Andrographolide as a Multi-Target Therapeutic Agent in Diabetic Nephropathy: Insights into STAT3/PI3K/Akt Pathway Modulation

Abstract

Diabetic nephropathy (DN) remains a leading cause of end-stage renal disease (ESRD), driven by chronic inflammation, oxidative stress, and apoptosis. Current therapies targeting glycemic and blood pressure control fail to address the underlying molecular mechanisms of DN. This study investigates the therapeutic potential of andrographolide (AD), a diterpenoid lactone from Andrographis paniculata, in mitigating DN by modulating key molecular pathways. Through integrative network pharmacology, molecular docking, and in vivo/in vitro experiments, 107 overlapping DN-related targets were identified, with STAT3, PI3K, and AKT1 emerging as core nodes. Molecular docking revealed high binding affinities between AD and these targets, supporting its modulatory potential. In vivo, AD significantly improved renal function in streptozotocin-induced DN rats, reducing proteinuria, glomerular hypertrophy, and renal fibrosis. AD also attenuated oxidative stress, decreased pro-inflammatory cytokine levels, and enhanced antioxidant enzyme activities, demonstrating systemic anti-inflammatory and antioxidative effects. In vitro studies further confirmed that AD alleviates podocyte oxidative stress and apoptosis under high glucose conditions by suppressing the RAGE-NF-κB and STAT3/PI3K/Akt pathways. Histological analyses revealed substantial improvements in renal architecture, including reductions in fibrosis and mesangial expansion. These results underscore AD’s multi-target mechanism, directly addressing DN’s core pathological drivers, including inflammation, oxidative stress, and apoptosis. As a natural compound with notable safety and efficacy, AD holds promise as an adjunct or standalone therapeutic agent for DN. This study establishes a robust preclinical foundation for AD, warranting further exploration in clinical trials and its potential application in other diabetic complications.

INTRODUCTION

Diabetic nephropathy (DN) stands as one of the most severe microvascular complications of diabetes mellitus (DM), and is a leading cause of end-stage renal disease (ESRD) worldwide (Qiu et al., 2023; Zou et al., 2023). Epidemiological data indicate that approximately 30% of individuals with diabetes will progress to DN, establishing it as a significant contributor to the global ESRD burden (Horiba et al., 2022). The pathogenesis of DN is highly complex, involving the interplay of metabolic, hemodynamic, and inflammatory factors that collectively drive renal injury and, ultimately, renal failure (Yang and Liu, 2022). Although glycemic control and blood pressure management have improved DN patient outcomes, these interventions largely fail to address the underlying molecular mechanisms that promote disease progression, highlighting the need for novel therapies capable of intervening in these processes at a molecular level (Bell, 2022).

Persistent hyperglycemia in diabetic patients initiates a cascade of cellular and molecular changes that promote DN. Hyperglycemia induces the production of reactive oxygen species (ROS) and advanced glycation end-products (AGEs) within renal tissues, both of which play critical roles in DN pathogenesis (Zhang et al., 2022; Zheng et al., 2023). AGEs, in particular, are known to activate key intracellular signaling cascades, such as the receptor for AGEs (RAGE), nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB), c-Jun N-terminal kinase (JNK), and the phosphoinositide 3-kinase/protein kinase B (PI3K/Akt) pathway (Chen et al., 2022; Zhang et al., 2024). Together, these pathways increase oxidative damage, drive inflammation, promote extracellular matrix (ECM) accumulation, and trigger apoptosis, leading to glomerular and tubular dysfunction (Xu et al., 2023; Negeem et al., 2024; Yuan et al., 2024). Additionally, hyperactivation of these signaling pathways leads to the overproduction of pro-inflammatory cytokines, such as tumor necrosis factor-alpha (TNF-α), interleukin-1 beta (IL-1β), and transforming growth factor-beta (TGF-β), which further contribute to renal inflammation and fibrosis (Zhao, 2018; Bai et al., 2019; Mansoor et al., 2022). These molecular changes foster a pro-fibrotic environment that perpetuates DN progression.

The STAT3/PI3K/Akt signaling axis is particularly significant in DN pathogenesis, due to its role in coordinating cellular responses to oxidative stress, inflammation, and ECM synthesis (A-Elgadir et al., 2024; Leng et al., 2024). Signal transducer and activator of transcription 3 (STAT3) is a transcription factor that responds to cytokines and growth factors and is abnormally activated in DN (Huang et al., 2023; Liu et al., 2023b). This activation correlates with the upregulation of genes involved in inflammation, ROS production, and ECM deposition, each of which is closely tied to renal fibrosis (Cho et al., 2022). STAT3 also interacts with the PI3K/Akt pathway, which regulates cellular metabolism, growth, and survival, and this cross-talk further amplifies pathological processes within the kidneys (Wang et al., 2024a). Dysregulation of the PI3K/Akt pathway promotes mesangial cell proliferation, glomerular hypertrophy, and podocyte apoptosis, all of which are hallmark features of DN (Hall et al., 2018; Al-Rawashde et al., 2022). Given the centrality of STAT3/PI3K/Akt signaling in DN, it represents a compelling therapeutic target for halting or reversing disease progression.

In recent years, natural compounds with multi-target potential have attracted increasing attention as promising therapeutic agents for chronic diseases, including DN. Among these, andrographolide (AD), a diterpenoid lactone derived from Andrographis paniculata, has garnered interest for its broad-spectrum pharmacological properties (Huang et al., 2022). AD has demonstrated anti-inflammatory, antioxidant, and anti-apoptotic effects in various preclinical studies, and its therapeutic potential has been explored in traditional medicine systems, including Ayurveda and Traditional Chinese Medicine, for conditions such as infections and liver disorders (Adiguna et al., 2023). More recently, AD has shown efficacy in chronic disease models, including cancer, cardiovascular, and metabolic disorders, and has been reported to exert protective effects in diabetic complications by reducing oxidative stress and inflammation, two critical contributors to renal injury in DN (Liu et al., 2023a). Despite these promising findings, the precise molecular mechanisms through which AD confers renoprotection in DN remain insufficiently characterized. Particularly, its impact on key signaling pathways such as STAT3 and PI3K/Akt in DN pathogenesis has not been fully elucidated.

