
Keywords: coinfection, Haemoproteus, haemosporidian, immune response, Leucocytozoon, PCR, Plasmodium
Abstract
Coinfection of a host by more than 1 parasite is more common than single infection in wild environments and can have differing impacts, although coinfections have relatively rarely been quantified. Host immune responses to coinfection can contribute to infection costs but are often harder to predict than those associated with single infection, due to the influence of within-host parasite–parasite interactions on infection virulence. To first quantify coinfection in a common bird species, and then to test for immune-related impacts of coinfection, we investigated the prevalence and immune response to avian haemosporidian (genera: Plasmodium, Haemoproteus and Leucocytozoon) coinfection in wild blackbirds. Coinfection status was diagnosed using a 1-step multiplex polymerase chain reaction, immune response was quantified through white blood cell counts and heterophil: lymphocyte ratios, and parasitaemia was quantified for each infected sample. We detected high rates of haemosporidian infection and coinfection, although neither impacted immune activity, despite a significantly higher parasitaemia in individuals experiencing double vs single infection. This suggests that immune-related costs of haemosporidian single and coinfection are low in this system. This could be due to long-term host–parasite coevolution, which has decreased infection virulence, or a consequence of reduced costs associated with chronic infections compared to acute infections. Alternatively, our results may obscure immune-related costs associated with specific combinations of coinfecting haemosporidian genera, species or lineages. Future research should investigate interactions that occur between haemosporidian parasites within hosts, as well as the ways in which these interactions and resulting impacts may vary depending on parasite identity.
Introduction
Coinfection refers to the concurrent infection of an individual host with at least 2 genetically distinct parasites (Hoarau et al., 2020) and is more common than single infections in natural populations (Telfer et al., 2010; McArdle et al., 2018). The outcomes of coinfection can differ significantly from that of single infections, as the presence of multiple different parasites alters within-host infection dynamics, thereby influencing disease severity (Gibson et al., 2011). Coinfection is often more costly to hosts than single infection (Bordes and Morand, 2011). For example, mice infected with Plasmodium berghei and Trypanosoma brucei experienced more severe anaemia and greater mortality than singly infected mice (Ademola and Odeniran, 2016). However, coinfections can also be less detrimental than single infections, as evidenced by the increased survival rates of mice infected with 2 strains of T. brucei brucei compared to those infected with only 1 (Balmer et al., 2009). Improving our ability to accurately predict the impacts of coinfections on wild host individuals would improve our understanding of the evolution and ecology of parasites and hosts, and of the mechanisms by which they may influence populations (Thomas et al., 2022). However, most studies that focus on the impacts of parasitic infection still only evaluate the effects of single infections (Thumbi et al., 2014). Of the studies that have investigated coinfections, many focus on experimental infections, which may neglect to account for the various factors that influence infection outcomes in wild populations (Hananeh et al., 2022).
Measuring the immune response to parasite coinfection in wild hosts could help to gain a deeper understanding of the direct and indirect fitness-related impacts of coinfection on wild host individuals and populations (Budischak et al., 2012), particularly as immune responses respond quickly to physiological stress and tend to be more sensitive to changes in host condition than standard body fat indices (Budischak et al., 2012). Immune responses are costly to the host, as immune activation and maintenance is energetically expensive (Ots et al., 2001) and may lead to autoimmunity (Råberg et al., 1998). Immunity is also traded-off against other life-history traits, such as reproduction, which can further reduce fitness by reducing host viability (Baer and Schmid-Hempel, 1999) or parental effort (Råberg et al., 2000). The fitness costs of an immune response tend to increase as the response intensifies (Marzal et al., 2007). Therefore, although immune responses are predicted to increase in strength as infection virulence increases (de Lope et al., 1998), this does not always occur, as hosts may need to suppress immunity, particularly if they are already experiencing stressful conditions (Hanssen et al., 2004). Immune responses to coinfection can be even more difficult to predict than immune responses to single infection, due to the influence of parasite–parasite interactions on infection virulence. This is exemplified by the conflicting results obtained from research into the immune response to coinfection. For instance, Vieira-Santos et al. (2021) found that mice coinfected with P. berghei and Ascaris suum had significantly elevated white blood cell (WBC) counts compared to singly infected mice. However, Olifiers et al. (2015) detected lower WBC counts in male coatis (Nasua nasua) infected with T. cruzi and T. evansi than in individuals with single infections. This highlights the complexity of coinfection and the need for further investigation into its immune-related impacts.
Avian haemosporidian parasites (genera: Plasmodium, Haemoproteus and Leucocytozoon) can cause avian malaria and malaria-like disease and are frequently used as models in studies of host–parasite dynamics (Lachish et al., 2011). Acute infection of the avian host can cause anaemia, lethargy, anorexia and even death (Krams et al., 2013; Schoener et al., 2014), and chronic infections, although often asymptomatic, can impact host life history traits (Knowles et al., 2010). Research into the immune response to avian malaria infection has generated contradictory results. Some studies have reported increased WBC counts in response to haemosporidian infection (e.g. Wojczulanis-Jakubas et al., 2012; Ellis et al., 2015), whereas others have detected no difference in haematological parameters (Krams et al., 2013; Vanstreels et al., 2019). This variability could in part be attributed to a high prevalence of avian haemosporidian coinfection (Pigeault et al., 2018). Across the 3 genera of avian malaria and malaria-like parasites, there are over 248 species and 5121 lineages (MalAvi Database, accessed 10/05/2024; Bensch et al., 2009). Coinfection with multiple of these genera, species or lineages is common in wild birds, for example, of the 54 infected Great tits (Parus major) sampled by Rooyen et al. (2013), 81.5% were coinfected with at least 2 different haemosporidian genera. Coinfection with multiple different haemosporidian parasites can significantly impact host individuals and has been reported as being more virulent than single infection (Palinauskas et al., 2011). Therefore, the immune response to avian malaria coinfection could be expected to be greater than that associated with single infections. However, the complexity of within-host parasite–parasite interactions coupled with the minimal amount of research on this topic makes it difficult to form such general conclusions.
Here, we investigate the immune response to coinfection by multiple genera of avian Haemosporidia in a species of wild bird known to have a high prevalence of blood parasites, and thus predicted to have a high prevalence of coinfection. We predict that (1) immune responses will be stronger in singly infected birds than uninfected birds, as single infection can exert significant costs on hosts (Knowles et al., 2010). We also hypothesize that (2) coinfected birds will exhibit stronger immune responses than singly infected birds, as avian malaria coinfection has been reported as more virulent than single infection (Palinauskas et al., 2011), and immune responses are expected to increase in intensity where there is potential for greater damage to the host (de Lope et al., 1998).
Materials and methods
Blood samples
A total of 128 blood samples were examined during this study, all of which had been previously collected from blackbirds (Turdus merula) at the following sites in Lincolnshire, UK, between 2017 and 2022: North Carlton (53°17′N, 0°34′W), Eagle (53°11′N, 0°41′W), Owmby (53°31′N, 0°22′W), Blankney (53°07′N, 0°24′W), Moorlands (53°12′N, 0°34′W) and Industrial Cottages (53°14′N, 0°33′W). Two blood smears were created from each sample, which were fixed in absolute methanol and stained with Giemsa for 45–50 min following standard protocols. Additional blood was stored at −20°C prior to DNA extraction and subsequent analysis.
