Skip to main content
BMC Complementary Medicine and Therapies logoLink to BMC Complementary Medicine and Therapies
. 2025 May 27;25:190. doi: 10.1186/s12906-025-04928-5

Integrated network pharmacology reveals the mechanism of action of Xianlinggubao prescription for inflammation in osteoarthritis

Jingyi Hou 1, Yubo Li 2, Yu Zhang 2, Ning Yang 2, Bin Chen 2, Guiyun Ma 2,, Naiqiang Zhu 2,3,
PMCID: PMC12108044  PMID: 40426157

Abstract

Background

Osteoarthritis (OA), a leading cause of disability worldwide, is characterized by complex interactions between cartilage degradation and synovial inflammation. While NSAIDs are the primary treatment, their prolonged use exacerbates gastrointestinal risks and does not alter disease progression. Xianlinggubao (XLGB), an approved Chinese herbal remedy for osteoporosis, has demonstrated promising anti-osteoarthritic effects in preliminary studies. However, its multi-component mechanisms targeting OA-related inflammation require further clarification. This study integrates network pharmacology with experimental validation to investigate XLGB's anti-inflammatory mechanisms in OA.

Methods

Bioactive compounds of XLGB and their respective targets were sourced from the TCMSP, ETCM, SymMap, and ChEMBL databases. Targets linked to OA-related inflammation were identified through differential expression analysis and by querying OMIM, GeneCards, and PubMed Gene databases. Network pharmacology and bioinformatics approaches were employed to construct compound-target and protein–protein interaction (PPI) networks, enabling the identification of pivotal therapeutic targets. Functional enrichment of these targets was performed using the ClusterProfiler package in R. The binding affinity of compounds to anti-inflammatory OA targets was assessed through molecular docking, dynamics simulations, RT-PCR, and immunofluorescence assays.

Results

Fifty-five bioactive compounds corresponding to 475 XLGB targets and 125 genes involved in OA-related inflammation were identified. PPI network analysis revealed that XLGB may alleviate OA inflammation by modulating key genes, including COX-2, IL-1β, TNF, IL-6, and MMP-9. Molecular simulations indicated strong binding affinities between bioactive compounds in XLGB and these critical targets. Functional enrichment analysis suggested that XLGB's anti-inflammatory action in OA may involve regulation of pathways such as IL-17, TNF, and NF-κB. In vitro experiments further confirmed that XLGB mitigates OA inflammation by modulating these genes, proteins, and signaling pathways.

Conclusions

Through network pharmacology, this study elucidated the mechanisms of XLGB in OA inflammation, highlighting its modulation of IL-6, IL-1β, TNF-α, PTGS2, MMP-9, and the NF-κB pathway. These findings provide strong support for the clinical application of XLGB in managing OA-related inflammation.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12906-025-04928-5.

Keywords: Bioinformatics analysis, Hub gene, Network pharmacology, NF-κB, Osteoarthritis, Xianlinggubao prescription

Introduction

Osteoarthritis (OA) is a prevalent age-related degenerative joint disorder, characterized by progressive articular cartilage degradation, accompanied by subchondral bone sclerosis and pathological remodeling [1, 2]. However, the precise etiological mechanisms driving OA pathogenesis remain incompletely understood. Current clinical management predominantly involves pharmacological interventions, such as nonsteroidal anti-inflammatory drugs (NSAIDs) and opioid analgesics [3, 4], alongside surgical procedures like osteotomy, arthroplasty, and arthrodesis [5, 6]. These treatments, however, are frequently associated with adverse effects, including surgical complications and cardiovascular risks [4, 7, 8]. Given that OA is linked to a persistent inflammatory response within joint tissues, driven by various immune cells, further understanding of the interactions between pro-inflammatory cytokines and immune cells is critical to elucidating its pathogenesis. Inflammatory cytokines and chemokines, synovial responses, immune cell infiltration, and the activation of inflammatory pathways all contribute to OA progression.

Traditional Chinese medicine (TCM) has been widely employed in clinical practice for managing OA due to its minimal side effects, substantial efficacy, and cost-effectiveness [9]. Xianlinggubao Prescription (XLGB), composed of six herbs—Yinyanghuo (Epimedium brevicornu Maxim., 70%), Zhimu (Anemarrhena asphodeloides Bunge, 5%), Danshen (Salvia miltiorrhiza Bunge, 5%), Buguzhi (Cullen corylifolium (L.) Medik., 5%), Xuduan (Dipsacus asperoides C.Y.Cheng & T.M.Ai, 10%), and Dihuang (Rehmannia glutinosa (Gaertn.) DC., 5%)—has shown effectiveness in treating conditions such as osteoporosis, aseptic osteonecrosis, OA, and bone fractures. Clinical studies suggest that XLGB enhances superoxide dismutase activity, reduces malondialdehyde and nitric oxide (NO) levels, and suppresses the expression of sensitive biomarkers such as C-reactive protein, TNF-α, and IL-6 in patients with OA [10]. However, the active components and specific anti-inflammatory targets of XLGB in OA remain unclear.

Systems pharmacology approaches, incorporating systems biology, cheminformatics, bioinformatics, multidirectional network biology, and traditional pharmacology [11], have been employed to identify bioactive compounds in TCM formulations and predict their mechanisms of action. In this study, network pharmacology, combined with bioinformatics analysis, was utilized to predict XLGB's anti-inflammatory targets in OA, with subsequent validation of these targets to provide insights for future clinical applications (Fig. 1).

Fig. 1.

Fig. 1

Schematic representation of a pharmacology-based approach to investigate the therapeutic mechanisms of Xianlinggubao (XLGB) on OA inflammation, integrating target identification, network analysis, and experimental validation

Materials & methods

Chemicals and materials

XLGB Prescription was purchased from Tongjitang Pharmacy (Guizhou, China, No. X742603), while Lipopolysaccharide (LPS, L2880) was sourced from Sigma-Aldrich (St. Louis, MO, USA). High-quality fetal bovine serum (HI-FBS, 10,099,141) and Dulbecco's Modified Eagle Medium (DMEM, 11,965,092) were obtained from GIBCO (Grand Island, NY, USA). The Griess reagent system (S0021), Cy3-labeled Goat antibody (A0516), DAPI (C1002), and CellTiter-Lumi™ Plus Detection Kit (C0065) were acquired from Beyotime (Beijing, China). TRIzol reagent (15,596,026) and real-time PCR kits (RR820 A) were purchased from Invitrogen Inc. (Carlsbad, CA, USA) and Takara Biotechnology Co., Ltd (Kusatsu, Japan), respectively. NF-κB p65 antibodies (AF0246) were obtained from Affinity (China). RAW264.7 cells were purchased from the Cell Culture Center of the Chinese Academy of Medical Sciences (Beijing, China). Methanol (1.06035.2500), acetonitrile (1.00029.2500), and formic acid (1.00264.1000), all of LC–MS grade, were sourced from Merck KGaA (Germany). All solvents used for reagent preparation were of chromatographic grade.

Collection of chemical ingredients for XLGB

All chemical components for XLGB were retrieved from the Traditional Chinese Medicine Systems Pharmacology Database (TCMSP) [12], the Encyclopedia of Traditional Chinese Medicine (ETCM) [13], and SymMap [14]. To identify bioactive ingredients, drug-likeness (DL) and oral bioavailability (OB) were employed as screening criteria [15]. Active components were selected based on an OB threshold of ≥ 30% and a DL threshold of ≥ 0.18.