To further investigate AD’s therapeutic potential in DN, network pharmacology provides an innovative systems-level approach that allows for the identification of multiple targets and pathways within the disease’s complex molecular landscape (Dixit et al., 2024). Unlike conventional drug discovery methods that focus on single-target interactions, network pharmacology integrates bioinformatics and systems biology to facilitate a comprehensive view of drug interactions with multiple molecular targets within complex diseases (Shi et al., 2022). This approach is particularly relevant for compounds like AD, which exhibit broad-spectrum biological activities and may impact numerous pathways simultaneously. Through the application of network pharmacology, we can map the molecular targets of AD and reveal key interactions within the STAT3/PI3K/Akt pathway, thereby offering insights into its potential mechanisms of action in DN. Additionally, molecular docking techniques support these analyses by providing quantitative data on the binding affinities of AD to critical proteins involved in DN pathogenesis, including STAT3, PI3K, and Akt, reinforcing its nephroprotective potential.

Based on the essential role of the STAT3/PI3K/Akt pathway in DN progression and the known pharmacological properties of AD, we hypothesized that AD exerts renoprotective effects in DN through targeted modulation of this signaling axis. To investigate this hypothesis, we employed a multi-dimensional approach combining network pharmacology, molecular docking, and experimental validation in both in vitro and in vivo models of DN. This integrative strategy provides a more comprehensive understanding of AD’s therapeutic effects and underlying mechanisms in DN, establishing a robust preclinical foundation for its potential application. By elucidating AD’s multi-target effects within the context of DN, this study aims to contribute to the development of AD as an innovative therapeutic agent for DN, while also advancing our understanding of therapeutic strategies for managing this complex and progressive renal disease. The experimental scheme design of this study is shown in Fig.1. The corresponding table of English abbreviations and their full forms for this document is provided in Table 1.

Fig. 1.

Integrated workflow for exploring the therapeutic mechanisms of andrographolide (AD) in diabetic nephropathy (DN). This schematic highlights the integration of computational predictions and experimental validations to comprehensively explore the mechanisms of AD in DN treatment.

Table 1.

The Abbreviations and their full forms in the manuscript

Abbreviation	Full form
AD	Andrographolide
AGEs	Advanced Glycation End Products
Akt	Protein Kinase B
BUN	Blood Urea Nitrogen
CASP3	Caspase 3
DN	Diabetic Nephropathy
EGFR	Epidermal Growth Factor Receptor
ERK	Extracellular Signal-Regulated Kinas
ESRD	End-Stage Renal Disease
IL-1β	Interleukin-1 Beta
JNK	c-Jun N-terminal Kinase
KEGG	Kyoto Encyclopedia of Genes and Genomes
LPO	Lipid Peroxidation
MAPK	Mitogen-Activated Protein Kinase
MDA	Malondialdehyde
NF-κB	Nuclear Factor Kappa B
PI3K	Phosphatidylinositol 3-Kinase
PPARα	Peroxisome Proliferator-Activated Receptor Alpha
ROS	Reactive Oxygen Species
RAGE	Receptor for Advanced Glycation End Products
Scr	Serum Creatinine
SOD	Superoxide Dismutase
STAT3	Signal Transducer and Activator of Transcription 3
TC	Total Cholesterol
TG	Triglycerides
TNF-α	Tumor Necrosis Factor Alpha

MATERIALS AND METHODS

Network pharmacology analysis

A network pharmacology approach was used to identify potential therapeutic targets of andrographolide (AD) in diabetic nephropathy (DN). First, AD-associated targets were extracted from public databases, including DrugBank (https://www.drugbank.ca/) and SwissTargetPrediction (http://www.swisstargetprediction.ch/), which catalog detailed data on small molecules, their biological targets, and interactions. Targets from both sources were consolidated, removing duplicates to generate a comprehensive, non-redundant target list. DN-related targets were then identified using DisGeNET (https://www.disgenet.org/), GeneCards (https://www.genecards.org/), and the Therapeutic Target Database (TTD, https://db.idrblab.net/ttd/). To ensure target relevance, criteria such as GeneCards relevance score >10 and DisGeNET gene-disease association score >0.06 were applied. The intersection of AD-associated and DN-related targets was visualized with a Venn diagram generated in R using the “VennDiagram” package. Intersection targets, representing potential AD therapeutic targets in DN, were then subjected to protein-protein interaction (PPI) network construction and functional enrichment analysis.

PPI analysis was conducted by inputting the identified common targets into the STRING database (http://string-db.org/) to gather data on known and predicted protein interactions. Cytoscape software (version 3.9.0) was used to visualize interaction networks, with CytoHubba plugin identifying key hub proteins based on topological features such as degree centrality, closeness centrality, and betweenness centrality. Gene Ontology (GO) enrichment and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis were carried out using the DAVID database (https://david.ncifcrf.gov/) to explore biological processes, cellular components, molecular functions, and pathways associated with the common targets. Pathways with p-values <0.05 were deemed significantly enriched, and the top 10 pathways were selected for further investigation.

Molecular docking studies

To validate AD’s interactions with key DN proteins, molecular docking was performed on SwissDock (http://www.swissdock.ch/). The 3D structures of AD and irbesartan (a standard DN therapeutic agent) were retrieved from PubChem (https://pubchem.ncbi.nlm.nih.gov/) and converted to Mol2 format using Open Babel software. Proteins such as STAT3, PI3K, and Akt, identified as key targets via network pharmacology, were selected for docking. Protein structures were downloaded from the Protein Data Bank (PDB, https://www.rcsb.org/). Each protein was prepared by removing water molecules and adding polar hydrogen atoms and charges using UCSF Chimera (version 1.14) to optimize the structures for docking. SwissDock was employed using default parameters, with CHARMM force field utilized for energy minimization. Docking results were ranked based on Gibbs free binding energy (ΔG), with ΔG values below –8 kcal/mol considered significant. The binding modes of AD with STAT3, PI3K, and Akt were visualized in Chimera, with hydrogen bond interactions analyzed to evaluate the stability and strength of each interaction.