DNA extraction and determination of infection status
DNA was extracted from all samples using a DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. The infection status of each sample was determined using a 1-step multiplex polymerase chain reaction (PCR) assay capable of detecting parasites of the genera Plasmodium and Leucocytozoon as well as the subgenera Haemoproteus and Parahaemoproteus (genus: Haemoproteus) (Ciloglu et al., 2023). However, we did not expect to find Haemoproteus parasites in our samples as this subgenus tends to infect birds from the orders Suliformes, Charadriiformes and Columbiformes, rather than Passeriformes (Ciloglu et al., 2023). The PCR was set up in total volumes of 10 μL, consisting of 5 μL of commercial multiplex PCR master mix (2 × Qiagen Multiplex PCR Master Mix, Qiagen), 0.2 μL of each primer (10 mm concentration) (Table 1), 2.4 μL of ddH2O and 1 μL of DNA. Reactions were performed in a Bio-Rad T100 Thermal Cycler (Bio-Rad Laboratories, Hercules, CA, USA). The PCR protocol began with denaturation at 95°C for 15 min, after which there were 37 cycles of 94°C for 30 s, 58.9°C for 90 s and 72°C for 30 s, and finally terminal extension at 72°C for 10 min. One positive and one negative control were included for every 10 samples, to ensure DNA had been successfully amplified (positive control) and that no contamination was present (negative control). Positive controls contained 1 μL of DNA from a blood sample confirmed to be naturally infected with Plasmodium, Leucocytozoon and Parahaemoproteus parasites, whereas negative controls contained 1 μL of ddH2O in place of DNA.
Table 1.
Names and sequences of all primers used in the 1-step multiplex PCR and Leucocytozoon sequencing PCR, along with product sizes
| Parasite taxa | Primer name | Primer sequence (5′ to 3′) | Product size (bp) | Reference |
|---|---|---|---|---|
| One-step multiplex PCR | ||||
| Plasmodium | PMF | CCTCACGAGTCGATCAGG | ~378 | Ciloglu et al. (2019) |
| PMR | GGAAACCGGCGCTAC | |||
| Leucocytozoon | LMF | TGGAACAATAATTGSATTATTTACAYT | ~218 | Ciloglu et al. (2019) |
| LMR | AACATATCATATTCCATCCATTTAGATTA | |||
| Subgenus Parahaemoproteus | HMF | ATTGGATGTCAATTACCACAATC | ~533 | Ciloglu et al. (2019) |
| HMR | GGGAAGTTTATCCAGGAAGTT | |||
| Subgenus Haemoproteus | HHMF | ATTTCTACAAAATGCCAGTATAATAATAC | ~471 | Ciloglu et al. (2019) |
| HHMR | CTGGGGTATTTTACATTTTGCAC | |||
| Leucocytozoon sequencing PCR | ||||
| Leucocytozoon | Leunew1F | GGWCAAATGAGTTTCTGGG | ~340 | Quillfeldt et al. (2014) |
| LDRd | CTGGATGWGATAATGGWGCA | Merino et al. (2008) | ||
Amplification products (5 μL) were electrophoretically resolved after 1 h at 120 V in 3% agarose gels. Gels were then post-stained with gel red to prevent the dye from potentially interfering with DNA migration during electrophoresis. During post-staining, gels were placed in a plastic tub containing 100 ml of water and 30 μL of gel red, which was gently agitated for 45 min. After this, gel visualization was carried out using a Syngene InGenius 3 transilluminator (Syngene International, Bengaluru, Karnataka) and GeneSys software (Genesys, Menlo Park, CA, USA). The presence of an amplicon band at the expected size (Table 1) was indicative of infection. Samples were recorded as either uninfected, singly infected or coinfected with parasites belonging to multiple different genera and/or subgenera, and the identity of any parasites present was noted.
Sequence analysis
Positive samples were sent to Macrogen Europe (Amsterdam, Netherlands) to be sequenced, in order to confirm the identity of the parasite strains present. Although the above PCR protocol produced sufficient lengths of Plasmodium and Parahaemoproteus DNA to allow for meaningful sequencing, this was not the case for Leucocytozoon DNA. As such, Leucocytozoon DNA was amplified using Leunew1F and LDRd primers (Table 1) prior to sequencing, which produced a product of length 340 bp. The PCR protocol was as follows: 95°C for 15 min, followed by 34 cycles of 95°C for 30 s, 56°C for 30 s and 72°C for 1 min, and finally terminal extension at 72°C for 10 min. This PCR was carried out using the same equipment and reagents as detailed above. Reaction volumes for all reagents were also identical to those mentioned previously, apart from that of ddH2O (3.6 μL in every 10 μL reaction).
Forward sequences were assessed for any errors, trimmed and then aligned using AliView (Larsson, 2014). Sequences of poor quality, where double peaks were present throughout the chromatogram, were not included in any further analysis. Leucocytozoon sequences were queried using the BLAST algorithm for both the MalAvi (Bensch et al., 2009) and GenBank databases to identify the closest matching sequences. Plasmodium and Parahaemoproteus sequences did not overlap the MalAvi region and were therefore only queried against the GenBank database.
Immune activity and infection intensity
Blood smears were assessed under oil immersion at 100× magnification to quantify immune responses and infection intensity. Inspection of each slide was concluded after a total of both 100 WBCs and 10 000 red blood cells (RBCs) had been examined. Each WBC inspected was identified based on standard avian guidelines (Clark et al., 2009). Immune function was then quantified through calculation of standardized WBC counts and heterophil to lymphocyte ratios (H:L ratios), which are used as measures of immune activity (Smits, 2007) and chronic stress (Davis et al., 2008), respectively. WBC counts were calculated as the number of erythrocytes present for every 100 WBCs and H:L ratio was calculated using the following formula: heterophils/(heterophils + lymphocytes) (Dunn et al., 2017). Infection intensity was measured for each blood smear by counting the number of parasites (all genera) present for every 10 000 RBCs.
Statistical analysis
All statistical analyses were carried out in R version 4.1.1 for Windows (R Core Team, 2021). General linear models with Gaussian error structure were used to examine the relationship between immune activity and infection status. H:L ratio was square root transformed and WBC count log-transformed to achieve normal distributions. To examine the relationship between coinfection status (coinfected or not coinfected) and immune function, models were run with either H:L ratio or WBC count as the dependent variable and coinfection status as a fixed factor. The effect of genera number (0, 1, 2 or 3, a categorical variable) on immune activity was assessed using models run as above but with genera number as a fixed factor. As parasitaemia is known to influence immune activity (Sol et al., 2003; Ellis et al., 2015), this was included as a covariate in the above models. The effect of genera number (0, 1, 2 or 3) on parasitaemia was investigated using a Poisson regression model constructed with parasitaemia as the dependent variable and genera number as a fixed factor. Likelihood ratio tests were used to test the significance of model terms. Sample sizes were too small to facilitate investigation of the effects of infection with specific parasite genera or genus combinations.
Co-occurrence analysis
To test whether coinfecting genera were significantly associated with one another, or whether coinfections occurred at random, we used the R co-occur package (Griffith et al., 2016) to test whether the observed frequency of genus co-occurrence is greater or less than expected given the overall prevalence of each genus in the population.