Prediction of targets of bioactive compounds

Targets associated with the candidate bioactive compounds were identified using the STITCH, Similarity Ensemble Approach (SEA) [16], SymMap, and ChEMBL databases [17], with the “Homo sapiens” setting. Genetic data, including gene names, IDs, and organism details, were retrieved from UniProt (https://www.uniprot.org/) [18]. The identified targets are listed in Table S1.

Identification of OA and inflammation-related targets

OA-related targets were identified by screening differentially expressed genes (DEGs) from the GSE1919 dataset, as described by Ungethuem et al. (PMID: 20,858,714) [19]. The GSE1919 dataset, which includes 15 synovial tissue samples—five from patients with OA, five from patients with rheumatoid arthritis (RA), and five from healthy controls—was downloaded from the GEO database. Data were generated using the Affymetrix Human Genome U95 A Array and subsequently annotated to match gene probes to gene names. Differential gene expression analysis was performed using the"limma"package in R [20], with a cutoff of p < 0.05 and |log2 fold change (FC)|≥ 2. The "anti-inflammatory," "inflammatory," and "inflammation" datasets were then imported into the OMIM, GeneCards, and PubMed Gene databases to obtain inflammation-related targets. The FunRich [21] online tool was employed to identify overlapping DEGs and inflammation-related genes, yielding OA-inflammatory targets.

Network construction

To elucidate the molecular mechanism of XLGB in OA treatment, a multi-layered network was constructed: First, TCM compounds were linked to their respective targets, creating a compound-target network. Next, the STRING database was utilized to establish a protein–protein interaction (PPI) network encompassing OA inflammation-related and XLGB candidate targets. This interconnected network was visualized using Cytoscape 3.7.2 software, and topological properties were analyzed through the "Network Analysis" plug-in [22].

Hub gene analysis

The "CytoHubba" plug-in was employed to assess the topological characteristics of network nodes, identifying hub genes most likely to counteract XLGB’s inflammatory effects in OA. The DisGenet database [23], a platform detailing biological mechanisms, was used to extract gene and target (protein) data related to human diseases.

Functional enrichment analysis

Gene Ontology, Functional Annotation, and KEGG Pathway Analysis of gene clusters were conducted using the ClusterProfiler package in R for functional evaluation [24].

Molecular docking and dynamics simulation

Molecular docking was performed as previously outlined [25]. Briefly, the bioactive components and protein structures of the hub genes were retrieved from the PubChem and PDB databases, including PTGS2 (PDB ID: 5 F19), IL-1β (PDB ID: 6Y8M), TNF-α (PDB ID: 2 AZ5), IL-6 (PDB ID: 4O9H), and MMP-9 (PDB ID: 1ITV). Docking scores assessed the binding affinity between ingredients and predicted hub genes. Additionally, molecular dynamics (MD) simulations were conducted to confirm binding energy and ligand stability. Initial conformations for MD simulations were derived from docking results. Small molecules were optimized using ORCA [26] with DFT (B3LYP/def2-TZVP) [2729], followed by RESP2 electrostatic potential fitting via Multiwfn [30]. Drug parameter files were generated using the GAFF force field [31] with sobtop, while protein structures were processed with PDBFixer to repair missing atoms and optimize protonation states. MD simulations were conducted in GROMACS (version 2025.0) [32] for 100 ns per protein-drug complex. Systems were parameterized using AMBER ff14SB (protein) and GAFF (drug) [31, 33], solvated in TIP3P water with 0.15 M NaCl [34, 35], and neutralized with counterions. Following steepest descent energy minimization (10,000 steps with harmonic restraints), systems underwent NVT (0–300 K over 1.0 ps) and NPT (2 ns at 300 K, 1 atm) equilibration [36]. Production runs in the NPT ensemble employed V-rescale for temperature [37], C-rescale for pressure [38], PME for electrostatic interactions [39], and LINCS for bond constraints. Binding free energies were calculated via MM/GBSA (GB-Neck2 model) [40] using 1,000 conformations (50–100 ns trajectory, 5-frame intervals), with per-residue decomposition to quantify amino acid contributions.

Preparation of XLGB extract

XLGB powder (10 g) was extracted twice with five times the amount of pure water under reflux for 30 min. The resulting extract was concentrated using rotary evaporation and then diluted to appropriate concentrations with PBS.

UPLC/TOF–MS analysis

UPLC chromatography

Separation of the extract was performed using a Thermo Vanquish UHPLC system equipped with a Zorbax Eclipse C18 column (2.1 × 100 mm, 1.8 μm). The mobile phase consisted of 0.1% formic acid aqueous solution (solvent A) and acetonitrile (solvent B). The gradient elution procedure was as follows: 0–2 min 0–5%; 2–6 min 5–30%; 6–7 min 30%; 7–12 min 78%; 12–14 min 78%; and 14–17 min 78–95%. A 10 μL sample volume was injected for analysis at a column temperature of 30 °C and a flow rate of 0.3 mL/min.

Mass chromatography

Chemical structures were analyzed using a Q-Exactive HF mass spectrometer (Thermo Fisher Scientific) with an electrospray ionization interface. The ion source settings were as follows: swelling temperature of 325 °C, peeling temperature of 350 °C, and capillary voltage set to 3.5 kV.

Cell culture and assessment of cell viability

RAW 264.7 cells were cultured in DMEM supplemented with 10% HI-FBS and maintained at 37 °C in a 5% CO2 atmosphere. Cells (5 × 103/well) were seeded into 96-well plates (Corning, NY, USA, 3599). After 24 h of adhesion, cells were treated with XLGB extract at concentrations of 2.5, 5, 10, and 20 µg/mL, based on preliminary dose–response experiments (0–50 µg/mL). Cell viability was assessed using the CellTiter-Lumi™ Plus Assay Kit according to the manufacturer's instructions.

Measurement of NO production

NO production was measured using the Griess reagent system, as previously described [41]. Briefly, RAW 264.7 cells (1 × 104/well) were seeded into 96-well plates and treated with LPS (0.2 μg/mL). After a 24-h incubation with pre-prepared XLGB extracts, cells were centrifuged, and supernatants were collected for NO detection according to the manufacturer's guidelines.

Quantitative real-time PCR analysis

Total RNA extraction was performed using TRIzol reagent following the manufacturer's guidelines. Purity was assessed via NanoDrop 2000 (Thermo Fisher, USA), yielding A260/A280 = 1.92 ± 0.08 and A260/A230 = 2.15 ± 0.12 (n = 6). RNA concentration was quantified using the Qubit 4.0 RNA HS Assay Kit (Thermo Fisher), resulting in 382 ± 45 ng/μL. RNA integrity was confirmed with a 28S/18S rRNA band ratio > 2.0 on a 1.5% agarose gel (RIN > 8.0). Prior to PCR amplification, RNA samples underwent cDNA synthesis. Reverse transcription was performed with the PrimeScript RT Kit (RR820 A, Takara, Japan) in 20 μL reactions, each containing 1 μg RNA, 4 μL 5 × buffer, 1 μL Oligo(dT)18 primer (50 μM), and 1 μL enzyme mix. The reaction was conducted under the following conditions: initial incubation at 25 °C for 10 min for primer annealing, followed by 42 °C for 60 min for cDNA synthesis, and enzyme inactivation at 85 °C for 5 min. Gene expression was quantified using the SYBR PCR Master Mix, with primers for the target genes listed in Table 1. The thermocycling protocol was as follows: 95 °C for 3 min; 40 cycles of 95 °C for 15 s, gene-specific annealing temperature for 30 s, and 72 °C for 30 s; final extension at 72 °C for 5 min. Specificity was confirmed by melting curve analysis (60–95 °C, 0.3 °C/s). β-actin was used as an endogenous control, with triplicate technical replicates.