In vivo experimental study

Animal model and grouping: A total of 50 male Sprague-Dawley (SD) rats (6-8 weeks old, 180 ± 20 g) were procured from the Animal Experiment Center of Anhui Medical University. All animals were housed under standard environmental conditions (temperature: 24-26°C, humidity: 50-60%, 12-h light/dark cycle) with free access to food and water. Following a one-week acclimatization period, the rats were randomly divided into two groups: a normal control group (NC, n=10) receiving standard chow and a high-fat diet group (n=40) to establish the diabetic nephropathy (DN) model. The experimental protocols were approved by the Ethics Committee of Anhui Medical University (Approval No.: LLSC20240994). After eight weeks of high-fat diet feeding, the model group was subjected to intraperitoneal injections of streptozotocin (STZ, 35 mg/kg in pH 4.5 citrate buffer) to induce diabetes, while the NC group received equivalent volumes of citrate buffer. Blood glucose levels were measured 72 h post-STZ injection using a glucometer, and rats with glucose levels ≥16.7 mmol/L were confirmed diabetic. Four weeks post-STZ injection, 24-h urine samples were collected, and urine protein levels were assessed. Rats with 24-h urinary protein levels exceeding 30 mg were identified as having DN. The DN model rats (n=40) were further divided into four experimental subgroups (n=10 per group): (1) model control group (M), (2) low-dose andrographolide group (M-AD-5, 5 mg/kg), (3) high-dose andrographolide group (M-AD-50, 50 mg/kg), and (4) irbesartan group (M-Irb, 25 mg/kg). Treatments were administered orally via gavage once daily for 12 weeks. The NC group received deionized water as a vehicle control. This experimental design ensured rigorous establishment of the DN model and precise evaluation of treatment effects, allowing for direct comparisons between AD and the standard DN therapeutic agent, irbesartan. n this study, we selected 5 mg/kg and 50 mg/kg as the experimental doses for AD based on the following justifications:

AD’s effective dose range in animal studies is commonly reported between 5-50 mg/kg. The lower dose (5 mg/kg) was chosen to observe baseline therapeutic effects, while the higher dose (50 mg/kg) aimed to evaluate maximum pharmacological efficacy (Ji et al., 2016; Qu et al., 2022). AD has a relatively short half-life and limited bioavailability, and higher doses are more likely to reflect its full therapeutic potential (Panossian et al., 2000).

General observations and urine collection: Rats were observed daily for general health, including activity level, fur condition, food and water intake. Body weight was recorded every four weeks. At the end of the 12-week treatment, 24-h urine was collected for urinary protein measurement using a BCA assay kit.

Blood biochemistry and renal function: After 16 weeks, rats were anesthetized (1% sodium pentobarbital, 40 mg/kg i.p.), and blood was drawn from the femoral artery. Blood samples were coagulated for 2 h at room temperature, then centrifuged at 2500 rpm for 20 min at 4°C to obtain serum. The protein concentrations utilized in this study and the sources of antibodies are detailed in Table 2. Serum levels of creatinine (Scr), urea nitrogen (BUN), total cholesterol (TC), triglycerides (TG), and low-density lipoprotein (LDL) were measured using an automatic biochemical analyzer. Oxidative stress markers, including ROS, superoxide dismutase (SOD), and malondialdehyde (MDA), were quantified using commercial assay kits.

Table 2.

Antibodies used in Western blot assays. A table cataloging primary and secondary antibodies used in Western blotting, with specific dilution ratios and catalog numbers to ensure reproducibility

Antibody name	Dilution ratio	Company information
STAT3	1:1000	Abcam, Cambridge, UK
AKT1	1:2000	Abcam
PI3K	1:1000	Santa Cruz, CA, USA
JUN	1:1000	Abcam
CASP3	1:1000	Abcam
MAPK	1:2000	Santa Cruz
ERBB2	1:1000	Abcam
PPARα	1:1000	Sigma, MO, USA
GAPDH	1:500	Sigma

Histopathological examination: Following blood collection, rats were euthanized, and kidneys were harvested for histological analysis. Kidneys were fixed in 4% paraformaldehyde, embedded in paraffin, and sectioned (4-5 µm). Hematoxylin and eosin (H&E) staining was performed for general histological assessment, while Masson’s trichrome staining assessed fibrosis. A blinded pathologist evaluated renal damage, including glomerular hypertrophy, mesangial expansion, and tubular-interstitial fibrosis using light microscopy.

In vitro studies: podocyte culture and AGEs-induced injury model

Podocyte culture: Mouse podocytes (MPC-5) were cultured in DMEM/F12 medium with 10% FBS and 1% penicillin-streptomycin at 37°C in 5% CO₂. Cells were used between passages 5-10 for experiments.

AGEs-induced podocyte injury model: An injury model was induced in MPC-5 cells with 200 μg/mL AGEs for 48 h, followed by AD treatment (20, 40, 80 μM) or irbesartan (50 μM) for 24 h. Untreated cells served as controls.

Cell viability and ROS detection: Cell viability was evaluated with a CCK-8 assay (Beyotime) and ROS levels with DCFH-DA probe (Beyotime). Fluorescence was measured under a confocal microscope, and intensity was quantified in ImageJ.

Western blot and immunofluorescence

Protein expression of STAT3, PI3K, and Akt was assessed via Western blotting. MPC-5 cells were lysed, and protein concentration was determined using a BCA assay. Proteins were separated via SDS-PAGE and transferred to PVDF membranes. Membranes were incubated overnight with primary antibodies, followed by secondary antibody incubation and chemiluminescent detection. For immunofluorescence, cells were fixed, permeabilized, and stained with primary antibodies (e.g., anti-RAGE). Confocal microscopy captured fluorescent images.

Statistical analysis

Data were analyzed using GraphPad Prism 9.0, with results expressed as mean ± SD. Normality was tested with the Shapiro-Wilk test, and variance homogeneity with Levene’s test. Parametric data were analyzed via one-way ANOVA with LSD post hoc tests, and non-parametric data via Kruskal-Wallis tests. A p-value <0.05 was considered statistically significant.