Results
Haemosporidia prevalence
A total of 128 blood samples were examined, of which 26 were uninfected (20.31%), 61 were singly infected (47.66%) and 41 were coinfected with at least 2 different haemosporidian genera (32.03%). Of these 41 samples, 38 were infected with 2 genera (92.68%) and 3 contained all 3 genera (7.32%). Singly infected samples were most commonly infected by Plasmodium spp. (42), followed by Parahaemoproteus spp. (18) and then Leucocytozoon spp. (1) (Fig. 1a). Plasmodium spp.–Parahaemoproteus spp. infections accounted for 89.47% (34) of double infections, whereas Plasmodium spp.–Leucocytozoon spp. and Leucocytozoon spp.–Parahaemoproteus spp. infections were much less common, making up 7.89% (3) and 2.63% (1) of double infections respectively (Fig. 1b). No samples were infected with the subgenus Haemoproteus, and 1 sample infected with Plasmodium spp. was also infected with microfilaria (identified during microscopy). The mean infection intensity amongst birds confirmed as infected through PCR was 8.75 parasites per 10 000 erythrocytes (range 0–163 parasites per 10 000 erythrocytes). In 12 singly infected and 3 coinfected samples identified using PCR, no parasites were seen under the microscope (10 Plasmodium spp.-infected, 2 Parahaemoproteus spp.-infected and 3 infected with Plasmodium spp. and Parahaemoproteus spp.). Three samples tested negative for Leucocytozoon spp. and 2 tested negative for Parahaemoproteus spp. using PCR, despite parasites being identified on blood smears. Photographs of each parasite genus seen during microscopic examination can be found in Supplementary file 1.
Figure 1.
Number of samples (a) singly infected and (b) doubly infected with parasites belonging to each genus/genera combination.
Sequence analysis
We were able to obtain 54 good quality sequences, of which 17 were identified as Plasmodium spp., 32 were Parahaemoproteus spp. and 5 were Leucocytozoon spp. We identified 5 unique Plasmodium spp. sequences, 11 unique Parahaemoproteus spp. sequences, and 4 unique Leucocytozoon spp. sequences (Table 2). Eleven of the 54 sequences were obtained from coinfected samples (1 sample was infected with Plas1, Haem1 and Leuc1 concurrently, 1 with Haem10 and Leuc2, 1 with Haem5 and Plas3, and 2 samples were infected with Plas1 and Haem1).
Table 2.
Haemosporidian lineages sequenced from infected samples as part of this study, alongside their closest matches on MalAvi and GenBank
| Lineage (this study) | Parasite genus | MalAvi match | % identity | GenBank match | % identity | N | Citation |
|---|---|---|---|---|---|---|---|
| Plas1 | Plasmodium | NA | NA |
KY653813.1 KY653792.1 |
100 | 8 | Pacheco et al. (2018) |
| Plas2 | Plasmodium | NA | NA |
MG598392.1 KY653815.1 KY653802.1 KY653785.1 KY653780.1 KY653766.1 OP701684.1 KC138226.1 NC_008279.1 AY733089.1 |
99.67 | 4 | Ferreira-Junior et al. (2018) Pacheco et al. (2018) Lotta-Arévalo et al. (2023) Mantilla et al. (2013) Omori et al. (2007) Beadell and Fleischer (2005) |
| Plas3 | Plasmodium | NA | NA |
KY653749.1 KY653814.1 KY653813.1 KY653804.1 KY653792.1 KY653786.1 KY653771.1 KY653770.1 AB599930.1 NC_008288.1 |
97.31 | 2 | Pacheco et al. (2019) Pacheco et al. (2018) Hikosaka et al. (2011) Omori et al. (2007) |
| Plas4 | Plasmodium | NA | NA | KY653762.1 | 100 | 2 | Pacheco et al. (2018) |
| Plas5 | Plasmodium | NA | NA |
MG598392.1 KY653815.1 KY653804.1 KY653802.1 KY653786.1 KY653785.1 KY653780.1 KY653766.1 OR347675.1 OR347674.1 OP701684.1 KC138226.1 AB599930.1 NC_008288.1 NC_008279.1 AY733089.1 |
99.31 | 1 | Ferreira-Junior et al. (2018) Pacheco et al. (2018) Musa (unpublished data) Böhme et al. (2018) Lotta-Arévalo et al. (2023) Mantilla et al. (2013) Hikosaka et al. (2011) Omori et al. (2007) Beadell and Fleischer (2005) |
| Leuc1 | Leucocytozoon | TUMER01 | 100 |
KJ488790.1 KJ488693.1 |
100 | 2 | Drovetski et al. (2014) |
| Leuc2 | Leucocytozoon | TUMER01 TUMER07 |
100 |
OQ311222.1 OQ311218.1 OQ311186.1 OQ311165.1 OQ311161.1 OQ311159.1 OQ311146.1 OQ311097.1 OQ311093.1 OQ311090.1 OQ311058.1 OQ311009.1 ON730885.1 KJ488828.1 KJ488790.1 KJ488693.1 GU391353.1 |
100 | 1 | Strehmann et al. (2023) Díez-Fernández et al. (2023) Drovetski et al. (2014) Hellgren et al. (unpublished data) |
| Leuc3 | Leucocytozoon | TUMER19 | 95 | KJ488895.1 | 94.67 | 1 | Drovetski et al. (2014) |
| Leuc4 | Leucocytozoon | COLBF08 | 99 | KR052940.1 | 99.23 | 1 | Murdock et al. (2015) |
| Haem1 | Haemoproteus | NA | NA | KY653763.1 | 100 | 19 | Pacheco et al. (2018) |
| Haem2 | Haemoproteus | NA | NA | KY653763.1 | 97.74 | 2 | Pacheco et al. (2018) |
| Haem3 | Haemoproteus | NA | NA | KY653763.1 | 99.33 | 2 | Pacheco et al. (2018) |
| Haem4 | Haemoproteus | NA | NA | KY653763.1 | 99.56 | 1 | Pacheco et al. (2018) |
| Haem5 | Haemoproteus | NA | NA | KY653763.1 | 99.55 | 1 | Pacheco et al. (2018) |
| Haem6 | Haemoproteus | NA | NA | KY653763.1 | 98.63 | 2 | Pacheco et al. (2018) |
| Haem7 | Haemoproteus | NA | NA | KY653763.1 | 98.89 | 1 | Pacheco et al. (2018) |
| Haem8 | Haemoproteus | NA | NA | KY653763.1 | 99.13 | 1 | Pacheco et al. (2018) |
| Haem9 | Haemoproteus | NA | NA | KY653763.1 | 98.41 | 1 | Pacheco et al. (2018) |
| Haem10 | Haemoproteus | NA | NA | KY653763.1 | 99.29 | 1 | Pacheco et al. (2018) |
| Haem11 | Haemoproteus | NA | NA | KY653763.1 | 99.31 | 1 | Pacheco et al. (2018) |
There are no data for Plasmodium and Haemoproteus MalAvi matches as the amplified DNA region does not overlap with the MalAvi region.
Plas1 was isolated from 8 individuals within this study and was identical to sequences of both Plasmodium vaughani collected from a blackbird in Lithuania and Plasmodium unalis collected from a Great thrush (Turdus fuscater) in Colombia (Table 2). Plas2 was isolated from 4 individuals and was a new sequence with 99.67% similarity to 10 sequences, detailed in Table 2. Plas3 was isolated from 2 blackbirds in this study, and was a 97.31% match to 10 sequences on GenBank: Plasmodium juxtanucleare from a short-crested flycatcher (Myiarchus ferox) in Brazil, 2 sequences of P. unalis from Great thrushes in Colombia, P. vaughani from a blackbird in Lithuania, Plasmodium homopolare from a rufous-collared sparrow (Zonotrichia capensis) in Colombia, 3 sequences of Plasmodium gallinaceum from a domestic chicken (Gallus gallus domesticus) and Plasmodium sp. from Swainson's thrush (Catharus ustulatus) in Colombia, an African penguin (Spheniscus demersus) in South Africa, and a Northern bobwhite quail (Colinus virginianus ridgwayi) in the USA. Plas4 was found in 2 blackbirds in this study, and was identical to only 1 sequence, Plasmodium circumflexum, isolated from a wren (Troglodytes troglodytes) in Lithuania. We isolated Plas5 from 1 blackbird: this was a new sequence with 99.31% identity to 17 sequences in GenBank, detailed in Table 2.