Table 1.

Primers used for quantitative real-time PCR

Gene Primer Sequence (5’−3’) GenBank Product length
β-actin Forward TGTTACCAACTGGGACGACA AJ312193.1 165
Reverse GGGGTGTTGAAGGTCTCAAA
PTGS2 Forward TGAGTACCGCAAACGCTTCTC KR709390.1 145
Reverse TGGACGAGGTTTTCCACCAG
TNF-α Forward TAGCCAGGAGGGAGAACAGA MH180383.1 127
Reverse TTTTCTGGAGGGAGATGTGG
IL-6 Forward CTGGAGCCCACCAAGAACGA AB028635.1 200
Reverse GCCTCCGACTTGTGAAGTGGT
MMP-9 Forward CAAAGACCTGAAAACCTCCAA KP974687.1 59
Reverse GGTACAAGTATGCCTCTGCCA
IL-1β Forward ATGCCACCTTTTGACAGTGATG KY038171.1 141
Reverse GTTGATGTGCTGCTGCGAGATT

Immunofluorescence

Immunofluorescence assays were performed as previously described [41]. Briefly, cells were stimulated with LPS and treated with 20 µg/mL XLGB extract. Cells were fixed with 4.0% formaldehyde, permeabilized with 0.1% Triton X-100, and incubated overnight with an anti-p65 NF-κB antibody (1:100, 3% BSA). Following incubation with Cy3-labeled goat anti-rabbit IgG for 1 h, cells were stained with DAPI for 10 min.

Statistical analyses

Data analysis and graphing were conducted using GraphPad Prism 9 (version 9.4.0). All experiments were performed in triplicate, with data presented as the mean ± standard deviation. Group comparisons were made using one-way ANOVA and Dunnett's post-hoc test. Statistical significance was defined as P < 0.05.

Results

Screening for bioactive compounds and candidate targets in XLGB

Analyses of the TCMSP, ETCM, and SymMap databases revealed 55 distinct bioactive compounds, with 12, 8, 31, 2, 5, and 3 compounds derived from the Yinyanghuo, Zhimu, Danshen, Buguzhi, Xuduan, and Dihuang species, respectively (Table 2). Target prediction conducted using the STITCH, SEA, SymMap, and ChEMBL databases identified 475 targets associated with the bioactive compounds in XLGB. These included 273, 230, 358, 34, 157, 231, and 106 targets for Yinyanghuo, Zhimu, Danshen, Buguzhi, Xuduan, and Dihuang, respectively.

Table 2.

Summary of the bioactive compounds in the Xianlinggubao prescription (XLGB), including Yinyanghuo (YYH), Xuduan (XD), Danshen (DS), Dihuang (DH), Zhimu (ZM), and Buguzhi (BGZ)

Molecule Name OB (%) DL Degree Herb Structure
Quercetin 46.43 0.28 217

YYH

DS

graphic file with name 12906_2025_4928_Figa_HTML.gif
Icaritin 45.41 0.44 19 YYH graphic file with name 12906_2025_4928_Figb_HTML.gif
8-Isopentenyl-kaempferol 37.58 0.71 13 YYH graphic file with name 12906_2025_4928_Figc_HTML.gif
Icariin 41.58 0.61 19 YYH graphic file with name 12906_2025_4928_Figd_HTML.gif
Luteolin 36.16 0.25 133

YYH

DS

graphic file with name 12906_2025_4928_Fige_HTML.gif
Chryseriol 35.85 0.27 11 YYH graphic file with name 12906_2025_4928_Figf_HTML.gif
C-Homoerythrinan,1,6-didehydro-3,15,16-trimethoxy 39.14 0.49 19 YYH graphic file with name 12906_2025_4928_Figg_HTML.gif
Kaempferol 41.88 0.24 125

YYH

ZM

DS

graphic file with name 12906_2025_4928_Figh_HTML.gif
DFV 32.76 0.18 8 YYH graphic file with name 12906_2025_4928_Figi_HTML.gif
Linoleyl acetate 42.1 0.2 7 YYH graphic file with name 12906_2025_4928_Figj_HTML.gif
Poriferast-5-en-3beta-one 36.91 0.75 5 YYH graphic file with name 12906_2025_4928_Figk_HTML.gif
Magnograndiolide 63.71 0.19 5 YYH graphic file with name 12906_2025_4928_Figl_HTML.gif
Gentisin 64.06 0.21 39 XD graphic file with name 12906_2025_4928_Figm_HTML.gif
Beta-sitosterol/Sitosterol 36.91 0.75 105

XD

DH

graphic file with name 12906_2025_4928_Fign_HTML.gif
(E,E)−3,5-Di-O-caffeoylquinic acid 48.14 0.68 18 XD graphic file with name 12906_2025_4928_Figo_HTML.gif
Japonine 44.11 0.25 24 XD graphic file with name 12906_2025_4928_Figp_HTML.gif
Sylvestroside III 48.02 0.53 4 XD graphic file with name 12906_2025_4928_Figq_HTML.gif
Asperglaucide 58.02 0.52 3 ZM graphic file with name 12906_2025_4928_Figr_HTML.gif
Anhydroicaritin 45.41 0.44 24 ZM graphic file with name 12906_2025_4928_Figs_HTML.gif
Timosaponin B III_qt 35.26 0.87 2 ZM graphic file with name 12906_2025_4928_Figt_HTML.gif
Stigmasterol 43.83 0.76 84

