Skip to main content
. Author manuscript; available in PMC: 2025 Oct 3.
Published in final edited form as: Structure. 2024 Aug 8;32(10):1667–1676.e5. doi: 10.1016/j.str.2024.07.011

Key Resources Table

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
anti-MIB1 (N-terminal) Abcam Cat# ab124929, RRID:AB_11127834
anti-GAPDH Cell Signaling Technology Cat# 2118, RRID:AB_561053
anti-Ub Santa Cruz Biotechnology Cat# sc-8017, RRID:AB_2762364
anti-Flag Millipore Sigma Cat# F1804-50UG
IRDye 800CW Donkey anti-Rabbit LI-COR Biosciences Cat# 926-32213, RRID:AB_621848
IRDye 680RD Goat anti-Mouse LI-COR Biosciences Cat#926-68070, RRID:AB_10956588
Mouse anti-Wg 4D4 antibody Developmental studies Hybridoma Bank. Antibody Registry ID: AB_528512, RRID: N/A
Bacterial and virus strains
BL21(DE3) New England Biolabs (NEB) Cat# C2527H
Stellar competent cells Takara Bio Cat# 636766
Chemicals, peptides, and recombinant proteins
FBS GeminiBio Cat# 100-106
Penicillin and streptomycin ThermoFisher Scientific Cat# 15140163
Trypsin/0.53 mM EDTA in HBSS Corning Cat# 25-051-CI
DMEM Corning Cat# 10-017-CV
DPBS Corning Cat# 21-031-CV
NaCl VWR Cat# 0241-10KG
Glycerol americanbio Cat# AB00751-04000
HEPES Sigma-Aldrich Cat# H4034-1KG
Trizma base Sigma-Aldrich Cat# T1503-5KG
Glycine Sigma-Aldrich Cat# G7126-5KG
β−Mercaptoethanol Sigma-Aldrich Cat# M6250-250ML
SDS Sigma Cat# 75746-1KG
Methanol VWR Cat# BDH2018-1GLP
Tween-20 Sigma Cat# P7949-500ML
DMSO Sigma-Aldrich Cat# D2650
Polyplus-transfection FectoPRO® VWR Cat#10118-842
Valproic acid sodium salt Sigma-Aldrich P4543-100G
D-(+)-Glucose solution Sigma-Aldrich G8769-100ML
Tacsimate - 100% solution pH 6.0 Hampton Research HR2-827
PEG3350 50% Hampton Research HR2-527
Sodium acetate trihydrate pH 4.6 Buffer Hampton Research HR2-731
2.0 M Ammonium tartrate dibasic Hampton Research HR2-679
Expi293 expression medium ThermoFisher Cat # A1435103
HisPur Ni-NTA resin ThermoFisher Cat # 88222
Pierce Glutathione Agarose Thermo Scientific Cat # PI16101
3C protease recombinant protein Produced in-house N/A
ULP1 protease Produced in-house N/A
Anti-Flag resin Produced in-house N/A
E1 enzyme (Ube1) Produced in-house N/A
UbcH5B protein Produced in-house N/A
Ubiquitin protein Produced in-house N/A
Critical commercial assays
QIAprep Spin Miniprep Kit Qiagen Cat# 27106
PureLink HiPure Plasmid Filter Maxiprep Kit Invitrogen Cat# K210016
Dual-Luciferase Reporter Assay System Promega Cat# E1910
Lipofectamine 2000 ThermoFisher Scientific Cat# 11668019
Deposited data
UbcH5B-ccRING3 structure coordinates This paper PDB: 8V0D
ANK repeats structure coordinates This paper PDB: 8V0E
Experimental models: cell lines
Human: U2OS cells ATCC Cat# HTB-96, RRID: CVCL_0042
Human: U2OS Mib1 KO cells This paper N/A
Human: Expi293F cells ThermoFisher Cat # A14527
Drosophila: mib1EY09870 Lai et al.37 N/A
Oligonucleotides
sgRNA (MIB1ko): 5’-CACCGTGCCAACTACCGCTGCTCCG-3’ This paper N/A
sgRNA (MIB1ko): 5’-AAACCGGAGCAGCGGTAGTTGGCAC-3’ This paper N/A
NotI-V5-4xG-hMIB1-for (Fly, MIB1 and mini-MIB1): 5’-GATCTgcggccATGATCCCTAACCCTCTCCTCGGTCTCGATggcggcggcggcagtaactcccggaataacc-3’ This paper N/A
NotI--Myc-4xG-hMIB1-for (Fly, MIB1 and mini-MIB1): 5’-GCgcggccGCGGAGTGGTAAAATGgaacaaaaacttattagcgaagaagatcttggcgggggcgggagtaactcccggaataaccg-3’ This paper N/A
hMIB1-XhoI-rev (Fly, MIB1 and minni-MIB1) ccttcacaaagatcctctagaggtaccctcgagctaatacaaaagaatccttcg This paper N/A
SDM hMIB1 I974E for: (Fly, I974E point mutant in mini-MIB1 gaagaatatgGAGTTCCTTTGTGGTCACGGAACC This paper N/A
SDM hMIB1-I974E rev: (Fly, I974E point mutant in mini-MIB1) AGACGATCTAGACACACagg This paper N/A
Recombinant DNA
pcDNA3.1/Hygro(+) pcDNA3.1/Hygro(+) Cat # V87020
mMib1-Flag Addgene Cat #37116
Software and algorithms
Phenix Adams, P. D. et al.44 https://sbgrid.org/software/
Coot Emsley, P. & Cowtan, K.43 https://sbgrid.org/software/
HKL2000 Otwinowski, Z. & Minor, W.45 https://sbgrid.org/software/
PDB validation server World Wide Protein Data Bank https://www.wwpdb.org/
GraphPad Prism GraphPad RRID:SCR_002798