Haem1, isolated from 19 blackbirds in this study, was identical to 1 sequence on GenBank, Haemoproteus minutus, isolated from a blackbird in Lithuania. Haem2–Haem11 were all new sequences, with 97–99% similarity to the same sequence as Haem 1 (Table 2).
Leuc1, isolated from 2 blackbirds in this study, was identical to TUMER01 at the region of overlap with the MalAvi region (235 bp). This lineage has been reported mostly from blackbirds across western Europe and North Africa, with 1 report from a house sparrow (Passer domesticus) in the Azores. Leuc2, isolated from 1 individual, was identical to both TUMER01 and TUMER07 at the region of overlap; TUMER07 has only previously been reported from a single blackbird in Portugal. Leuc3, also isolated from a single blackbird, may be a new lineage, with 95% match to TUMER19 on MalAvi at the region of overlap: TUMER19 was isolated from a blackbird in Armenia. Leuc4 was a 99% match at the MalAvi region and a 99.23% match on GenBank to lineage COLBF08 isolated from the Woodland Black Fly (Simulium silvestre) in the USA: this lineage had not previously been isolated from an avian host (Table 2).
Impacts of infection
No significant differences in H:L ratio (F1 = 0.27, P = 0.60) or WBC count (F1 = 0.78, P = 0.38) were detected between coinfected blackbirds (T. merula) and those that were not coinfected (H:L ratio, coinfected: 0.199 ± 0.017; not coinfected: 0.185 ± 0.011; WBC count, coinfected: 14 806.767 ± 1663.892; not coinfected: 16 823.315 ± 1280.073). Similarly, haemosporidian genus number (0, 1, 2, 3) also had no significant effect on H:L ratio (F1 = 0.09, P = 0.76; 0:0.190 ± 0.021; 1:0.182 ± 0.013; 2:0.198 ± 0.017; 3:0.210 ± 0.080) or WBC count (F1 = 1.81, P = 0.15; 0 genera: 22 066.158 ± 3421.956; 1:14 588.661 ± 995.793; 2:15 226.516 ± 1774.760; 3:9489.941 ± 1840.128), although there were significant differences in parasitaemia between individuals infected with 1 genus and those infected with 2 genera (χ22 = 44.34, P < 0.001) (Fig. 2). When controlling for coinfection status, parasitaemia had no significant effect on H:L ratio (F1 = 0.12, P = 0.73) or WBC count (F1 = 2.20, P = 0.14). This was also true when controlling for genus number (H:L ratio: F1 = 0.13, P = 0.72; WBC count: F1 = 1.36, P = 0.25).
Figure 2.
Mean number of parasites per 10 000 red blood cells in blackbird (Turdus merula) blood smears infected with 1, 2 or 3 avian haemosporidian genera (singly infected: n = 61; 2 genera: n = 38; 3 genera: n = 3). Error bars represent ±1s.e.
Co-occurrence analysis
At the genus level, associations between genera did not differ from random, given the prevalence of each in the population (P > 0.05 for each association). However, all but 1 Leucocytozoon spp. infection (n = 8) occurred alongside either a Plasmodium spp. or a Haemoproteus spp. infection.
Discussion
A high prevalence of avian haemosporidian infection was found amongst sampled blackbirds (T. merula), as just under 80% were infected with at least 1 genus of parasite. Although we only sampled birds from 1 area of the UK, other studies have reported high levels of haemosporidian infection in passerine birds from other locations across the UK and Europe (e.g. Hatchwell et al., 2000; Valkiūnas et al., 2003), suggesting that our findings may be reflective of general infection patterns in this species. We found Plasmodium parasites to be the most common of all 3 haemosporidian genera, followed by Haemoproteus spp. and then Leucocytozoon spp., which concurs with the high incidences of Plasmodium spp. reported in blackbirds in various European countries (Dinhopl et al., 2015; Himmel et al., 2020).
We identified 5 strains of Plasmodium spp., 11 strains of Haemoproteus spp. and 4 strains of Leucocytozoon spp. in sampled blackbirds. Plas1 matched sequences for P. unalis and P. vaughani. However, as P. unalis has been isolated almost exclusively from birds in America (Harl et al., 2020), whereas P. vaughani is commonly found in Europe, we expect that our samples were infected with P. vaughani. As Plas2, Plas3 and Plas5 matched with a considerable number of sequences on GenBank, it is difficult to determine the exact identity of these sequences. However, this suggests that the primers PMF and PMR may be useful in the amplification of a wide variety of Plasmodium strains, although further work is needed to determine whether this region may be useful as a barcode for species discrimination. Leuc2 matched with sequences for TUMER01 and TUMER07, although the individual sampled in the present study was more likely infected with TUMER01, given its considerably higher prevalence in this host species.
We also detected a considerable prevalence of haemosporidian coinfection, as 32.03% of all individuals tested positive for infection with at least 2 genera. Similar rates of avian malaria coinfection have been reported in other host species, including a 31% prevalence in American crow nestlings (Townsend et al., 2018). These results may be unsurprising considering the high prevalence and diversity of avian malaria parasites globally, and the observation that birds already infected with either Plasmodium spp., Haemoproteus spp. or Leucocytozoon spp. appear more likely to be subsequently infected with another haemosporidian genus (Norte et al., 2009). However, there is substantial variation in reported rates of haemosporidian coinfection, for example, coinfection rates recorded by Starkloff and Galen (2023) ranged from 7 to 75% depending on the host population. This is likely due to the many different factors known to influence haemosporidian infection prevalence in the wild, including host species (Lutz et al., 2015), migratory behaviour (Ciloglu et al., 2020), environmental conditions and the abundance and activity of vectors (Thomas et al., 2022).
Contrary to our hypothesis, we detected no significant differences in H:L ratio or WBC count between uninfected and singly infected individuals, suggesting that infection with 1 haemosporidian genus does not impose significant immune-related costs on hosts. This is supported by several studies, all detecting no effect of parasite presence on immunological parameters such as H:L ratio (Krams et al., 2013), haematocrit levels (Bichet et al., 2020) and WBC count (Vanstreels et al., 2019). These results could be a consequence of long-term coevolution between haemosporidian parasites and their avian hosts (Norte et al., 2009), which can reduce parasite virulence, subsequently evoking weaker immune responses (Macintosh and Frias, 2017). These coevolutionary relationships can have severe implications for naïve populations, potentially causing high morbidity and mortality (Garnick, 1992; Woodworth et al., 2005). As such, further investigation into the dynamics of coevolutionary relationships should be a priority. However, coevolution has not eliminated all the costs that avian malaria parasites impose upon host individuals, as significant immune responses to these parasites, including increased WBC counts and H:L ratios (Wojczulanis-Jakubas et al., 2012; Dunn et al., 2013; Ellis et al., 2014, 2015), have been recorded in species that are frequently infected by haemosporidians. This evidences the complexities of host–parasite coevolution and the many different factors that can influence immune responses to parasitic infection.
We also found no effect of coinfection on H:L ratio or WBC count. Similar findings were reported by Palinauskas et al. (2018), who found no significant differences in body weight between singly infected domestic canaries (Canaria domestica) and those infected with 2 different Plasmodium species. Likewise, Chavarría et al. (2023) found no effect of coinfection on body condition or polychromatophil count in the ash-breasted Sierra finch (Geospizopsis plebejus). Conversely, other studies have detected additive costs of coinfection in comparison to single infection, in terms of body condition (Marzal et al., 2008) and survival probability (Pigeault et al., 2018). The impacts of coinfection on host individuals are dependent on the nature of the interactions occurring between parasites within the host (Karvonen et al., 2019). If interactions are antagonistic, infection virulence will be lowered in comparison to single infection, due to the suppression of 1 parasite by another (Clay and Rudolf, 2019; Shen et al., 2019). Facultative interactions on the other hand, in which both parasites benefit, can impose greater costs on hosts (Clay and Rudolf, 2019). To fully understand the reasons for the observed differences in coinfection costs, exploration into the interactions that occur between different haemosporidian parasites within avian hosts is needed.