ZM

DH

DS

graphic file with name 12906_2025_4928_Figu_HTML.gif
(Z)−3-(4-hydroxy-3-methoxy-phenyl)-N-[2-(4-hydroxyphenyl)ethyl]acrylamide 118.35 0.26 4 ZM graphic file with name 12906_2025_4928_Figv_HTML.gif
Diosgenin 80.88 0.81 24 ZM graphic file with name 12906_2025_4928_Figw_HTML.gif
Coumaroyltyramine 112.9 0.2 5 ZM graphic file with name 12906_2025_4928_Figx_HTML.gif
Marmesin 50.28 0.18 9 ZM graphic file with name 12906_2025_4928_Figy_HTML.gif
(2S)−7-hydroxy-2-(4-hydroxyphenyl)−8-(3-methylbut-2-enyl)chroman-4-one 36.57 0.32 8 BGZ graphic file with name 12906_2025_4928_Figz_HTML.gif
Daucosterol 20.63 0.63 26 BGZ graphic file with name 12906_2025_4928_Figaa_HTML.gif
Aucuboside 35.56 0.33 6 DH graphic file with name 12906_2025_4928_Figab_HTML.gif
1,2,5,6-tetrahydrotanshinone 38.75 0.36 14 DS graphic file with name 12906_2025_4928_Figac_HTML.gif
Poriferasterol 43.83 0.76 2 DS graphic file with name 12906_2025_4928_Figad_HTML.gif
Poriferast-5-en-3beta-ol 36.91 0.75 5 DS graphic file with name 12906_2025_4928_Figae_HTML.gif
Dehydrotanshinone II A 43.76 0.4 11 DS graphic file with name 12906_2025_4928_Figaf_HTML.gif
Baicalin 40.12 0.75 80 DS graphic file with name 12906_2025_4928_Figag_HTML.gif
Digallate 61.85 0.26 2 DS graphic file with name 12906_2025_4928_Figah_HTML.gif
2-isopropyl-8-methylphenanthrene-3,4-dione 36.16 0.25 37 DS graphic file with name 12906_2025_4928_Figai_HTML.gif
Methylenetanshinquinone 40.86 0.23 14 DS graphic file with name 12906_2025_4928_Figaj_HTML.gif
Danshenol B 43.67 0.21 11 DS graphic file with name 12906_2025_4928_Figak_HTML.gif
Danshenol A 57.95 0.56 6 DS graphic file with name 12906_2025_4928_Figal_HTML.gif
Salvilenone 30.38 0.38 6 DS graphic file with name 12906_2025_4928_Figam_HTML.gif
Cryptotanshinone 52.34 0.4 21 DS graphic file with name 12906_2025_4928_Figan_HTML.gif
Dihydrotanshinone I 45.04 0.36 10 DS graphic file with name 12906_2025_4928_Figao_HTML.gif
C09092 36.07 0.25 7 DS graphic file with name 12906_2025_4928_Figap_HTML.gif
Isocryptotanshi 54.98 0.39 18 DS graphic file with name 12906_2025_4928_Figaq_HTML.gif
Isotanshinone II 49.92 0.4 16 DS graphic file with name 12906_2025_4928_Figar_HTML.gif
Miltirone 38.76 0.25 17 DS graphic file with name 12906_2025_4928_Figas_HTML.gif
1-methyl-8,9-dihydro-7H-naphtho[5,6-g]benzofuran-6,10,11-trione 34.72 0.37 11 DS graphic file with name 12906_2025_4928_Figat_HTML.gif
2R)−3-(3,4-dihydroxyphenyl)−2-[(Z)−3-(3,4-dihydroxyphenyl)acryloyl]oxy-pRopionic acid 109.38 0.35 5 DS graphic file with name 12906_2025_4928_Figau_HTML.gif
Salvilenone I 32.43 0.23 6 DS graphic file with name 12906_2025_4928_Figav_HTML.gif
Salviolone 31.72 0.24 6 DS graphic file with name 12906_2025_4928_Figaw_HTML.gif
(6S)−6-hydroxy-1-methyl-6-methylol-8,9-dihydro-7H-naphtho[8,7-g]benzofuran-10,11-quinone 75.39 0.46 5 DS graphic file with name 12906_2025_4928_Figax_HTML.gif
Tanshindiol B 42.67 0.45 4 DS graphic file with name 12906_2025_4928_Figay_HTML.gif
Przewaquinone E 42.85 0.45 4 DS graphic file with name 12906_2025_4928_Figaz_HTML.gif
Tanshinone iia 49.89 0.4 27 DS graphic file with name 12906_2025_4928_Figba_HTML.gif
Aloe-Emodin 36.91 0.75 29 DS graphic file with name 12906_2025_4928_Figbb_HTML.gif
Rhein 83.38 0.24 17 DS graphic file with name 12906_2025_4928_Figbc_HTML.gif

Building the compound-target network

A compound-target interaction network was constructed to illustrate the relationship between the bioactive compounds in XLGB and their potential targets (Fig. 2). This network comprised 530 nodes (55 compounds and 465 compound-target interactions) and 1452 edges. Network analysis revealed that bioactive compounds interacted with multiple targets, and several compounds targeted a single molecule, highlighting the multi-target therapeutic nature of XLGB. Additionally, the biological activity of the compounds exceeded 10, suggesting that the active compounds in XLGB contribute significantly to the biological network system (Table 2). Among these, quercetin (activity level 217) emerged as the most potent compound, followed by luteolin (level 133) and kaempferol (level 125), indicating their critical role in OA treatment through XLGB.

Fig. 2.

Fig. 2

Compound-target network. Blue nodes represent predicted targets; green nodes indicate Xuduan; red nodes denote Yingyanghuo; orange nodes represent Buguzhi; pink nodes depict Danshen; gray nodes represent Dihuang; yellow nodes correspond to Zhimu

Identification of OA-inflammatory targets

Differential gene expression analysis of the GSE1919 database identified 1893 DEGs, with 973 upregulated and 900 downregulated genes (Fig. S1 A-B). Further, screening of the OMIM, GeneCards, and PubMed-Gene databases for “Homo sapiens” yielded 435 common targets, detailed in Table S2. Among these, 125 DEGs overlapped with inflammation-related genes, which were classified as OA-inflammatory genes.

PPI networks and hub genes

To elucidate the mechanisms via which XLGB modulates inflammation in OA, the interaction between XLGB targets and bioactive compounds was analyzed. The PPI network analysis identified 125 interaction nodes and 990 edges. By applying the degree principle, the top five ranked targets—PTGS2, IL-1β, TNF-α, IL-6, and MMP−9—were selected (Fig. 3). These hub genes were primarily involved in enzymatic processes and signaling pathways (Table 3).

Fig. 3.

Fig. 3

PPI network illustrating the XLGB targets involved in inflammation in OA

Table 3.

Hub genes and their topological properties

Gene Name Uniprot ID Target Target Class Degree
TNF-α P01375 Tumor necrosis factor-α Signaling 69
MMP-9 P14780 Matrix metallopeptidase 9 Enzyme 59
IL-6 P05231 Interleukin-6 None 82
IL-1β P01584 Interleukin 1 beta None 53
PTGS2 P35354 Prostaglandin-endoperoxide synthase 2 Enzyme 60

Functional enrichment analysis

As depicted in Fig. 4A, the identified targets were predominantly enriched in biological processes (BP) related to biotic stimuli, oxidative stress, external stimuli, LPS, and bacterial-origin molecules. In cellular components (CC), the targets were associated with membrane rafts, membrane regions, outer membranes, mitochondrial outer membranes, transcription factor complexes, and serine/threonine protein kinases (Fig. 4B). In the molecular function (MF) category, targets were linked to cell adhesion molecule binding, cytokine interactions, nuclear hormone receptors, and phosphorylated proteins (Fig. 4C). KEGG pathway analysis revealed that DEGs were primarily enriched in the TNF signaling pathway, PI3 K-Akt signaling pathway, IL-17 signaling pathway, NF-κB signaling pathway, chemokine signaling pathway, HIF-1 signaling pathway, Toll-like receptor signaling pathway, p53 signaling pathway, Th17 cell differentiation, and VEGF signaling pathway (Fig. 5A). These results suggest that XLGB modulates OA inflammation through multiple signaling pathways. Among these, the NF-κB pathway plays a central role in regulating the transcription of genes involved in inflammation, immune responses, and cell differentiation. As shown in Fig. 5B, key XLGB target proteins in the NF-κB pathway include IL-1β, TNF-α, IKKα, p65, IκBα, and COX-2. IL-1β, TNF-α, and COX-2 were selected as hub genes for further validation, while the expression of IKKα, p65, and IκBα was assessed by immunofluorescence to elucidate XLGB's immune-regulatory effects.

Fig. 4.

Fig. 4

GO pathway enrichment analysis. A Bubble chart of the top 20 biological processes (BP) associated with XLGB in OA; B Bubble chart of the top 20 cellular components (CC) associated with XLGB in OA; C Bubble chart of the top 20 molecular functions (MF) associated with XLGB in OA

Fig. 5.

