piglets. Virus Res. 2016;213:172–83. [DOI] [PubMed] [Google Scholar]
- 11.Kim HJ, Park SI, Ha TP, Jeong YJ, Kim HH, Kwon HJ, et al. Detection and genotyping of Korean porcine rotaviruses. Vet Microbiol. 2010;144:274–86. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Amimo JO, Vlasova AN, Saif LJ. Detection and genetic diversity of porcine group A rotaviruses in historic (2004) and recent (2011 and 2012) swine fecal samples in Ohio: predominance of the G9P[13] genotype in nursing piglets. J Clin Microbiol. 2013;51:1142–51. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Papp H, László B, Jakab F, Ganesh B, De Grazia S, Matthijnssens J, et al. Review of group A rotavirus strains reported in swine and cattle. Vet Microbiol. 2013;165:190–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Pham HA, Carrique-Mas JJ, Nguyen VC, Ngo TH, Nguyet LA, Do TD, et al. The prevalence and genetic diversity of group A rotaviruses on pig farms in the Mekong Delta region of Vietnam. Vet Microbiol. 2014;170:258–65. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Jampanil N, Kumthip K, Maneekarn N, Khamrin P. Genetic diversity of rotaviruses circulating in pediatric patients and domestic animals in Thailand. Trop Med Infect Dis. 2023;8:347. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Maneekarn N, Khamrin P, Chan-it W, Peerakome S, Sukchai S, Pringprao K, et al. Detection of rare G3P[19] porcine rotavirus strains in Chiang Mai, Thailand, provides evidence for origin of the VP4 genes of Mc323 and Mc345 human rotaviruses. J Clin Microbiol. 2006;44:4113–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Yodmeeklin A, Khamrin P, Chuchaona W, Saikruang W, Kongkaew A, Vachirachewin R, et al. Great genetic diversity of rotaviruses detected in piglets with diarrhea in Thailand. Arch Virol. 2016;161:2843–9. [DOI] [PubMed] [Google Scholar]
- 18.Tuanthap S, Phupolphan C, Luengyosluechakul S, Duang-In A, Theamboonlers A, Wattanaphansak S, et al. Porcine rotavirus C in pigs with gastroenteritis on Thai swine farms, 2011–2016. PeerJ. 2018;6:4724. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Saikruang W, Khamrin P, Chaimongkol N, Suantai B, Kongkaew A, Kongkaew S, et al. Genetic diversity and novel combinations of G4P[19] and G9P[19] porcine rotavirus strains in Thailand. Vet Microbiol. 2013;161:255–62. [DOI] [PubMed] [Google Scholar]
- 20.Chan-it W, Khamrin P, Saekhow P, Pantip C, Thongprachum A, Peerakome S, et al. Multiple combinations of P[13]-Like genotype with G3, G4, and G5 in porcine rotaviruses. J Clin Microbiol. 2008;46:1169–73. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Okitsu S, Khamrin P, Thongprachum A, Maneekarn N, Mizuguchi M, Ushijima H. Predominance of porcine P[23] genotype rotaviruses in piglets with diarrhea in northern Thailand. J Clin Microbiol. 2011;49:442–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Khamrin P, Maneekarn N, Peerakome S, Chan-it W, Yagyu F, Okitsu S, et al. Novel porcine rotavirus of genotype P[27] shares new phylogenetic lineage with G2 porcine rotavirus strain. Virology. 2007;361:243–52. [DOI] [PubMed] [Google Scholar]
- 23.Jothikumar N, Kang G, Hill VR. Broadly reactive TaqMan assay for real-time RT-PCR detection of rotavirus in clinical and environmental samples. J Virol Methods. 2009;155:126–31. [DOI] [PubMed] [Google Scholar]
- 24.Iturriza-Gómara M, Kang G, Gray J. Rotavirus genotyping: keeping up with an evolving population of human rotaviruses. J Clin Microbiol. 2004;31:259–65. [DOI] [PubMed] [Google Scholar]
- 25.Winiarczyk S, Paul P, Mummidi S, Panek R, Gradzki Z. Survey of porcine rotavirus G and P genotype in Poland and the United States using RT-PCR. J Vet Med B Infect Dis Vet Public Health. 2002;49:373–8. [DOI] [PubMed] [Google Scholar]
- 26.Gouvea V, Santos N, Timenetsky MC. Identification of bovine and porcine rotavirus G types by PCR. J Clin Microbiol. 1994;32:1338–40. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Chandler-Bostock R, Hancox LR, Nawaz S, Watts O, Iturriza-Gomara M, Mellits KH. Genetic diversity of porcine group A rotavirus strains in the UK. Vet Microbiol. 2014;173:27–37. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Khamrin P, Okame M, Thongprachum A, Nantachit N, Nishimura S, Okitsu S, et al. A single-tube multiplex PCR for rapid detection in feces of 10 viruses causing diarrhea. J Virol Methods. 2011;173:390–3. [DOI] [PubMed] [Google Scholar]