RESULTS

Network pharmacology target prediction and analysis

Using a network pharmacology approach, 188 potential therapeutic targets of andrographolide (AD) and 3,791 diabetic nephropathy (DN)-related targets were identified through comprehensive data mining. After eliminating duplicates, 107 overlapping targets were identified, representing 56.91% of AD’s targets and 2.82% of DN-related targets (Fig. 2A). This significant overlap suggests that AD may exert therapeutic effects on DN by modulating these shared targets. A protein-protein interaction (PPI) network was constructed using STRING and analyzed in Cytoscape to assess the biological relevance of the shared targets. Key topological properties, including degree centrality (DC), betweenness centrality (BC), and closeness centrality (CC), were evaluated using the CytoHubba plugin. Eight core targets—STAT3, AKT1, PI3K, JUN, CASP3, MAPK, ERBB2, and PPARα—were identified as key regulators and prioritized for further investigation (Fig. 2B, 2C).

Fig. 2.

Target prediction and functional enrichment analysis of andrographolide (AD) in diabetic nephropathy (DN). (A) Venn diagram showing 107 overlapping targets between AD and DN, highlighting their therapeutic relevance. These shared targets represent 56.91% of AD’s targets and 2.82% of DN-related targets. (B) PPI network of overlapping targets constructed via STRING, with core targets (red nodes) identified based on topological centrality metrics. (C) Core targets in the PPI network, including STAT3, AKT1, PI3K, JUN, CASP3, MAPK, ERBB2, and PPARα, prioritized for further study due to their central roles in DN pathophysiology.

Functional enrichment analysis of the shared targets revealed significant biological processes (BP), including protein phosphorylation and positive regulation of the MAPK cascade. Cellular components (CC) were predominantly localized to the plasma membrane and extracellular exosomes, while molecular functions (MF) involved protein kinase activity and ATP binding (Fig. 3A-3C). KEGG pathway analysis identified enrichment in critical signaling pathways, including the AGE-RAGE signaling pathway, PI3K-Akt signaling, and MAPK signaling, underscoring the multi-target, multi-pathway therapeutic potential of AD in DN (Fig. 3D).

Fig. 3.

GO and KEGG Pathway Enrichment Analysis for Molecular Functions, Cellular Components, Biological Processes, and Pathways. (A) GO enrichment analysis for Biological Processes (BP). (B) GO enrichment analysis for Cellular Components (CC). (C) GO enrichment analysis for Molecular Functions (MF). (D) KEGG pathway enrichment analysis. Dot plot of the KEGG pathway enrichment analysis. The horizontal axis represents the Enrichment, while the vertical axis represents the enriched pathway name. The color scale indicates different thresholds of the p-value, and the size of the dot indicates the number of genes corresponding to each pathway.

Functional enrichment analysis of core targets

Gene Ontology (GO) enrichment analysis revealed that andrographolide (AD) modulates key biological processes (BP) such as protein phosphorylation, inflammatory response, and positive regulation of transcriptional activity, which are highly relevant to diabetic nephropathy (DN) pathophysiology. Core targets were also associated with molecular functions (MF) including transcription factor binding, kinase activity, and oxidoreductase activity, reflecting their roles in signal transduction and oxidative stress regulation. Furthermore, cellular component (CC) analysis highlighted the localization of these targets to the plasma membrane, cytosol, and nuclear compartments, aligning with their involvement in DN-relevant pathways. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis underscored significant enrichment in pathways central to DN pathogenesis, including the AGE-RAGE signaling pathway, which plays a pivotal role in oxidative stress and inflammation; the PI3K-Akt signaling pathway, which is critical for cellular survival and metabolism; and the MAPK signaling pathway, involved in inflammatory cascades. Other enriched pathways include lipid metabolism, autophagy, and atherosclerosis, suggesting a multifaceted regulatory role of AD (Fig. 4, 5).

Fig. 4.

Integrated analysis of core targets and enriched pathways associated with andrographolide (AD) in diabetic nephropathy (DN). (A) Protein-Protein Interaction (PPI) Network: The core targets, including STAT3, PI3K, AKT1, MAPK1, CASP3, JUN, and ERBB2, were identified from the intersection of AD targets and DN-associated genes. Nodes represent individual proteins, while the edges indicate predicted functional and physical interactions. STAT3, as the central node, highlights its key regulatory role in DN-related pathways. (B) Gene Ontology (GO) Enrichment Analysis: Enriched biological processes (BP), cellular components (CC), and molecular functions (MF) are displayed. Prominent processes include protein tyrosine kinase activity, signal transduction, and extracellular matrix organization. The x-axis indicates specific terms, while the y-axis shows enrichment scores. (C) KEGG Pathway Analysis: The Sankey diagram links core targets to significantly enriched pathways, such as “Pathways in cancer,” “Lipid and atherosclerosis,” “AGE-RAGE signaling in diabetic complications,” and “HIF-1 signaling.” Dot plots illustrate the number of genes (size of the dot) and significance levels (-log10 p-value, color gradient) for each pathway, emphasizing their relevance in DN pathogenesis.

Fig. 5.

Key signaling pathways involved in the therapeutic mechanism of andrographolide (AD) in diabetic nephropathy (DN). (A) AGE-RAGE signaling pathway in diabetic complications. Highlighted in red are core targets, including PI3K, STAT3, AKT1, and CASP3, which play pivotal roles in inflammation, oxidative stress, apoptosis, and vascular remodeling. (B) PI3K-AKT and related pathways involved in cellular processes. Core targets, marked in red (e.g., PI3K, AKT1, JUN), underscore their involvement in mitochondrial survival, cell proliferation, apoptosis, and immune responses.

Molecular docking to validate binding affinity

Molecular docking simulations were performed to validate the predicted interactions of andrographolide (AD) with core targets identified through network pharmacology. The SwissDock web server was utilized to assess the binding affinity of AD and irbesartan (Irb), a standard therapeutic agent for diabetic nephropathy (DN), against key targets such as STAT3, AKT1, PI3K, JUN, CASP3, MAPK1, ERBB2, and PPARα. Gibbs free energy (ΔG) was used as a measure of binding affinity, with ΔG values below –8 kcal/mol considered indicative of strong binding interactions. The docking results demonstrated that AD exhibited high binding affinity for most core targets, with ΔG values consistently below –8 kcal/mol, confirming stable interactions. Notably, STAT3 showed a binding energy of –12.4 kcal/mol, suggesting a particularly strong and stable interaction with AD, exceeding the binding affinity of Irb for the same target. The docking simulation results were further visualized to illustrate the spatial alignment of AD and Irb with the active sites of target proteins. Hydrogen bonds and hydrophobic interactions were identified as the primary forces stabilizing these complexes (Supplementary Fig. 1). These findings support the hypothesis that AD could modulate DN pathophysiology through direct interactions with multiple key targets, offering potential advantages over standard therapies such as Irb.