It would be interesting for future work to test for the impacts of coinfection specific to certain parasite species or lineages. This is because different haemosporidian genera, species and lineages exhibit different life history traits, patterns of development inside the avian host and levels of pathogenicity (Atkinson and Riper, 1991; Zehtindjiev et al., 2008). For example, Townsend et al. (2018) found that, of the 3 avian haemosporidian genera, only Plasmodium spp. infection was associated with significant reductions in body condition and haematocrit levels. Additionally, Zehtindjiev et al. (2008) reported lower parasitaemia in great reed warblers (Acrocephalus arundinaceus) infected with Plasmodium relictum compared to individuals infected with Plasmodium ashfordi, and Bentz et al. (2006) found that parasitaemia of Plasmodium lineage TM1 was 100–1000× that of Plasmodium TM2 in blackbirds (T. merula). These findings suggest that there may also be differences in the ways in which different parasitic genera, species and lineages interact with each other, and with the host, during coinfection (Rooyen et al., 2013). Consequently, the immune-related impacts of parasitic coinfections may be dependent on the identity of the parasites present, meaning our results could obscure significant costs associated with specific combinations of haemosporidian parasites. As such, future research should seek to uncover any potential parasite-specific costs of coinfection.
It is also important to acknowledge the impact that the incorrect diagnosis of infection status may have had on our results, as we recorded infection status based solely on the results of the 1-step multiplex PCR, which appears to have failed to detect infection in a few samples. This study also included blood samples that were diagnosed as infected by PCR, but in which no parasites were seen under the microscope. There are a few possible reasons for such observations, including that these birds were suffering from very light parasitaemia, or that parasite DNA detected during PCR represented parasite remnants that had aborted development (Valkiūnas et al., 2009; Chagas et al., 2016). Consequently, some individuals we recorded as infected might not have been harbouring successful infections. As such, the diagnosis of infection status is probably best achieved using a combination of microscopy and PCR-based techniques.
As well as investigating the immune-related impacts of single infections and coinfections, we also looked at the effect of coinfection on parasitaemia. We found that individuals infected with 2 haemosporidian genera had significantly higher parasitaemia than those infected by 1 genus. As only 3 of our samples were infected with Plasmodium spp., Haemoproteus spp. and Leucocytozoon spp. concurrently, it is possible that this small sample size hampered our ability to also detect a significant influence of 3-genera coinfection on parasitic burden. Other studies have also detected an increase in parasitaemia during coinfections in comparison to single infections (e.g. Palinauskas et al., 2018; Chavarría et al., 2023), indicating an additive effect of coinfection on parasitaemia (Cox, 2001). However, as we did not record the genus of each parasite seen during microscopic examination, we do not have any data on the relative parasitaemia of each genus in coinfected samples. This restricts our ability to comment on potential dynamics that may have been regulating the parasitaemia of each genus. Previous research has detected both positive (Zehtindjiev et al., 2008; Palinauskas et al., 2011) and negative relationships (Palinauskas et al., 2011) between the parasitaemia of different coinfecting haemosporidians, as well as significant variation in parasitaemia dynamics across coinfected host species. As there is much research demonstrating the significant influence that haemosporidian parasitaemia has on infection costs (e.g. Sol et al., 2003; Ellis et al., 2015), it is important that the mechanisms that regulate these observed dynamics are investigated further and any changes in these dynamics over the course of infection are recorded.
Contrary to the aforementioned research, we found that parasitaemia had no influence on H:L ratio or WBC count. This could be explained by the generally low levels of parasitic burden detected amongst sampled individuals, suggesting that most birds were suffering from chronic rather than acute infection. As the acute phase of haemosporidian infection imposes greater costs on avian hosts than chronic infection (Krams et al., 2013), it is possible that this prevented us from detecting an effect of parasitaemia and infection status on immune activity. Unfortunately, it is more difficult to collect samples from wild birds experiencing acute infection, as these individuals are more likely to reduce their levels of activity and may die before being sampled (Yorinks and Atkinson, 2000; Krams et al., 2013). On the other hand, studies that have used anti-Haemosporidia medications to treat chronic infections have uncovered associations between chronic infection and reduced host survival and reproductive success (Knowles et al., 2010; Martínez-de la Puente et al., 2010). This suggests that even low parasitic burdens can exert significant costs in some circumstances. However, the impacts of haemosporidian infections on wild hosts are dependent on a variety of factors aside from parasitaemia, including food availability and environmental conditions. For example, Cornet et al. (2014) found that nutritionally supplemented domestic canaries (Serinus canaria) were better able to control Plasmodium relictum burdens than those that were not supplemented. It is difficult to assess the extent to which these factors influenced the results of this study, as with any study of haemosporidian infection costs conducted on wild birds. Further examination of the effect of these variables in controlled conditions may help to shed more light on their possible effects in wild environments.
In conclusion, we detected high rates of haemosporidian infection and coinfection, but found no evidence that either impacted immune activity, despite a significantly higher parasitic burden in individuals experiencing double vs single infection. This could be a result of coevolution, which has reduced parasite virulence, or a reflection of the reduced costs associated with chronic infection in comparison to acute infection. These findings may obscure significant impacts associated with specific combinations of coinfecting haemosporidian genera, species or lineages. Further research into the interactions that occur between parasites within the host, and how these interactions and resulting impacts may vary depending on parasite identity, would help to facilitate a better understanding of the costs of coinfection in this system.
Supporting information
Lebeau and Dunn supplementary material
Acknowledgements
Sample collection was partly funded by Royal Society Research grant RG170086 to J. C. D., and laboratory analysis was funded through E. L.'s MBio research project at the University of Lincoln. Blood samples were collected under licence from the UK Home Office, and birds were caught under licence from the British Trust for Ornithology.
Supplementary material
The supplementary material for this article can be found at https://doi.org/10.1017/S0031182024000829.
Data availability statement
Sequences generated in this research are accessible through GenBank accession numbers PP850198–PP850217.
Author contributions
E. L. designed the study, conducted laboratory analysis, performed statistical analyses and wrote the manuscript. J. C. D. conceived the study, provided pre-collected samples and edited the manuscript.
Financial support
Sample collection was partly funded by Royal Society Research grant RG170086 to J. C. D., and laboratory analysis was funded through E. L.'s MBio research project at the University of Lincoln.
Competing interests
None.
Ethical standards
All blood samples were collected under licence from the UK Home Office. This work was approved by both the University of Leeds Animal Welfare and Ethical Review Committee, and the University of Lincoln Animal Ethics Committee.