Fig. 5

KEGG pathway enrichment analysis. A Bubble chart of the 10 key signaling pathways related to XLGB in OA; B The NF-κB signaling pathway associated with XLGB treatment in OA

Molecular docking and dynamics simulation

Molecular docking analysis revealed that all bioactive compounds in XLGB bound to key targets—IL-6, PTGS2, MMP-9, TNF-α, and IL-1β—to varying extents, indicating that XLGB modulates OA inflammation through regulation of these targets (Fig. S2). Notably, as shown in Fig. 6A, (2R)−3-(3,4-dihydroxyphenyl)−2-[(Z)−3-(3,4-dihydroxyphenyl)acryloyl]oxy-propionic acid exhibited a strong binding affinity for PTGS2 (docking score = −9.057, binding energy = −152.75 kcal/mol) (Fig. 6A-a). Anhydroicaritin demonstrated strong binding to IL-6 (docking score = −9.176, binding energy = −26.64 kcal/mol) (Fig. 6A-b), IL-1β (docking score = −7.64, binding energy = −102.67 kcal/mol) (Fig. 6A-c), and TNF-α (docking score = −10.007, binding energy = −199.61 kcal/mol) (Fig. 6A-d). (2S)−7-hydroxy-2-(4-hydroxyphenyl)−8-(3-methylbut-2-enyl)chroman-4-one was found to bind to MMP-9 (docking score = −8.454, binding energy = −81.62 kcal/mol) (Fig. 6A-e). To further validate the binding energy of these compounds with their respective targets, MD simulations were performed, and the root-mean-square deviation (RMSD), a measure of the deviation of atomic coordinates from a reference structure, was used to assess the stability of the simulation system. As shown in Fig. 6B-a, RMSD analysis of the bioactive compound-key target complexes indicated that the protein–ligand systems reached equilibrium after 50 ns, suggesting stable binding between the bioactive compounds and their target atoms. Figure 6B-b illustrates the average number of hydrogen bonds formed between key targets and bioactive compounds: 2 for PTGS2, 5 for IL-6, 4.5 for IL-1β, 6 for TNF-α, and 1 for MMP-9, confirming hydrogen bond interactions between proteins and ligands. Within these simulation systems, molecules with the most negative energy values (584, 913, 719, 497, 330) played a dominant role in system stability, attributed to strong interactions such as hydrogen bonding and hydrophobic interactions. Residues A:VAL:447 (−1.70 kcal/mol), A:PHE:785 (−5.43 kcal/mol), A:ARG:596 (−2.76 kcal/mol), A:PRO:160 (−3.58 kcal/mol), and A:ILE:49 (−2.74 kcal/mol) exhibited moderately negative energy values, indicating their auxiliary role in maintaining structural integrity and potential contributions to binding (Fig. 6B-c). Collectively, these results demonstrate that the bioactive compounds in XLGB exhibit strong binding affinities with key targets (PTGS2, IL-1β, TNF-α, IL-6, MMP-9), further validating the reliability of the predicted interactions.

Fig. 6.

Fig. 6

Molecular docking and dynamics simulation of bioactive compound-hub target interactions. A Molecular docking of bioactive compounds with hub target: (a) (2R)−3-(3,4-dihydroxyphenyl)−2-[(Z)−3-(3,4-dihydroxyphenyl)acryloyl]oxy-propionic acid-PTGS2 (docking score = −9.057); (b) Anhydroicaritin-IL-6 (docking score = −9.176); (c) Anhydroicaritin-IL-1β (docking score = −7.64); (d) Anhydroicaritin-TNF-α (docking score = −10.007); (e) (2S)−7-hydroxy-2-(4-hydroxyphenyl)−8-(3-methylbut-2-enyl)chroman-4-one-MMP-9 (docking score = −8.454); B Molecular dynamics simulation of bioactive compound-hub target interactions: (a) Root-mean-square deviation (RMSD); (b) Intramolecular H-bond plots; (c) Energy contributions of residues in the molecular dynamics simulation

Compounds present in the XLGB extract

UPLC/TOF–MS analysis was performed to identify the compounds present in XLGB extracts (Fig. 7A–B). Using retention times, primary and secondary mass spectrometry data, and screening relevant literature, 34 compounds were identified, including coniferaldehyde, atenolol acid, 3-phenylpropanoic acid, 3,5-dihydroxy-2-naphthoic acid, ikarisoside C, diphylloside B, lithospermic acid, salvianolic acid, epimedin C, maslinic acid, ikarisoside B, psoralen, anhydroicaritin 3-rhamnosyl, neobavaisoflavone, flemistrictin E, isobavachalcone, bavachinin, cryptotanshinone, tanshinone IIA, estra-1,3,5(10)-trien-3-ol, piscidic acid, mussaenosidic acid, sweroside, 3-acetyl-7-beta-D-glucopyranosyl-oxycoumarin, cycloolivil, epimedin A1, epimedin C, ovemotide, noranhydroicaritin-3-rhamnosyl-rhamnoside, timosaponin A-III, xanthohumol, corylin, isobavachin, and estradiol (Table 4). Many of these compounds, including neobavaisoflavone, cryptotanshinone, and tanshinone IIA, have been previously reported in Salvia miltiorrhiza and related medicinal herb studies [42, 43]. However, compounds such as cycloolivil and timosaponin A-III have not been widely reported in the literature, and their presence in XLGB suggests that they may contribute to its pharmacological properties. Further studies are required to fully elucidate their potential roles and confirm their significance in the therapeutic effects of XLGB.

Fig. 7.

Fig. 7

UPLC/TOF–MS analysis of XLGB extract. A Positive mode chromatograms; B Negative mode chromatograms

Table 4.

MS/MS data in (±) ESI modes and the identities of bioactive compounds in XLGB

NO Ingredient Time (min) m/z Mode Formula
1 Coniferaldehyde 4.82 178.06 Positive C10H10O3
2 Atenolol acid 4.88 267.14 Positive C14H21NO4
3 3-Phenylpropanoic acid 5.78 150.06 Positive C9H10O2
4 3,5-Dihydroxy-2-naphthoic acid 6.09 204.04 Positive C11H8O4
5 Ikarisoside C 7.05 824.27 Positive/Negative C38H48O20
6 Diphylloside B 7.21 808.27 Positive C38H48O19
7 Lithospermic acid 7.74 538.11 Positive C27H22O12
8 Salvianolic acid 7.75 718.15 Positive C36H30O16
9 Epimedin C 8.41 822.29 Positive C39H50H19
10 Maslinic acid 9.14 472.35 Positive C30H48O4
11 Ikarisoside B 9.53 662.21 Positive/Negative C32H38O15
12 Psoralen 10.03 186.03 Positive C11H6O3
13 Anhydroicaritin 3-rhamnosyl 10.51 660.24 Positive/Negative C33H40O14
14 Neobavaisoflavone 11.25 322.11 Positive/Negative C20H18O4
15 Flemistrictin E 11.91 324.13 Positive C20H20O4
16 Isobavachalcone 12.49 324.13 Positive C20H20O4
17 Bavachinin 12.80 338.15 Positive C21H22O4
18 Cryptotanshinone 13.29 296.14 Positive C19H20O3
19 Tanshinone IIA 14.46 296.12 Positive C19H18O3
20 Estra-1,3,5(10)-trien-3-ol 14.93 256.18 Positive C18H24O
21 Piscidic acid 3.31 256.06 Negative C11H12O7
22 Mussaenosidic acid 4.82 376.14 Negative C16H24O10
23 Sweroside 5.80 358.13 Negative C16H22O9
24 3-acetyl-7-beta-D-glucopyranosyloxycoumarin 6.10 366.10 Negative C17H18O9
25 Cycloolivil 6.13 376.15 Negative C20H18O9
26 Epimedin A1 7.85 838.29 Negative C39H48O20
27 Epmedin C 8.40 822.29 Negative C39H50O19
28 Ovemotide 9.15 973.51 Negative C46H71N9O14
29 Noranhydroicaritin 3-rhamnosyl-rhamnoside 9.73 646.23 Negative C32H38O14
30 Timosaponin A-III 11.59 740.43 Negative C39H64O13
31 Xanthohumol 11.89 354.15 Negative C21H22O5
32 Corylin 11.91 320.10 Negative C20H16O4
33 Isobavachin 12.49 324.14 Negative C20H20O4
34 Estradiol 13.65 272.18 Negative C18H24O2