Effects of andrographolide (AD) on general observations and key renal markers in DN rats

Diabetic nephropathy (DN) model rats, induced by a high-fat diet and STZ injection, exhibited characteristic symptoms such as fatigue, reduced activity, increased water intake, and elevated 24-h urinary volumes compared to normal controls (p<0.01). Untreated DN rats developed severe complications, including urinary tract infections, limb edema, and toe ulcers, reflecting disease progression. Treatment with AD (5 mg/kg and 50 mg/kg) or irbesartan (Irb, 25 mg/kg) significantly mitigated these symptoms, indicating their protective effects (Fig. 6A).

Fig. 6.

Andrographolide (AD) alleviates diabetic nephropathy (DN) symptoms by improving renal function, lipid metabolism, and oxidative stress. (A-B) Body weight and 24-h urinary protein levels among experimental groups. (C-E) Renal function markers: serum creatinine (Scr), urea, and AGEs levels. (F-H) Lipid profiles: total cholesterol (TC), triglycerides (TG), and low-density lipoprotein (LDL). (I-J) Oxidative stress markers: reactive oxygen species (ROS) and superoxide dismutase (SOD). (K-L) Lipid peroxidation markers: lipid peroxides (LPO) and malondialdehyde (MDA). Data are mean ± SD, with statistical significance denoted by *p<0.05, **p<0.01. n=6 per group for biological replicates in each experiment.

High-dose AD (50 mg/kg) and Irb treatments significantly reduced DN-associated weight gain (p<0.01), suggesting AD’s ability to counteract hyperglycemia-related metabolic dysfunction. Similarly, 24-h urinary protein levels, a marker of renal dysfunction, were significantly decreased in the high-dose AD and Irb groups (p<0.01), whereas low-dose AD (5 mg/kg) showed no significant improvement (Fig. 6B).

Serum creatinine (Scr) and urea levels, critical indicators of renal function, were significantly elevated in DN model rats compared to controls (p<0.01). Both high-dose AD and Irb significantly reduced Scr and urea levels (p<0.05 and p<0.01, respectively), demonstrating comparable efficacy in ameliorating DN-related renal impairments (Fig. 6C-6E). AGEs, key markers of oxidative stress and DN progression, were significantly elevated in DN rats (p<0.01). High-dose AD (50 mg/kg) and Irb treatments resulted in a significant reduction in AGEs levels (p<0.01), whereas low-dose AD showed a modest but non-significant decrease (Fig. 6D). These findings suggest that AD effectively reduces AGE accumulation, contributing to its protective effects against DN pathogenesis.

Effects of AD on lipid profiles and oxidative stress markers

DN model rats exhibited elevated total cholesterol (TC), triglycerides (TG), and low-density lipoprotein (LDL) levels (p<0.01). High-dose AD and Irb significantly reduced these lipid markers (p<0.01), underscoring AD’s potential hypolipidemic and renoprotective effects (Fig. 6F-6H). Reactive oxygen species (ROS) levels were significantly increased, while superoxide dismutase (SOD) activity was reduced in DN rats, reflecting heightened oxidative stress (p<0.01). High-dose AD and Irb markedly reduced ROS levels and restored SOD activity (p<0.01), confirming AD’s antioxidative properties (Fig. 6I, 6J). Markers of lipid peroxidation, such as lipid peroxides (LPO) and malondialdehyde (MDA), were significantly elevated in DN renal tissues (p<0.01). Both high-dose AD and Irb significantly reduced LPO and MDA levels (p<0.01 and p<0.05, respectively), suggesting AD’s ability to mitigate oxidative damage and protect renal tissue from DN-related complications (Fig. 6K, 6L).

CCK-8 assay to evaluate cell viability

The CCK-8 assay demonstrated no significant differences in cell proliferation among the treatment groups, confirming that the selected andrographolide (AD) concentrations were non-toxic and suitable for further experiments. Viability levels for all groups remained within 80%-120% of the control, supporting the safety and efficacy of AD at the tested concentrations (Fig. 7A).

Fig. 7.

Andrographolide (AD) mitigates oxidative stress and inflammation in diabetic nephropathy (DN) model cells. (A) CCK-8 assay results showing cell proliferation capacity across experimental groups. (B-D) Intracellular oxidative stress markers: reactive oxygen species (ROS), GSH/GSSG ratio, and malondialdehyde (MDA). (E-H) Pro-inflammatory cytokines (TNF-α, IL-1β, PGE2, TXB2) measured in cell supernatants. Data are mean ± SD, with statistical significance denoted by **p<0.01.

Intracellular oxidative stress analysis

To assess oxidative stress, intracellular ROS levels and the GSH/GSSG ratio were measured. Diabetic nephropathy (DN) model cells exhibited significantly elevated ROS levels and decreased GSH/GSSG ratios compared to controls. High-dose AD (80 µmol/L) significantly reduced ROS levels and restored the GSH/GSSG ratio, demonstrating antioxidative effects comparable to irbesartan (Irb) (Fig. 7B, 7C). Additionally, malondialdehyde (MDA), a key marker of lipid peroxidation, was significantly elevated in DN model cells. Treatment with high-dose AD and Irb effectively reduced MDA levels, further supporting AD’s ability to mitigate oxidative stress (Fig. 7D).

Cytokine quantification in cell supernatants

ELISA analyses revealed that pro-inflammatory cytokines, including TNF-α, IL-1β, PGE2, and TXB2, were markedly elevated in DN cell supernatants compared to controls. Treatment with high-dose AD (80 µmol/L) and Irb significantly reduced the levels of these cytokines, indicating potent anti-inflammatory effects. Low-dose AD (20 µmol/L) demonstrated a moderate but non-significant reduction, highlighting a dose-dependent effect of AD on cytokine inhibition (Fig. 7E-7H).

