Key Resources Table
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| anti-MIB1 (N-terminal) | Abcam | Cat# ab124929, RRID:AB_11127834 |
| anti-GAPDH | Cell Signaling Technology | Cat# 2118, RRID:AB_561053 |
| anti-Ub | Santa Cruz Biotechnology | Cat# sc-8017, RRID:AB_2762364 |
| anti-Flag | Millipore Sigma | Cat# F1804-50UG |
| IRDye 800CW Donkey anti-Rabbit | LI-COR Biosciences | Cat# 926-32213, RRID:AB_621848 |
| IRDye 680RD Goat anti-Mouse | LI-COR Biosciences | Cat#926-68070, RRID:AB_10956588 |
| Mouse anti-Wg 4D4 antibody | Developmental studies Hybridoma Bank. | Antibody Registry ID: AB_528512, RRID: N/A |
| Bacterial and virus strains | ||
| BL21(DE3) | New England Biolabs (NEB) | Cat# C2527H |
| Stellar competent cells | Takara Bio | Cat# 636766 |
| Chemicals, peptides, and recombinant proteins | ||
| FBS | GeminiBio | Cat# 100-106 |
| Penicillin and streptomycin | ThermoFisher Scientific | Cat# 15140163 |
| Trypsin/0.53 mM EDTA in HBSS | Corning | Cat# 25-051-CI |
| DMEM | Corning | Cat# 10-017-CV |
| DPBS | Corning | Cat# 21-031-CV |
| NaCl | VWR | Cat# 0241-10KG |
| Glycerol | americanbio | Cat# AB00751-04000 |
| HEPES | Sigma-Aldrich | Cat# H4034-1KG |
| Trizma base | Sigma-Aldrich | Cat# T1503-5KG |
| Glycine | Sigma-Aldrich | Cat# G7126-5KG |
| β−Mercaptoethanol | Sigma-Aldrich | Cat# M6250-250ML |
| SDS | Sigma | Cat# 75746-1KG |
| Methanol | VWR | Cat# BDH2018-1GLP |
| Tween-20 | Sigma | Cat# P7949-500ML |
| DMSO | Sigma-Aldrich | Cat# D2650 |
| Polyplus-transfection FectoPRO® | VWR | Cat#10118-842 |
| Valproic acid sodium salt | Sigma-Aldrich | P4543-100G |
| D-(+)-Glucose solution | Sigma-Aldrich | G8769-100ML |
| Tacsimate - 100% solution pH 6.0 | Hampton Research | HR2-827 |
| PEG3350 50% | Hampton Research | HR2-527 |
| Sodium acetate trihydrate pH 4.6 Buffer | Hampton Research | HR2-731 |
| 2.0 M Ammonium tartrate dibasic | Hampton Research | HR2-679 |
| Expi293 expression medium | ThermoFisher | Cat # A1435103 |
| HisPur Ni-NTA resin | ThermoFisher | Cat # 88222 |
| Pierce™ Glutathione Agarose | Thermo Scientific | Cat # PI16101 |
| 3C protease recombinant protein | Produced in-house | N/A |
| ULP1 protease | Produced in-house | N/A |
| Anti-Flag resin | Produced in-house | N/A |
| E1 enzyme (Ube1) | Produced in-house | N/A |
| UbcH5B protein | Produced in-house | N/A |
| Ubiquitin protein | Produced in-house | N/A |
| Critical commercial assays | ||
| QIAprep Spin Miniprep Kit | Qiagen | Cat# 27106 |
| PureLink™ HiPure Plasmid Filter Maxiprep Kit | Invitrogen | Cat# K210016 |
| Dual-Luciferase Reporter Assay System | Promega | Cat# E1910 |
| Lipofectamine™ 2000 | ThermoFisher Scientific | Cat# 11668019 |
| Deposited data | ||
| UbcH5B-ccRING3 structure coordinates | This paper | PDB: 8V0D |
| ANK repeats structure coordinates | This paper | PDB: 8V0E |
| Experimental models: cell lines | ||
| Human: U2OS cells | ATCC | Cat# HTB-96, RRID: CVCL_0042 |
| Human: U2OS Mib1 KO cells | This paper | N/A |
| Human: Expi293F cells | ThermoFisher | Cat # A14527 |
| Drosophila: mib1EY09870 | Lai et al.37 | N/A |
| Oligonucleotides | ||
| sgRNA (MIB1ko): 5’-CACCGTGCCAACTACCGCTGCTCCG-3’ | This paper | N/A |
| sgRNA (MIB1ko): 5’-AAACCGGAGCAGCGGTAGTTGGCAC-3’ | This paper | N/A |
| NotI-V5-4xG-hMIB1-for (Fly, MIB1 and mini-MIB1): 5’-GATCTgcggccATGATCCCTAACCCTCTCCTCGGTCTCGATggcggcggcggcagtaactcccggaataacc-3’ | This paper | N/A |
| NotI--Myc-4xG-hMIB1-for (Fly, MIB1 and mini-MIB1): 5’-GCgcggccGCGGAGTGGTAAAATGgaacaaaaacttattagcgaagaagatcttggcgggggcgggagtaactcccggaataaccg-3’ | This paper | N/A |
| hMIB1-XhoI-rev (Fly, MIB1 and minni-MIB1) ccttcacaaagatcctctagaggtaccctcgagctaatacaaaagaatccttcg | This paper | N/A |
| SDM hMIB1 I974E for: (Fly, I974E point mutant in mini-MIB1 gaagaatatgGAGTTCCTTTGTGGTCACGGAACC | This paper | N/A |
| SDM hMIB1-I974E rev: (Fly, I974E point mutant in mini-MIB1) AGACGATCTAGACACACagg | This paper | N/A |
| Recombinant DNA | ||
| pcDNA3.1/Hygro(+) | pcDNA3.1/Hygro(+) | Cat # V87020 |
| mMib1-Flag | Addgene | Cat #37116 |
| Software and algorithms | ||
| Phenix | Adams, P. D. et al.44 | https://sbgrid.org/software/ |
| Coot | Emsley, P. & Cowtan, K.43 | https://sbgrid.org/software/ |
| HKL2000 | Otwinowski, Z. & Minor, W.45 | https://sbgrid.org/software/ |
| PDB validation server | World Wide Protein Data Bank | https://www.wwpdb.org/ |
| GraphPad Prism | GraphPad | RRID:SCR_002798 |