References
- Ademola IO and Odeniran PO (2016) Co-infection with Plasmodium berghei and Trypanosoma brucei increases severity of malaria and trypanosomiasis in mice. Acta Tropica 159, 29–35. [DOI] [PubMed] [Google Scholar]
- Atkinson CT and Riper CV (1991) Pathogenicity and epizootiology of avian haematozoa: Plasmodium, Leucocytozoon and Haemoproteus. In Loye JE and Zuk M (eds), Bird-Parasite Interactions: Ecology, Evolution, and Behaviour. New York, USA: Oxford University Press, pp. 19–48. [Google Scholar]
- Baer B and Schmid-Hempel P (1999) Experimental variation in polyandry affects parasite loads and fitness in a bumble-bee. Nature 397, 151–154. [Google Scholar]
- Balmer O, Stearns SC, Schötzau A and Brun R (2009) Intraspecific competition between co-infecting parasite strains enhances host survival in African trypanosomes. Ecology 90, 3367–3378. [DOI] [PubMed] [Google Scholar]
- Beadell JS and Fleischer RC (2005) A restriction enzyme-based assay to distinguish between avian hemosporidians. Journal of Parasitology 91, 683–685. [DOI] [PubMed] [Google Scholar]
- Bensch S, Hellgren O and Pérez-Tris J (2009) Malavi: a public database of malaria parasites and related haemosporidians in avian hosts based on mitochondrial cytochrome b lineages. Molecular Ecology Resources 9, 1353–1358. [DOI] [PubMed] [Google Scholar]
- Bentz S, Rigaud T, Barroca M, Martin-Laurent F, Bru D, Moreau J and Faivre B (2006) Sensitive measure of prevalence and parasitaemia of haemosporidia from European blackbird (Turdus merula) populations: value of PCR-RFLP and quantitative PCR. Parasitology 133, 685–692. [DOI] [PubMed] [Google Scholar]
- Bichet C, Brischoux F, Ribout C, Parenteau C, Meillere A and Angelier F (2020) Physiological and morphological correlates of blood parasite infection in urban and non-urban house sparrow populations. PLoS ONE 15, e0237170. doi: 10.1371/journal.pone.0237170 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Böhme U, Otto TD, Cotton JA, Steinbiss S, Sanders M, Oyola SO, Nicot A, Gandon S, Patra KP, Herd C and Bushell E (2018) Complete avian malaria parasite genomes reveal features associated with lineage-specific evolution in birds and mammals. Genome Research 28, 547–560. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bordes F and Morand S (2011) The impact of multiple infections on wild animal hosts: a review. Infection Ecology and Epidemiology 1, 7346. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Budischak SA, Jolles AE and Ezenwa VO (2012) Direct and indirect costs of coinfection in the wild: linking gastrointestinal parasite communities, host hematology, and immune function. International Journal for Parasitology: Parasites and Wildlife 1, 2–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chagas CRF, Guimarães LDO, Monteiro EF, Valkiūnas G, Katayama MV, Santos SV, Guida FJV, Simões RF and Kirchgatter K (2016) Hemosporidian parasites of free-living birds in the São Paulo Zoo, Brazil. Parasitology Research 115, 1443–1452. [DOI] [PubMed] [Google Scholar]
- Chavarría X, Matta N, Cadena-Ortíz H, Alarcón I, Bahamonde-Vinueza D, González A and Bonaccorso E (2023) Haemosporidian parasites in the ash-breasted Sierra finch (Geospizopsis plebejus): insights from an Andean dry forest population. Parasitology 150, 115–128. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ciloglu A, Ellis VA, Bernotienė R, Valkiūnas G and Bensch S (2019) A new one-step multiplex PCR assay for simultaneous detection and identification of avian haemosporidian parasites. Parasitology Research 118, 191–201. [DOI] [PubMed] [Google Scholar]
- Ciloglu A, Ergen AG, Inci A, Dik B, Duzlu O, Onder Z, Yetismis G, Bensch S, Valkiūnas G and Yildirim A (2020) Prevalence and genetic diversity of avian haemosporidian parasites at an intersection point of bird migration routes: Sultan Marshes National Park, Turkey. Acta Tropica 210, 105465. [DOI] [PubMed] [Google Scholar]
- Ciloglu A, Yildirim A, Pekmezci D, Yetismis G, Sursal Simsek N, Simsek E, Duzlu O, Onder Z, Delibasi Kokcu N, Pekmezci GZ and Ellis VA (2023) A novel one-step multiplex PCR protocol to detect avian haemosporidian parasites in the subgenus Haemoproteus (Kruse, 1890) used to quantify parasite prevalence in domestic pigeons (Columba livia) in Turkey. Veterinary Research Communications 47, 511–521. doi: 10.1007/s11259-022-09962-z [DOI] [PubMed] [Google Scholar]
- Clark P, Boardman W and Raidal S (2009) Atlas of Clinical Avian Hematology. Hoboken, NJ: John Wiley & Sons. [Google Scholar]
- Clay PA and Rudolf VH (2019) How parasite interaction strategies alter virulence evolution in multi-parasite communities. Evolution 73, 2189–2203. [DOI] [PubMed] [Google Scholar]
- Cornet S, Bichet C, Larcombe S, Faivre B and Sorci G (2014) Impact of host nutritional status on infection dynamics and parasite virulence in a bird-malaria system. Journal of Animal Ecology 83, 256–265. [DOI] [PubMed] [Google Scholar]
- Cox FEG (2001) Concomitant infections, parasites and immune responses. Parasitology 122(S1), S23–S38. [DOI] [PubMed] [Google Scholar]
- Davis AK, Maney DL and Maerz JC (2008) The use of leukocyte profiles to measure stress in vertebrates: a review for ecologists. Function Ecology 22, 760–772. [Google Scholar]
- de Lope F, Møller AP and de la Cruz C (1998) Parasitism, immune response and reproductive success in the house martin Delichonurbica. Oecologia 114, 188–193. [DOI] [PubMed] [Google Scholar]
- Díez-Fernández A, Martín J, Martínez-de la Puente J, Gangoso L, López P, Soriguer R and Figuerola J (2023) Effects of sex and sampling site on the relative proportion of pesticides in uropygial gland secretions of European Blackbirds (Turdus merula). Ibis 165, 142–152. [Google Scholar]
- Dinhopl N, Nedorost N, Mostegl MM, Weissenbacher-Lang C and Weissenböck H (2015) In situ hybridization and sequence analysis reveal an association of Plasmodium spp. with mortalities in wild passerine birds in Austria. Parasitology Research 114, 1455–1462. [DOI] [PubMed] [Google Scholar]
- Drovetski SV, Aghayan SA, Mata VA, Lopes RJ, Mode NA, Harvey JA and Voelker G (2014) Does the niche breadth or trade-off hypothesis explain the abundance–occupancy relationship in avian Haemosporidia? Molecular Ecology 23, 3322–3329. [DOI] [PubMed] [Google Scholar]
- Dunn JC, Goodman SJ, Benton TG and Hamer KC (2013) Avian blood parasite infection during the non-breeding season: an overlooked issue in declining populations? BMC Ecology 13, 1–10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dunn JC, Stockdale JE, Bradford EL, McCubbin A, Morris AJ, Grice PV, Goodman SJ and Hamer KC (2017) High rates of infection by blood parasites during the nestling phase in UK Columbids with notes on ecological associations. Parasitology 144, 622–628. [DOI] [PubMed] [Google Scholar]
- Ellis VA, Kunkel MR and Ricklefs RE (2014) The ecology of host immune responses to chronic avian haemosporidian infection. Oecologia 176, 729–737. [DOI] [PubMed] [Google Scholar]
- Ellis VA, Cornet S, Merrill L, Kunkel MR, Tsunekage T and Ricklefs RE (2015) Host immune responses to experimental infection of Plasmodium relictum (lineage SGS1) in domestic canaries (Serinus canaria). Parasitology Research 114, 3627–3636. [DOI] [PubMed] [Google Scholar]
- Ferreira-Junior FC, de Angeli Dutra D, Silveira P, Pacheco RC, Witter R, de Souza Ramos DG, Pacheco MA, Escalante AA and Braga ÉM (2018) A new pathogen spillover from domestic to wild animals: Plasmodium juxtanucleare infects free-living passerines in Brazil. Parasitology 145, 1949–1958. [DOI] [PubMed] [Google Scholar]