Molecular docking to validate binding affinity

Molecular docking simulations were performed using the SwissDock web server to validate andrographolide’s (AD) predicted interactions with core targets identified through Network pharmacology. Irbesartan (Irb), a standard therapeutic agent for diabetic nephropathy (DN), was used as a reference compound. Binding affinities were calculated based on Gibbs free energy (ΔG), with values below –8 kcal/mol indicating strong interactions. As shown in Supplementary Table 1, the results demonstrated that AD exhibited strong binding affinities with the majority of the core targets, including STAT3, AKT1, PI3K, and JUN. Notably, STAT3 displayed a binding energy below –12 kcal/mol, highlighting a particularly stable interaction with AD. These findings suggest that AD has the potential to modulate key targets involved in DN pathophysiology.

Comparative docking results for Irb revealed similar trends, further supporting the therapeutic relevance of these targets. Spatial alignment of AD and Irb within the active binding sites of target proteins, as visualized in Supplementary Fig. 1, underscores AD’s potential as a multi-target therapeutic agent for DN.

Effects of andrographolide (AD) on mRNA expression of core targets in renal tissue

Quantitative RT-PCR analysis revealed significant alterations in the mRNA expression of key targets in diabetic nephropathy (DN) model rats. STAT3, PI3K, CASP3, and ERBB2 mRNA levels were significantly downregulated, while AKT1, JUN, MAPK, and PPARα levels were upregulated compared to normal controls (p<0.01). The mRNA sequences employed in this study are presented in Table 3. Treatment with high-dose AD (50 mg/kg) and irbesartan (Irb) effectively reversed these changes. Specifically, AD significantly upregulated STAT3, PI3K, CASP3, and ERBB2 expression while downregulating AKT1, JUN, MAPK, and PPARα levels (p<0.05), indicating AD’s capacity to modulate DN-associated signaling pathways at the transcriptional level (Supplementary Fig. 2A).

Table 3.

Primer sequences for quantitative RT-PCR. This table lists primers used to quantify mRNA expression of core target genes in DN kidney tissues, supporting gene expression analysis

Target gene	Direction	Primer Sequence (5’ - 3’)	NCBI RefSeq NM number
STAT3	Forward	GAGAGCGGCCAAGATGACAG	NM_001804
	Reverse	CAGCCAGGTAGGTTGTAGAG	NM_001804
AKT1	Forward	CCGTCCTCCTCCTGTCTTCTTC	NM_005428
	Reverse	AGCTTCTTGCGGGGAATGCCT	NM_005428
PI3K	Forward	TCAGCAGCTTCAGGCATCAATG	NM_001594
	Reverse	CGCTCTACCAGAACAGTGACAC	NM_001594
JUN	Forward	GGACGCTTACCTACAGAGAGT	NM_051056
	Reverse	AACCACGATGCCACATGATTG	NM_051056
CASP3	Forward	ACTGGATGGAGAGTCTCTGGTG	NM_010633
	Reverse	GGTACTGTTGGCATGGCATCTC	NM_010633
MAPK	Forward	GGAGAAGGTGACGAGCAGAG	NM_002346
	Reverse	GCAGCCGCATAGTGGAGTAG	NM_002346
ERBB2	Forward	AATGTCGCCCATCCAAAGC	NM_014646
	Reverse	TTCCCTTCCCATCGTACCG	NM_014646
PPARα	Forward	GCAGCATCCACGACCGCAG	NM_026526
	Reverse	TGTCTGTGAGGCCGCCATC	NM_026526

Histopathological analysis of renal tissue

Histological examination of renal tissues stained with HE demonstrated marked pathological changes in DN model rats, including glomerular hypertrophy, mesangial matrix expansion, tubular epithelial vacuolization, and interstitial fibrosis, characteristic of advanced DN-related renal damage. High-dose AD and Irb treatments significantly ameliorated these pathological changes, as evidenced by reductions in glomerular hypertrophy, mesangial proliferation, and fibrosis. These improvements suggest that AD mitigates structural renal damage associated with DN progression (Supplementary Fig. 2B).

Confocal microscopy analysis of core target expression

Confocal microscopy revealed significant alterations in the expression and localization of STAT3, AKT1, and MAPK under high-glucose conditions in diabetic nephropathy (DN) cells. High glucose exposure resulted in reduced STAT3 expression and upregulated AKT1 and MAPK levels, indicating dysregulation of the STAT3/PI3K/Akt signaling axis. Treatment with andrographolide (AD) restored STAT3 expression and downregulated AKT1 and MAPK in a dose-dependent manner. Notably, high-dose AD (80 µM) exhibited the most pronounced effect, suggesting that STAT3 plays a regulatory role in the suppression of AKT1 and MAPK through AD’s modulation of the signaling axis (Supplementary Fig. 3A, 3D).

Co-immunoprecipitation analysis

Co-immunoprecipitation (Co-IP) experiments confirmed the direct interactions between STAT3, AKT1, and MAPK, supporting the hypothesis that these proteins are co-regulated within the STAT3/PI3K/Akt pathway. Immunoblotting results demonstrated that AD treatment reduced the binding affinity of STAT3 with AKT1 and MAPK, further highlighting AD’s role in modulating protein-protein interactions within this signaling cascade. GAPDH was used as a loading control to ensure normalization (Supplementary Fig. 3B, 3E). These findings suggest that AD disrupts pathological protein interactions to restore cellular homeostasis in DN.

Effects of andrographolide on STAT3/PI3K/Akt signaling in AGEs-induced MPC-5 cells

Western blot and quantitative PCR analyses revealed dysregulation of key targets in the STAT3/PI3K/Akt signaling pathway in MPC-5 cells exposed to advanced glycation end-products (AGEs), mimicking diabetic nephropathy (DN) conditions. Specifically, AGEs exposure led to significant reductions in STAT3, PI3K, CASP3, and ERBB2 expression, while AKT1, JUN, MAPK1, and PPARα levels were markedly upregulated. High-dose andrographolide (AD, 80 µM) effectively reversed these changes, restoring STAT3, PI3K, CASP3, and ERBB2 levels while downregulating AKT1, JUN, MAPK1, and PPARα expression. These results emphasize AD’s potential to modulate DN pathogenesis by rebalancing the STAT3/PI3K/Akt pathway (Supplementary Fig. 4).