Effect of XLGB extracts on cell viability and NO production

To determine the optimal concentration of XLGB extract, RAW264.7 cells were treated with various concentrations (20, 10, 5, 2.5 μg/mL) of the extract for 24 h, and cell viability was assessed using the CellTiter-Lumi™ Kit. No significant differences were observed between the DEX group and XLGB-treated groups across all concentrations (p > 0.05), indicating the absence of cytotoxicity, even at the highest dose of 20 μg/mL. In contrast, LPS treatment notably reduced cell viability, demonstrating both cytotoxic and inflammatory effects in RAW264.7 cells (p < 0.05). This outcome aligns with the established pro-inflammatory role of LPS, commonly used to induce inflammation in OA cell models (Fig. 8A). Additionally, LPS stimulation resulted in a significant increase in NO production compared to the control group (p < 0.01), confirming successful induction of inflammation. In contrast, XLGB extract treatment significantly reduced LPS-induced NO production in a dose-dependent manner. At the highest concentration (20 μg/mL), XLGB significantly decreased NO production compared to the LPS group (p < 0.01). Similar reductions were observed at 10 μg/mL and 5 μg/mL (p < 0.05), with the lowest concentration (2.5 μg/mL) also leading to a significant decrease in NO production (p < 0.05), indicating XLGB's anti-inflammatory effect even at lower doses (Fig. 8B).

Fig. 8.

Fig. 8

Effects of XLGB extract on RAW264.7 cells. A Effect of XLGB extract on cell viability of RAW264.7 cells (n = 3); B Effect of XLGB extract on NO production (n = 6); C PTGS2 mRNA expression; D IL-1β mRNA expression; E IL-6 mRNA expression; F MMP-9 mRNA expression; G TNF-α mRNA expression (n = 3) (p* < 0.05, **p < 0.01)

Effect of XLGB extract on hub genes in RAW264.7 cells

To assess the role of hub genes in the anti-inflammatory effects of XLGB, mRNA expression levels were measured in RAW264.7 cells treated with LPS. Cells were exposed to varying concentrations of XLGB extract, LPS (0.2 μg/mL), and DEX (100 mM) as a positive control. As shown in Fig. 8, LPS treatment significantly upregulated the expression of hub genes, confirming the successful induction of inflammation in RAW264.7 cells. In contrast, DEX, a known anti-inflammatory agent, effectively downregulated these genes, validating its use as a positive control. XLGB extract significantly downregulated the expression of PTGS2 (Fig. 8C), IL-1β (Fig. 8D), IL-6 (Fig. 8E), MMP-9 (Fig. 8F), and TNF-α (Fig. 8G) in a dose-dependent manner (*p < 0.05, **p < 0.01) following LPS stimulation. At a concentration of 20 μg/mL, XLGB exhibited a significant downregulation of the hub genes, comparable to the effect of DEX. At lower concentrations (5 μg/mL and 2.5 μg/mL), the inhibitory effects were less pronounced but still statistically significant. Notably, even at the lowest concentration (2.5 μg/mL), XLGB significantly reduced IL-1β mRNA levels. These results indicate that while LPS upregulated hub gene expression, XLGB effectively suppressed their expression, thereby attenuating inflammation by modulating these key genes.

NF-κB nuclear translocation

Figure 9 highlights the differential expression of p65 within the NF-κB signaling pathway. To explore the mechanism through which XLGB modulates OA inflammation, the intracellular localization of p65 was examined. In untreated cells, the p65 subunit (red) was predominantly located in the cytoplasm, while in the normal group, it was found in the nucleus (blue). LPS treatment induced nuclear translocation of p65, thereby activating NF-κB transcriptional activity. This effect was counteracted by XLGB treatment (20 μg/mL), which inhibited the nuclear translocation of p65 (Fig. 9). These results suggest that the NF-κB signaling pathway regulates inflammation and tight junctions following combined LPS and XLGB treatment.

Fig. 9.

Fig. 9

Nuclear localization of the p65 subunit of NF-κB revealed by immunofluorescence

Discussion

OA is a chronic inflammatory condition characterized by progressive joint degeneration and subchondral bone remodeling. The primary goal of OA treatment is symptom management [7]. In TCM, OA is classified as a bone callus [44]. XLGB, a formulation prepared by the Miao minority group [45], is frequently prescribed for OA [46] due to its minimal side effects, diverse dosage forms, affordability, and proven efficacy. A multicenter, randomized, open-label, controlled trial demonstrated that XLGB effectively alleviates pain, improves symptoms, and enhances function in patients with OA [45]. This study aimed to elucidate the anti-inflammatory mechanism of XLGB in OA treatment by constructing an anti-inflammatory compound-OA target network, performing functional enrichment and molecular docking analyses, and validating these findings through molecular experiments.

Fifty-five bioactive components of XLGB, including flavonoids, coumarins, saponins, alkaloids, sugars, and terpenes, met the screening criteria. The compound-target network analysis identified quercetin, luteolin, and kaempferol as key bioactive compounds with significantly higher degree values, suggesting their potential as major therapeutic targets. Quercetin, a widely recognized flavonoid, is known for its potent anti-inflammatory, antioxidant, and other beneficial properties, such as lowering blood pressure and dilating coronary arteries [47]. Research indicates that quercetin has a chondroprotective role by inhibiting the inflammatory response and apoptosis of chondrocytes, modulating synovial macrophage polarization, and fostering a pro-chondrogenic environment for chondrocytes [48]. Luteolin, a natural flavonoid found in various plants, exhibits multiple pharmacological effects, including anti-inflammatory, anti-allergy, anti-tumor, antibacterial, and antiviral activities [49]. Fei et al. [50] demonstrated that luteolin attenuates IL-1β-induced inflammation by inhibiting the production of NO, PGE2, TNF-α, MMPs, and the phosphorylation of NF-κB and p65. Kaempferol (OB = 41.88%, DL = 0.24, degree = 125), a bioflavonoid commonly found in fruits and vegetables, significantly inhibits IL-1β-induced pro-inflammatory mediators through suppression of NF-κB signaling [51].

Analysis of the PPI network revealed 125 interaction nodes and 990 edges, highlighting the key targets associated with the anti-inflammatory effects of XLGB in OA. Topological property analysis identified five hub genes—PTGS2, IL-1β, TNF-α, IL-6, and MMP-9—with the highest degree values, indicating their potential significance as anti-inflammatory targets in XLGB's treatment of OA. Inflammatory cytokines such as IL-1β and TNF-α bind to receptors on cell membranes, increasing MMP expression, which triggers chondrocyte apoptosis and cartilage destruction [52]. IL-6, a key pro-inflammatory cytokine, plays a pivotal role in OA development and progression, explaining its elevated levels in patients with OA [53]. IL-6 also mediates the effects of IL-1β and TNF-α, further exacerbating OA progression [54]. PTGS2 regulates prostaglandin levels, and prostaglandin-2 increases vascular permeability, promotes inflammatory cell infiltration, and stimulates IL-6 production from chondrocytes via the NF-κB pathway [55]. Additionally, molecular docking and dynamics simulations confirmed that core bioactive ingredients, such as anhydroicaritin, exhibited strong binding affinities with key targets, such as TNF-α and IL-6 (Fig. 6), further supporting the reliability of the predictive results.