- Garnick E (1992) Parasite virulence and parasite-host coevolution: a reappraisal. The Journal of Parasitology 78, 381–386. [PubMed] [Google Scholar]
- Gibson AK, Raverty S, Lambourn DM, Huggins J, Magargal SL and Grigg ME (2011) Polyparasitism is associated with increased disease severity in Toxoplasma gondii-infected marine sentinel species. PLoS Neglected Tropical Diseases 5, e1142. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Griffith DM, Veech JA and Marsh CJ (2016) Cooccur: probabilistic species co-occurrence analysis in R. Journal of Statistical Software 69, 1–17. [Google Scholar]
- Hananeh WM, Radhi A, Mukbel RM and Ismail ZB (2022) Effects of parasites coinfection with other pathogens on animal host: a literature review. World 15, 2414–2424. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hanssen SA, Hasselquist D, Folstad I and Erikstad KE (2004) Costs of immunity: immune responsiveness reduces survival in a vertebrate. Proceedings of the Royal Society of London. Series B: Biological Sciences 271, 925–930. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Harl J, Himmel T, Valkiūnas G, Ilgūnas M, Bakonyi T and Weissenböck H (2020) Geographic and host distribution of haemosporidian parasite lineages from birds of the family Turdidae. Malaria Journal 19, 1–35. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hatchwell BJ, Wood MJ, Anwar M and Perrins CM (2000) The prevalence and ecology of the haematozoan parasites of European blackbirds, Turdus merula. Canadian Journal of Zoology 78, 684–687. [Google Scholar]
- Hikosaka K, Watanabe YI, Kobayashi F, Waki S, Kita K and Tanabe K (2011) Highly conserved gene arrangement of the mitochondrial genomes of 23 Plasmodium species. Parasitology International 60, 175–180. [DOI] [PubMed] [Google Scholar]
- Himmel T, Harl J, Pfanner S, Nedorost N, Nowotny N and Weissenbock H (2020) Haemosporidioses in wild Eurasian blackbirds (Turdus merula) and song thrushes (T. philomelos): an in situ hybridization study with emphasis on exo-erythrocytic parasite burden. Malaria Journal 19, 1–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hoarau AO, Mavingui P and Lebarbenchon C (2020) Coinfections in wildlife: focus on a neglected aspect of infectious disease epidemiology. PLoS Pathogens 16, e1008790. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Karvonen A, Jokela J and Laine AL (2019) Importance of sequence and timing in parasite coinfections. Trends in Parasitology 35, 109–118. [DOI] [PubMed] [Google Scholar]
- Knowles SC, Palinauskas V and Sheldon BC (2010) Chronic malaria infections increase family inequalities and reduce parental fitness: experimental evidence from a wild bird population. Journal of Evolutionary Biology 23, 557–569. [DOI] [PubMed] [Google Scholar]
- Krams IA, Suraka V, Rantala MJ, Sepp T, Mierauskas P, Vrublevska J and Krama T (2013) Acute infection of avian malaria impairs concentration of haemoglobin and survival in juvenile altricial birds. Journal of Zoology 291, 34–41. [Google Scholar]
- Lachish S, Knowles SC, Alves R, Wood MJ and Sheldon BC (2011) Fitness effects of endemic malaria infections in a wild bird population: the importance of ecological structure. Journal of Animal Ecology 80, 1196–1206. [DOI] [PubMed] [Google Scholar]
- Larsson A (2014) Aliview: a fast and lightweight alignment viewer and editor for large data sets. Bioinformatics 30, 3276–3278. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lotta-Arévalo IA, González AD, Gamboa-Suárez BA, Pacheco MA, Escalante AA, Moreno C, Rodríguez-Fandíño O, Cuervo A and Matta NE (2023) Haemosporidians in non-passerine birds of Colombia: an overview of the last 20 years of research. Diversity 15, 57. [Google Scholar]
- Lutz HL, Hochachka WM, Engel JI, Bell JA, Tkach VV, Bates JM, Hackett SJ and Weckstein JD (2015) Parasite prevalence corresponds to host life history in a diverse assemblage of afrotropical birds and haemosporidian parasites. PLoS ONE 10, e0128851. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Macintosh AJJ and Frias L (2017) Coevolution of hosts and parasites. In Fuentes A (ed.), The International Encyclopedia of Primatology. Hoboken, NJ: Wiley, pp. 1–8. [Google Scholar]
- Mantilla JS, Matta NE, Pacheco MA, Escalante AA, González AD and Moncada LI (2013) Identification of Plasmodium (Haemamoeba) lutzi (Lucena, 1939) from Turdus fuscater (great thrush) in Colombia. The Journal of Parasitology 99, 662–668. [DOI] [PubMed] [Google Scholar]
- Martínez-de la Puente JM, Merino S, Tomás G, Moreno J, Morales J, Lobato E, Garcia-Fraile S and Belda EJ (2010) The blood parasite Haemoproteus reduces survival in a wild bird: a medication experiment. Biology Letters 6, 663–665. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Marzal A, Reviriego M, de Lope F and Møller AP (2007) Fitness costs of an immune response in the house martin (Delichon urbica). Behavioral Ecology and Sociobiology 61, 1573–1580. [Google Scholar]
- Marzal A, Bensch S, Reviriego M, Balbontin J and de Lope F (2008) Effects of malaria double infection in birds: one plus one is not two. Journal of Evolutionary Biology 21, 979–987. [DOI] [PubMed] [Google Scholar]
- McArdle AJ, Turkova A and Cunnington AJ (2018) When do co-infections matter? Current Opinion in Infectious Diseases 31, 209. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Merino S, Moreno J, Vásquez R, Martínez J, Sánchez-Monsálvez I, Estades C, Ippi S, Sabat P, Rozzi R and McGekee S (2008) Haematozoa in forest birds from southern Chile: latitudinal gradients in prevalence and parasite lineage richness. Austral Ecology 33, 329–340. [Google Scholar]
- Murdock CC, Adler PH, Frank J and Perkins SL (2015) Molecular analyses on host-seeking black flies (Diptera: Simuliidae) reveal a diverse assemblage of Leucocytozoon (Apicomplexa: Haemospororida) parasites in an alpine ecosystem. Parasites & Vectors 8, 1–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Norte AC, Araujo PM, Sampaio HL, Sousa JP and Ramos JA (2009) Haematozoa infections in a Great Tit Parus major population in Central Portugal: relationships with breeding effort and health. Ibis 151, 677–688. [Google Scholar]
- Olifiers N, Jansen AM, Herrera HM, Bianchi RD, D'Andrea PS, Mourao GD and Gompper ME (2015) Co-infection and wild animal health: effects of trypanosomatids and gastrointestinal parasites on coatis of the Brazilian Pantanal. PLoS ONE 10, e0143997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Omori S, Sato Y, Isobe T, Yukawa M and Murata K (2007) Complete nucleotide sequences of the mitochondrial genomes of two avian malaria protozoa, Plasmodium gallinaceum and Plasmodium juxtanucleare. Parasitology Research 100, 661–664. [DOI] [PubMed] [Google Scholar]