DISCUSSION

Diabetic nephropathy (DN) is a predominant microvascular complication in diabetes mellitus, recognized as a major contributor to end-stage renal disease (ESRD) globally (Qiu et al., 2023; Zou et al., 2023). With diabetes incidence on the rise, particularly in low- and middle-income countries, there is a parallel increase in DN cases that imposes a significant burden on healthcare systems worldwide (Attique et al., 2021). This trajectory is driven by complex hemodynamic, metabolic, and molecular disturbances, with hyperglycemia serving as a critical instigator of the pathological events leading to renal damage (Sun et al., 2020). Hyperglycemia induces both oxidative stress and an inflammatory response, exacerbating these disturbances and further accelerating the fibrosis that characterizes DN’s late stages (Zizzi et al., 2024).

The molecular underpinnings of DN implicate several central signaling pathways that converge to drive renal damage. These pathways include nuclear factor-kappa B (NF-κB), mitogen-activated protein kinase (MAPK), and transforming growth factor-beta (TGF-β)/Smad signaling, each of which fosters a cellular environment conducive to apoptosis, extracellular matrix (ECM) accumulation, and glomerulosclerosis (Song et al., 2020; Li et al., 2021, 2022). Existing therapeutic strategies, including renin-angiotensin-aldosterone system (RAAS) inhibitors and sodium-glucose cotransporter-2 (SGLT2) inhibitors, effectively modulate hemodynamic changes and slow proteinuria progression, yet these treatments fall short in directly addressing the core molecular mechanisms of DN—namely, oxidative stress, inflammation, and fibrosis (Huang et al., 2024b; Wang et al., 2024c). Consequently, advancing therapeutic development toward agents that can counteract these processes remains a focal point in nephrology research.

Andrographolide (AD), a diterpenoid lactone derived from Andrographis paniculata, has garnered considerable interest due to its demonstrated anti-inflammatory, antioxidant, and immunomodulatory properties, positioning it as a promising candidate for chronic disease management (Jain and Sudandiradoss, 2023; Low et al., 2024). AD’s efficacy in attenuating both oxidative stress and inflammation, two pivotal elements in DN’s pathophysiology, is supported by a substantial body of preclinical evidence (Van Chien et al., 2023). The current investigation expands upon this foundational research by employing network pharmacology, molecular docking, and both in vitro and in vivo experimental models to elucidate AD’s therapeutic mechanism in DN (Liu et al., 2022). The emphasis is placed on AD’s interaction with the STAT3/PI3K/Akt signaling axis, a critical regulatory pathway governing inflammation, oxidative stress, and cellular survival in the context of DN.

Detailed findings underscore AD’s significant regulatory effects across various pathological processes central to DN, including inflammation, oxidative stress, and apoptosis (Qu et al., 2022). In vivo analyses demonstrated that AD treatment in DN model rats notably reduced serum creatinine (Scr) and blood urea nitrogen (BUN) levels, markers of renal impairment, as well as decreased 24-h urinary protein excretion—an essential clinical marker of DN severity (Adiguna et al., 2023). This reduction in proteinuria, indicative of AD’s capacity to restore glomerular barrier function, aligns with histopathological observations showing that AD ameliorated glomerular hypertrophy, reduced mesangial matrix expansion, and attenuated tubulointerstitial fibrosis (Liu et al., 2022). These renoprotective effects, attributable to AD’s antioxidant and anti-inflammatory activities, validate findings from previous research into the therapeutic potential of natural compounds in DN (Shu et al., 2024).

The STAT3/PI3K/Akt pathway emerges as a vital molecular axis in DN pathophysiology, where hyperglycemia triggers this pathway via several mediators, including advanced glycation end-products (AGEs) and the receptor for AGEs (RAGE) (Ding et al., 2017). The subsequent cascade promotes inflammatory cytokine production, ECM accumulation, and glomerular hypertrophy, processes that are central to DN progression (Tran et al., 2023). Experimental evidence from this study substantiates that AD modulates this pathway, enhancing STAT3 activation while concurrently inhibiting PI3K/Akt signaling in DN model rats (Ding et al., 2017). AD’s promotion of STAT3 phosphorylation at anti-inflammatory sites, alongside the attenuation of PI3K/Akt, suggests a dual role in balancing inflammatory responses, underscoring AD’s capacity to recalibrate a key pathway implicated in DN (Wang et al., 2024b). These findings provide valuable insights into AD’s regulatory mechanism within the intricate molecular landscape of DN, establishing it as a multi-target agent that counteracts the pathophysiological drivers of DN at multiple levels. Previous studies suggest that the STAT3 and PI3K/Akt pathways play dual roles in the pathogenesis and treatment of DN. For example, STAT3 activation in chronic inflammation is considered a central factor in DN progression, and its inhibition effectively reduces the release of inflammatory cytokines, alleviating renal damage (Liu et al., 2023b; Qiu et al., 2023). Meanwhile, the PI3K/Akt pathway, a critical survival signal, plays a key role in regulating oxidative stress and apoptosis; however, its excessive activation may exacerbate inflammation and fibrosis (Zhang et al., 2022; Huang et al., 2024a). Based on the literature and our current findings, we hypothesize that AD may regulate the activity of STAT3/PI3K/Akt through a dose-dependent mechanism, thereby exerting its anti-inflammatory and antioxidant effects.

Further support for AD’s multi-target effects is provided by molecular docking studies, which reveal strong binding affinities of AD to critical targets within the STAT3/PI3K/Akt pathway, notably STAT3 and PI3K proteins (Calabresi et al., 2022; Luo et al., 2022; Qin et al., 2024). This interaction likely constitutes a central component of AD’s mechanism, as it enables modulation across multiple signaling routes. The significance of such a multi-target approach in DN cannot be overstated, given that the disease’s progression arises from numerous overlapping pathways. AD’s ability to concurrently engage various pathways distinguishes it from conventional monotherapeutic agents and allows for a more comprehensive impact on DN progression.