Functional enrichment analysis indicated that all targets in the PPI network were associated with IL-17, TNF, and NF-κB signaling pathways. IL-17, a potent inflammatory factor, contributes to bone metabolism and disease. It modulates osteoblast differentiation and promotes bone degradation by stimulating osteoblasts and bone stromal cells [56]. Liu et al. [57] suggested that IL-17 expression correlates with the severity of KOA pain, and blocking the IL-17 signaling pathway may alleviate OA-related pain. The expression of caspase and CXCL10 was positively correlated with OA progression. Fu et al. [58] observed significantly higher caspase-3 activity in OA groups compared to sham groups. Furman et al. [59] further demonstrated that upregulation of CXCL10 plays a critical role in chronic inflammation and tissue damage following its elevation in OA cartilage. TNF, a major mediator of inflammation, downregulates inflammatory factor expression in OA synovial fibroblasts, suggesting that inhibition of the TNF signaling pathway could represent a promising strategy for OA treatment [60]. The NF-κB pathway plays a central role in the development and persistence of OA, with previous studies indicating that NF-κB mediates PTGS2 to regulate prostaglandin E2 (PGE2) production. Activated by pro-inflammatory cytokines like IL-1β and TNF-α, NF-κB forms an inflammatory feedback loop. The TNF-α/IL-1β-NF-κB-IL-6 axis constitutes a cascade signaling network that drives cartilage degeneration and synovial inflammation in OA [61]. Ni et al. also demonstrated that fibroblast-like synoviocytes modulate OA progression by activating the NF-κB signaling pathway and promoting synovitis [62].

RT-PCR and immunofluorescence analyses confirmed that XLGB extract modulated the expression of predicted genes (PTGS2, IL-1β, TNF-α, IL-6, MMP-9) and impacted the NF-κB signaling pathway. LPS-induced activation of RAW264.7 macrophages, key contributors to the inflammatory response, stimulated the production of pro-inflammatory cytokines, including IL-6 and TNF-α. LPS is widely used to model inflammation-related diseases and to induce inflammatory conditions in cells. RAW264.7 macrophages play a central role in the inflammatory development of OA. LPS treatment elevated the expression of the identified hub genes (PTGS2, IL-1β, TNF-α, IL-6, MMP-9), while XLGB treatment reduced their expression, demonstrating that XLGB antagonized the inflammatory effects in RAW264.7 cells in a dose-dependent manner. Wu et al. reported that Xianlinggubao, a traditional remedy for OA, exerts its effects by inhibiting chondrocyte apoptosis and inflammatory responses through the JNK and PI3 K/AKT/NF-κB signaling pathways [63]. In contrast, this study combines bioinformatics analyses with experimental validation, revealing that XLGB reduces OA-related inflammation and suppresses the NF-κB pathway, corroborating previous findings from a different perspective. Our study provides significant insights supporting the clinical application of XLGB in OA treatment.

This study has several limitations. Regarding research design and methodology, the reliance on existing databases (e.g., TCMSP, ETCM) for screening active ingredients and targets may lead to the exclusion of certain XLGB constituents and novel inflammatory targets. Future research will incorporate high-resolution mass spectrometry and metabolomics to more comprehensively identify chemical entities in XLGB. While the RAW264.7 macrophage cell line served as a useful model for validating inflammatory targets, it does not fully replicate the intricate interactions present in the OA joint microenvironment. Therefore, future studies will utilize primary synovial fibroblasts derived from patients with OA or 3D organoid models to improve experimental fidelity. Additionally, the current findings, primarily based on in vitro experiments, lack in vivo validation. To address this gap, OA animal models (e.g., collagenase-induced or surgical models) will be employed in combination with micro-CT and histopathological analysis to assess XLGB's effects on cartilage degradation and bone remodeling. From a translational medicine perspective, XLGB—a multi-component traditional Chinese medicine—interacts through a complex network of constituents influencing its efficacy. Component deletion experiments or orthogonal design studies will be necessary to isolate and identify key active ingredients. Furthermore, existing clinical data do not fully account for differential efficacy across OA subtypes, highlighting the need for multi-center, stratified clinical studies.

Future research will focus on three key areas. 1. Animal Model Validation: Collagenase-induced (MIA-OA) or surgically induced (e.g., DMM) mouse OA models will be used to assess XLGB's in vivo effects on cartilage degradation, synovial inflammation, and bone remodeling. Micro-CT, histopathology (hematoxylin–eosin/Safranin O staining), and biomechanical analyses will provide quantitative assessments of joint structure and function. Gene knockout models (e.g., NF-κB p65 conditional knockout mice) and fluorescent reporter systems will be employed to explore the regulation of signaling pathways. 2. Clinical Translation: Multi-center, randomized, double-blind, placebo-controlled RCTs (following CONSORT guidelines) will involve patients with knee/hand OA to evaluate the long-term effects on pain (VAS), function (WASOC), and inflammation (hs-CRP, IL-6). Proteomic and metabolomic profiling of biosamples (serum, synovial fluid) will identify biomarkers responsive to treatment, enabling precision stratification. 3. Mechanism & Technology: Single-cell transcriptomic sequencing (scRNA-seq) will be utilized to uncover XLGB’s regulatory networks in OA joint cell subpopulations (macrophages, synovial fibroblasts, chondrocytes), revealing immunometabolic reprogramming. Nanodelivery systems (e.g., liposomal/exosomal carriers) will enhance the bioavailability of active ingredients in joints while minimizing systemic exposure. Collectively, these strategies will deepen mechanistic understanding and enhance the translational potential of XLGB in OA treatment.

Conclusions

This study, by integrating network pharmacology with experimental validation, comprehensively elucidated how XLGB suppresses OA inflammation through the synergistic modulation of PTGS2, IL-1β, TNF-α, IL-6, MMP-9, and the NF-κB pathway. This provides a theoretical foundation for the multi-component, multi-target synergistic effects of TCM compounds, paving the way for developing low-side-effect treatment strategies for OA. Future research will focus on three primary objectives: first, evaluating XLGB’s in vivo efficacy in OA using animal models; second, exploring XLGB’s impact on immune cell subsets within the joint microenvironment using single-cell sequencing technology; and third, conducting multi-center clinical trials to assess XLGB’s long-term safety and patient-stratified efficacy. These forthcoming studies will build upon the findings of the current research while providing clear guidance for future investigations.

Supplementary Information

12906_2025_4928_MOESM1_ESM.xls (42.5KB, xls)

Supplementary Material 1. Table S1: Predicted targets of bioactive compounds in XLGB.

12906_2025_4928_MOESM2_ESM.xls (1.2KB, xls)

Supplementary Material 2. Table S2: Differentially expressed genes (DEGs) between OA and normal samples.

12906_2025_4928_MOESM3_ESM.jpg (1.8MB, jpg)

Supplementary Material 3. Figure S1: Differential gene expression analysis based on the GSE1919 database. (A) Volcano plot of DEGs comparing OA and normal samples. Red and green nodes represent upregulated and downregulated genes, respectively. (B) Heatmap of DEGs comparing samples from OA and normal groups.

12906_2025_4928_MOESM4_ESM.jpg (838KB, jpg)

Supplementary Material 4. Figure S2: Heatmaps of docking scores for hub genes activated by bioactive compounds in XLGB.

Acknowledgements

We would like to thank Bullet Edits Limited for the linguistic editing and proofreading of the manuscript.