- Ots I, Kerimov AB, Ivankina EV, Ilyina TA and Hõrak P (2001) Immune challenge affects basal metabolic activity in wintering great tits. Proceedings of the Royal Society of London. Series B: Biological Sciences 268, 1175–1181. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pacheco MA, Matta NE, Valkiūnas G, Parker PG, Mello B, Stanley CE Jr., Lentino M, Garcia-Amado MA, Cranfield M, Kosakovsky Pond SL and Escalante AA (2018) Mode and rate of evolution of haemosporidian mitochondrial genomes: timing the radiation of avian parasites. Molecular Biology and Evolution 35, 383–403. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pacheco MA, García-Amado MA, Manzano J, Matta NE and Escalante AA (2019) Blood parasites infecting the Hoatzin (Opisthocomus hoazin), a unique neotropical folivorous bird. PeerJ 7, e6361. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Palinauskas V, Valkiūnas G, Bolshakov CV and Bensch S (2011) Plasmodium relictum (lineage SGS1) and Plasmodium ashfordi (lineage GRW2): the effects of the co-infection on experimentally infected passerine birds. Experimental Parasitology 127, 527–533. [DOI] [PubMed] [Google Scholar]
- Palinauskas V, Žiegytė R, Šengaut J and Bernotienė R (2018) Different paths–the same virulence: experimental study on avian single and co-infections with Plasmodium relictum and Plasmodium elongatum. International Journal for Parasitology 48, 1089–1096. [DOI] [PubMed] [Google Scholar]
- Pigeault R, Cozzarolo CS, Choquet R, Strehler M, Jenkins T, Delhaye J, Bovet L, Wassef J, Glaizot O and Christe P (2018) Haemosporidian infection and co-infection affect host survival and reproduction in wild populations of great tits. International Journal for Parasitology 48, 1079–1087. [DOI] [PubMed] [Google Scholar]
- Quillfeldt P, Martínez J, Bugoni L, Mancini PL and Merino S (2014) Blood parasites in noddies and boobies from Brazilian offshore islands – differences between species and influence of nesting habitat. Parasitology 141, 399–410. [DOI] [PubMed] [Google Scholar]
- Råberg L, Grahn M, Hasselquist D and Svensson E (1998) On the adaptive significance of stress-induced immunosuppression. Proceedings of the Royal Society of London. Series B: Biological Sciences 265, 1637–1641. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Råberg L, Nilsson JÅ, Ilmonen P, Stjernman M and Hasselquist D (2000) The cost of an immune response: vaccination reduces parental effort. Ecology Letters 3, 382–386. [Google Scholar]
- R Core Team (2021) R: A Language and Environment for Statistical Computing. Vienna, Austria: R Foundation for Statistical Computing. Available at https://www.R-project.org/ [Google Scholar]
- Rooyen JV, Lalubin F, Glaizot O and Christe P (2013) Avian haemosporidian persistence and co-infection in great tits at the individual level. Malaria Journal 12, 1–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Schoener ER, Banda M, Howe L, Castro IC and Alley MR (2014) Avian malaria in New Zealand. New Zealand Veterinary Journal 62, 189–198. [DOI] [PubMed] [Google Scholar]
- Shen SS, Qu XY, Zhang WZ, Li J and Lv ZY (2019) Infection against infection: parasite antagonism against parasites, viruses and bacteria. Infectious Diseases of Poverty 8, 1–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Smits JE (2007) Are we enlightened about the immunocompetence of a severely inbred population of New Zealand robins? Challenges inherent in studies using immunological endpoints. Animal Conservation 10, 14–16. [Google Scholar]
- Sol D, Jovani R and Torres J (2003) Parasite mediated mortality and host immune response explain age-related differences in blood parasitism in birds. Population Ecology 135, 542–547. [DOI] [PubMed] [Google Scholar]
- Starkloff NC and Galen SC (2023) Coinfection rates of avian blood parasites increase with latitude in parapatric host species. Parasitology 150, 1–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Strehmann F, Becker M, Lindner K, Masello JF, Quillfeldt P, Schumm YR, Farwig N, Schabo DG and Rösner S (2023) Half of a forest bird community infected with haemosporidian parasites. Frontiers in Ecology and Evolution 11, 1107736. [Google Scholar]
- Telfer S, Lambin X, Birtles R, Beldomenico P, Burthe S, Paterson S and Begon M (2010) Species interactions in a parasite community drive infection risk in a wildlife population. Science 330, 243–246. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Thomas RC, Dunn JC, Dawson DA, Hipperson H, Horsburgh GJ, Morris AJ, Orsman C, Mallord J, Grice PV, Hamer KC and Eraud C (2022) Assessing rates of parasite coinfection and spatiotemporal strain variation via metabarcoding: insights for the conservation of European Turtle Doves Streptopelia turtur. Molecular Ecology 31, 2730–2751. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Thumbi SM, Bronsvoort BM, Poole EJ, Kiara H, Toye PG, Mbole-Kariuki MN, Conradie I, Jennings A, Handel IG, Coetzer JAW and Steyl JC (2014) Parasite co-infections and their impact on survival of indigenous cattle. PLoS ONE 9, e76324. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Townsend AK, Wheeler SS, Freund D, Sehgal RNM and Boyce WM (2018) Links between blood parasites, blood chemistry, and the survival of nestling American crows. Ecology and Evolution 8, 8779–8790. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Valkiūnas G, Iezhova TA and Shapoval AP (2003) High prevalence of blood parasites in hawfinch Coccothraustes coccothraustes. Journal of Natural History 37, 2647–2652. [Google Scholar]
- Valkiūnas G, Iezhova TA, Loisseau C and Sehgal RNM (2009) Nested cytochrome b polymerase chain reaction diagnostics detect sporozoites of haemosporidian parasites in peripheral blood of naturally infected birds. Journal of Parasitology 95, 1512–1515. [DOI] [PubMed] [Google Scholar]
- Vanstreels RE, Dutra DD, Ferreira-Junior FC, Hurtado R, Egert L, Mayorga LF, Bhering RC, Braga ÉM and Catão-Dias JL (2019) Epidemiology, hematology, and unusual morphological characteristics of Plasmodium during an avian malaria outbreak in penguins in Brazil. Parasitology Research 118, 3497–3508. [DOI] [PubMed] [Google Scholar]
- Vieira-Santos F, Leal-Silva T, de Lima Silva Padrão L, Ruas AC, Nogueira DS, Kraemer L, Oliveira FM, Caliari MV, Russo RC, Fujiwara RT and Bueno LL (2021) Concomitant experimental coinfection by Plasmodium berghei NK65-NY and Ascaris suum downregulates the Ascaris-specific immune response and potentiates Ascaris-associated lung pathology. Malaria Journal 20, 1–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wojczulanis-Jakubas K, Jakubas D, Czujkowska A, Kulaszewicz I and Kruszewicz AG (2012) Blood parasite infestation and the leukocyte profiles in adult and immature reed warblers (Acrocephalus scirpaceus) and sedge warblers (Acrocephalus schoenobaenus) during autumn migration. Annales Zoologici Fennici 49, 341–349. [Google Scholar]
- Woodworth BL, Atkinson CT, Lapointe DA, Hart PJ, Spiegel CS, Tweed EJ, Henneman C, LeBrun J, Denette T, DeMots R, Kozar KL, Triglia D, Lease D, Gregor A, Smith T and Duffy D (2005) Host population persistence in the face of introduced vector-borne diseases: Hawaii amakihi and avian malaria. Proceedings of the National Academy of Sciences of the USA 102, 1531–1536. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yorinks N and Atkinson CT (2000) Effects of malaria on activity budgets of experimentally infected juvenile Apapane (Himatione sanguinea). The Auk 117, 731–738. [Google Scholar]
- Zehtindjiev P, Ilieva M, Westerdahl H, Hansson B, Valkiūnas G and Bensch S (2008) Dynamics of parasitemia of malaria parasites in a naturally and experimentally infected migratory songbird, the great reed warbler Acrocephalus arundinaceus. Experimental Parasitology 119, 99–110. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Lebeau and Dunn supplementary material
Data Availability Statement
Sequences generated in this research are accessible through GenBank accession numbers PP850198–PP850217.