- 29.Gentsch JR, Glass RI, Woods P, Gouvea V, Gorziglia M, Flores J, et al. Identification of group A rotavirus gene 4 types by polymerase chain reaction. J Clin Microbiol. 1992;30:1365–73. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Kumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: molecular evolutionary genetics analysis across computing platforms. Mol Biol Evol. 2018;35:1547–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Lachapelle V, Letellier A, Fravalo P, Brassard J, L’Homme Y. Dynamics of virus distribution in a defined swine production network using enteric viruses as molecular markers. Appl Environ Microbiol. 2017;83:3187–216. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Dennis AF, McDonald SM, Payne DC, Mijatovic-Rustempasic S, Esona MD, Edwards KM, et al. Molecular epidemiology of contemporary G2P[4] human rotaviruses cocirculating in a single U.S. community: footprints of a globally transitioning genotype. J Virol. 2014;88:3789–801. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Phan MVT, Anh PH, Cuong NV, Munnink BBO, van der Hoek L, My PT, et al. Unbiased whole-genome deep sequencing of human and porcine stool samples reveals circulation of multiple groups of rotaviruses and a putative zoonotic infection. Virus Evol. 2016;2:vew027. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Zhou X, Wang YH, Ghosh S, Tang WF, Pang BB, Liu MQ, et al. Genomic characterization of G3P[6], G4P[6] and G4P[8] human rotaviruses from Wuhan, China: evidence for interspecies transmission and reassortment events. Infect Genet Evol. 2015;33:55–71. [DOI] [PubMed] [Google Scholar]
- 35.Qiao M, Li M, Li Y, Wang Z, Hu Z, Qing J, et al. Recent molecular characterization of porcine rotaviruses detected in China and their phylogenetic relationships with human rotaviruses. Viruses. 2024;16:453. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Wu FT, Bányai K, Jiang B, Liu LT, Marton S, Huang YC, et al. Novel G9 rotavirus strains co-circulate in children and pigs. Taiwan Sci Rep. 2017;7:40731. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Okada J, Urasawa T, Kobayashi N, Taniguchi K, Hasegawa A, Mise K, et al. New P serotype of group A human rotavirus closely related to that of a porcine rotavirus. J Med Virol. 2000;60:63–9. [PubMed] [Google Scholar]
- 38.Komoto S, Tacharoenmuang R, Guntapong R, Ide T, Sinchai P, Upachai S, et al. Identification and characterization of a human G9P[23] rotavirus strain from a child with diarrhoea in Thailand: evidence for porcine-to-human interspecies transmission. J Gen Virol. 2017;98:532–8. [DOI] [PubMed] [Google Scholar]
- 39.Tacharoenmuang R, Guntapong R, Upachai S, Singchai P, Fukuda S, Ide T, et al. Full genome-based characterization of G4P[6] rotavirus strains from diarrheic patients in Thailand: evidence for independent porcine-to-human interspecies transmission events. Virus Genes. 2021;57:338–57. [DOI] [PubMed] [Google Scholar]
- 40.Yodmeeklin A, Khamrin P, Kumthip K, Malasao R, Ukarapol N, Ushijima H, et al. Increasing predominance of G8P[8] species A rotaviruses in children admitted to hospital with acute gastroenteritis in Thailand, 2010–2013. Arch Virol. 2018;163:2165–78. [DOI] [PubMed] [Google Scholar]
- 41.Zhirakovskaia E, Tikunov A, Tymentsev A, Sokolov S, Sedelnikova D, Tikunova N. Changing pattern of prevalence and genetic diversity of rotavirus, norovirus, astrovirus, and bocavirus associated with childhood diarrhea in Asian Russia, 2009–2012. Infect Genet Evol. 2019;67:167–82. [DOI] [PubMed] [Google Scholar]
- 42.Yodmeeklin A, Khamrin P, Chuchaona W, Kumthip K, Kongkaew A, Vachirachewin R, et al. Analysis of complete genome sequences of G9P[19] rotavirus strains from human and piglet with diarrhea provides evidence for whole-genome interspecies transmission of nonreassorted porcine rotavirus. Infect Genet Evol. 2017;47:99–108. [DOI] [PubMed] [Google Scholar]
- 43.Cook N, Bridger J, Kendall K, Gomara MI, El-Attar L, Gray J. The zoonotic potential of rotavirus. J Infect. 2004;48:289–302. [DOI] [PubMed] [Google Scholar]