Moreover, AD’s anti-inflammatory efficacy within DN is underscored by its capacity to disrupt the hyperglycemia-induced inflammatory milieu that sustains renal injury. Hyperglycemia drives NF-κB and JNK pathway activation through AGE-RAGE interactions, leading to cytokine release and exacerbating glomerular damage, mesangial proliferation, and interstitial fibrosis. Findings reveal that AD robustly suppresses NF-κB signaling, reducing pro-inflammatory cytokine levels in serum and renal tissue (Ju et al., 2023). Furthermore, in vitro studies indicate that AD diminishes cytokine secretion in podocytes under high glucose conditions, implicating direct modulation of podocyte function (International Journal of Biological Sciences, 2021). This functional restoration at the cellular level is crucial for maintaining the integrity of the glomerular filtration barrier, suggesting AD’s potential to achieve the therapeutic milestone of proteinuria reduction in DN.

Oxidative stress, largely induced by hyperglycemia-associated mitochondrial dysfunction and NADPH oxidase activation, acts synergistically with inflammation to propagate renal fibrosis (Ketterman et al., 2020). Findings demonstrate that AD significantly mitigates oxidative stress in DN by lowering ROS levels and enhancing antioxidant enzyme activity, both in serum and kidney tissues (Yin et al., 2022). These outcomes resonate with previous studies demonstrating the antioxidative potential of natural compounds in DN. However, AD’s distinctive capability to simultaneously counteract oxidative stress and inflammation through the STAT3/PI3K/Akt pathway reinforces its value as a more comprehensive therapeutic candidate than current DN therapies, particularly in addressing the underlying molecular mechanisms of DN.

Histopathological evaluations offer additional confirmation of AD’s therapeutic efficacy, revealing marked reductions in DN-associated structural damage. AD-treated rats exhibited diminished glomerular hypertrophy, reduced mesangial expansion, and less severe tubulointerstitial fibrosis relative to untreated DN models. These structural improvements underscore AD’s role not only in early-stage DN prevention but also in potentially reversing established renal damage. Clinically, the observed reduction in proteinuria further corroborates AD’s ability to reinforce glomerular filtration barrier integrity, which is likely mediated by its direct effects on podocyte function. Given the critical correlation between proteinuria reduction and improved DN prognosis, AD’s impact on this marker enhances its potential for translation to clinical applications.

From a therapeutic development perspective, AD’s multi-target profile presents unique advantages over conventional DN therapies, which often inadequately address DN’s intricate pathophysiology. Monotherapies such as ACE inhibitors, although effective in reducing DN progression, fail to engage with the underlying molecular disturbances that exacerbate the disease. AD’s ability to modulate multiple pathways, including STAT3/PI3K/Akt, NF-κB, and MAPK, provides a broader protective effect, suggesting potential value as an adjunct therapy. AD’s compatibility with existing DN treatments, such as RAAS inhibitors, positions it as an enhancer of therapeutic efficacy and a possible mitigator of treatment resistance—a common issue in monotherapy approaches. This study provides preliminary evidence that AD improves diabetic nephropathy (DN) through multi-target modulation of the STAT3/PI3K/Akt signaling pathway. Compared to irbesartan (Irb), a commonly used RAAS inhibitor, AD exhibits distinctive mechanistic advantages. From the perspective of multi-target regulation, Irb primarily acts by blocking the AT1 receptor within the RAAS, thereby suppressing angiotensin II-mediated inflammation, oxidative stress, and tubulointerstitial fibrosis (Brenner et al., 2001; Zhou et al., 2024). In contrast, AD regulates multiple pathological processes simultaneously by modulating the STAT3/PI3K/Akt signaling pathway and other key pathways, such as NF-κB and Nrf2 (Qu et al., 2022). This multi-target mechanism may offer broader therapeutic potential for early intervention in DN pathology. In terms of anti-inflammatory and anti-fibrotic effects, Irb achieves fibrosis suppression by reducing glomerular pressure and limiting inflammatory cell infiltration. AD, however, not only suppresses inflammation but also directly modulates STAT3 and PI3K/Akt signaling, inhibiting the expression of pro-fibrotic factors such as TGF-β and Collagen I at the molecular level (Zhang et al., 2022; Songvut et al., 2024). These findings suggest that AD may exhibit a more comprehensive therapeutic profile in mitigating both inflammation and fibrosis.

While these findings underscore AD’s promise, several limitations merit consideration. Although AD demonstrated significant effects in experimental DN models, clinical studies are required to confirm these results in human populations. Detailed pharmacokinetic and pharmacodynamic profiles of AD, particularly in diabetic patients with coexisting comorbidities, are essential for advancing AD to clinical use. Additionally, while the STAT3/PI3K/Akt pathway was a primary focus in elucidating AD’s mechanism, pathways such as Nrf2 and TGF-β/Smad likely also contribute to its therapeutic actions. Further exploration of these pathways will provide a more integrated understanding of AD’s multifaceted role in DN.

In summary, this investigation elucidates AD’s potential as a multi-target therapeutic agent with a broad capacity to modulate inflammation, oxidative stress, and apoptosis, central contributors to DN progression. By targeting key pathways, AD demonstrates a capacity to complement existing DN therapies and potentially deliver more comprehensive protection against DN. Moving forward, research efforts should prioritize clinical validation and optimal dosing strategies for AD, with a particular emphasis on exploring potential synergistic effects in combination therapies. Additionally, examining AD’s applicability in other diabetes-related complications, such as retinopathy and neuropathy, could further support its role as a broad-spectrum agent in managing diabetic disorders.

In summary, this study elucidates andrographolide’s (AD) potential therapeutic effects in diabetic nephropathy (DN), demonstrating that AD alleviates oxidative stress, inflammation, and apoptosis by modulating the STAT3/PI3K/Akt signaling pathway, thereby improving renal function and reducing pathological damage. As a natural compound with notable safety and multi-target capabilities, AD shows significant promise as a future treatment for DN. Continued research and clinical trials will be essential to confirm AD’s efficacy, potentially offering patients a novel, effective, and safe therapeutic option for managing DN.