- 44.Martella V, Bányai K, Matthijnssens J, Buonavoglia C, Ciarlet M. Zoonotic aspects of rotaviruses. Vet Microbiol. 2010;140:246–55. [DOI] [PubMed] [Google Scholar]
- 45.Wu FT, Liu LT, Jiang B, Kuo TY, Wu CY, Liao MH. Prevalence and diversity of rotavirus A in pigs: evidence for a possible reservoir in human infection. Infect Genet Evol. 2022;98:105198. [DOI] [PubMed] [Google Scholar]
- 46.Abass G, Dubal ZB, Rajak KK, Kale BM, Raorane A, Dudhe N, et al. Molecular characterization of porcine rotavirus A from India revealing zooanthroponotic transmission. Anim Biotechnol. 2022;33:1073–85. [DOI] [PubMed] [Google Scholar]
- 47.Park GN, Kim DI, Choe S, Shin J, An BH, Kim KS, et al. Genetic diversity of porcine group A rotavirus strains from pigs in South Korea. Viruses. 2022;14:2522. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Tao R, Chang X, Zhou J, Zhu X, Yang S, Li K, et al. Molecular epidemiological investigation of group A porcine rotavirus in East China. Front Vet Sci. 2023;10:1138419. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Boene SS, João ED, Strydom A, Munlela B, Chissaque A, Bauhofer AFL, et al. Prevalence and genome characterization of porcine rotavirus A in southern Mozambique. Infect Genet Evol. 2021;87:104637. [DOI] [PubMed] [Google Scholar]
- 50.Lv Y, Tong Z, Liu J, Zhang Z, Wang C, Zeng Y, et al. Molecular characterization and pathogenicity analysis of porcine rotavirus A. Viruses. 2024;16:1842. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Miyazaki A, Kuga K, Suzuki T, Tsunemitsu H. Analysis of the excretion dynamics and genotypic characteristics of rotavirus A during the lives of pigs raised on farms for meat production. J Clin Microbiol. 2012;50:2009–17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Hong Anh P, Carrique-Mas JJ, Van Cuong N, Hoa NT, Lam Anh N, Duy DT, et al. The prevalence and genetic diversity of group A rotaviruses on pig farms in the Mekong Delta region of Vietnam. Vet Microbiol. 2014;170:258–65. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Monini M, Zaccaria G, Ianiro G, Lavazza A, Vaccari G, Ruggeri FM. Full-length genomic analysis of porcine rotavirus strains isolated from pigs with diarrhea in Northern Italy. Infect Genet Evol. 2014;25:4–13. [DOI] [PubMed] [Google Scholar]
- 54.Tonietti PO, Hora AS, Silva FD, Ruiz VL, Gregori F. Phylogenetic analyses of the VP4 and VP7 genes of porcine group A rotaviruses in Sao Paulo State, Brazil: first identification of G5P[23] in piglets. J Clin Microbiol. 2013;51:2750–3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Gao L, Shen H, Zhao S, Chen S, Zhu P, Lin W, et al. Isolation and pathogenicity analysis of a G5P[23] porcine rotavirus strain. Viruses. 2023;16:21. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Theuns S, Heylen E, Zeller M, Roukaerts ID, Desmarets LM, Van Ranst M, et al. Complete genome characterization of recent and ancient Belgian pig group A rotaviruses and assessment of their evolutionary relationship with human rotaviruses. J Virol. 2015;89:1043–57. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Martella V, Ciarlet M, Bányai K, Lorusso E, Arista S, Lavazza A, et al. Identification of group A porcine rotavirus strains bearing a novel VP4 (P) genotype in Italian swine herds. J Clin Microbiol. 2007;45:577–80. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Steyer A, Poljsak-Prijatelj M, Barlic-Maganja D, Jamnikar U, Mijovski JZ, Marin J. Molecular characterization of a new porcine rotavirus P genotype found in an asymptomatic pig in Slovenia. Virology. 2007;359:275–82. [DOI] [PubMed] [Google Scholar]
- 59.Lamhoujeb S, Cook A, Pollari F, Bidawid S, Farber J, Mattison K. Rotaviruses from Canadian farm samples. Arch Virol. 2010;155:1127–37. [DOI] [PubMed] [Google Scholar]
- 60.Martel-Paradis O, Laurin MA, Martella V, Sohal JS, L’Homme Y. Full-length genome analysis of G2, G9 and G11 porcine group A rotaviruses. Vet Microbiol. 2013;162:94–102. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The nucleotide sequences of PoRVA strains detected in this study were submitted to the GenBank database under accession numbers PQ281214-PQ281283.