Abbreviations

ADME

Adsorption, distribution, metabolism, and excretion

AR

Androgen receptor

BP

Biological processes

CC

Cellular components

CM

Chinese Medicine

DEGs

Differentially expressed genes

DL

Drug-likeness

DMM

Dorsal Medical Meniscectomy

EGF

Epidermal growth factor

EGFR

Epidermal growth factor receptor

ETCM

Encyclopedia of Traditional Chinese Medicine

FC

Fold change

GO

Gene Ontology

ILs

Interleukins

KEGG

Kyoto Encyclopedia of Genes and Genomes

MIA-OA

Monosodium lodoacetate-induced OA

MD

Molecular dynamics

Micro-CT

Micro-Computed Tomography

OA

Osteoarthritis

OB

Oral bioavailability

PGE2

Prostaglandin E2

PPI

Protein–protein interaction

RA

Rheumatoid arthritis

RCT

Randomized Controlled Trial

RMSD

Root-mean-square deviation

scRNA-seq

Single-cell RNA sequencing

SEA

Similarity ensemble approach database

TCM

Traditional Chinese medicine

TCMSP

Traditional Chinese Medicine Systems Pharmacology Database and Analysis Platform

VAS

Visual Analogue scale

Authors’ contributions

Naiqiang Zhu and Bin Chen conceived and designed the study. Jingyi Hou performed the investigation, formal analysis and writing- original draft. Yubo Li performed the methodology, software, data curation and visualization. Ning Yang performed the experimental validation. Yu Zhang and Guiyun Ma wrote and revised the manuscript and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.

Funding

This study was supported by the Hebei Natural Science Foundation (H2022406038) and National Natural Science Foundation of China (82305055).

Data availability

All datasets presented in this study are included in the article/Supplementary Materials.

Declarations

Ethics Statement

Not applicable.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Contributor Information

Guiyun Ma, Email: maguiyun3778@163.com.

Naiqiang Zhu, Email: zhunq2010@163.com.

References

  • 1.Naselli F, Bellavia D, Costa V, De Luca A, Raimondi L, Giavaresi G, et al. Osteoarthritis in the Elderly Population: Preclinical Evidence of Nutrigenomic Activities of Flavonoids. Nutrients. 2023;16:112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Chen W, Wang Q, Tao H, Lu L, Zhou J, Wang Q, et al. Subchondral osteoclasts and osteoarthritis: new insights and potential therapeutic avenues. Acta Biochim Biophys Sin (Shanghai). 2024;56:499–512. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Woodell-May JE, Sommerfeld SD. Role of Inflammation and the Immune System in the Progression of Osteoarthritis. J Orthop Res. 2020;38:253–7. [DOI] [PubMed] [Google Scholar]
  • 4.Liao CR, Wang SN, Zhu SY, Wang YQ, Li ZZ, Liu ZY, et al. Advanced oxidation protein products increase TNF-alpha and IL-1beta expression in chondrocytes via NADPH oxidase 4 and accelerate cartilage degeneration in osteoarthritis progression. Redox Biol. 2020;28: 101306. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Zhang W, Ouyang H, Dass CR, Xu J. Current research on pharmacologic and regenerative therapies for osteoarthritis. Bone Res. 2016;4:15040. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Nelson AE. Osteoarthritis year in review 2017: clinical. Osteoarthritis Cartilage. 2018;26:319–25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Taruc-Uy RL, Lynch SA. Diagnosis and treatment of osteoarthritis. Prim Care. 2013;40(821–36):vii. [DOI] [PubMed] [Google Scholar]
  • 8.De Bari C, Roelofs AJ. Stem cell-based therapeutic strategies for cartilage defects and osteoarthritis. Curr Opin Pharmacol. 2018;40:74–80. [DOI] [PubMed] [Google Scholar]
  • 9.Song W, Ni S, Fu Y, Wang Y. Uncovering the mechanism of Maxing Ganshi Decoction on asthma from a systematic perspective: A network pharmacology study. Sci Rep. 2018;8:17362. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Wang X, He Y, Guo B, Tsang MC, Tu F, Dai Y, et al. In vivo screening for anti-osteoporotic fraction from extract of herbal formula Xianlinggubao in ovariectomized mice. PLoS ONE. 2015;10: e0118184. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Berger SI, Iyengar R. Network analyses in systems pharmacology. Bioinformatics. 2009;25:2466–72. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Ru J, Li P, Wang J, Zhou W, Li B, Huang C, et al. TCMSP: a database of systems pharmacology for drug discovery from herbal medicines. J Cheminform. 2014;6:13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Xu HY, Zhang YQ, Liu ZM, Chen T, Lv CY, Tang SH, et al. ETCM: an encyclopaedia of traditional Chinese medicine. Nucleic Acids Res. 2019;47:D976–82. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Wu Y, Zhang F, Yang K, Fang S, Bu D, Li H, et al. SymMap: an integrative database of traditional Chinese medicine enhanced by symptom mapping. Nucleic Acids Res. 2019;47:D1110–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Bocci G, Carosati E, Vayer P, Arrault A, Lozano S, Cruciani G. ADME-Space: a new tool for medicinal chemists to explore ADME properties. Sci Rep. 2017;7:6359. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Jahid MJ, Ruan J. An Ensemble Approach for Drug Side Effect Prediction. Proceedings (IEEE Int Conf Bioinformatics Biomed). 2013:440–5. https://ieeexplore.ieee.org/document/6732532. [DOI] [PMC free article] [PubMed]
  • 17.Davies M, Nowotka M, Papadatos G, Dedman N, Gaulton A, Atkinson F, et al. ChEMBL web services: streamlining access to drug discovery data and utilities. Nucleic Acids Res. 2015;43:W612–20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.UniProt Consortium T. UniProt: the universal protein knowledgebase. Nucleic Acids Res. 2018;46:2699. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Ungethuem U, Haeupl T, Witt H, Koczan D, Krenn V, Huber H, et al. Molecular signatures and new candidates to target the pathogenesis of rheumatoid arthritis. Physiol Genomics. 2010;42A:267–82. [DOI] [PubMed] [Google Scholar]
  • 20.Law CW, Alhamdoosh M, Su S, Dong X, Tian L, Smyth GK, et al. RNA-seq analysis is easy as 1–2–3 with limma, Glimma and edgeR. F1000Res. 2016;17:5. [DOI] [PMC free article] [PubMed]
  • 21.Pathan M, Keerthikumar S, Ang C-S, Gangoda L, Quek CYJ, Williamson NA, et al. FunRich: An open access standalone functional enrichment and interaction network analysis tool. Proteomics. 2015;15:2597–601. [DOI] [PubMed] [Google Scholar]
  • 22.Munir N, Cheng C, Xia C, Xu X, Nawaz MA, Iftikhar J, et al. RNA-Seq analysis reveals an essential role of tyrosine metabolism pathway in response to root-rot infection in Gerbera hybrida. PLoS ONE. 2019;14: e0223519. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Pinero J, Queralt-Rosinach N, Bravo A, Deu-Pons J, Bauer-Mehren A, Baron M, et al. DisGeNET: a discovery platform for the dynamical exploration of human diseases and their genes. Database (Oxford). 2015;2015:bav028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Yu G, Wang LG, Han Y, He QY. clusterProfiler: an R package for comparing biological themes among gene clusters. OMICS. 2012;16:284–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Zhu N, Hou J. Exploring the mechanism of action Xianlingubao Prescription in the treatment of osteoporosis by network pharmacology. Comput Biol Chem. 2020;85: 107240. [DOI] [PubMed] [Google Scholar]
  • 26.Neese F. The ORCA program system. WIREs Computational Molecular Science. 2012;2:73–8. [Google Scholar]
  • 27.Becke AD. Density-functional thermochemistry. III. The role of exact exchange. J Chemical Physics. 1993;98:5648–52. [Google Scholar]
  • 28.Lee C, Yang W, Parr RG. Development of the Colle-Salvetti correlation-energy formula into a functional of the electron density. Phys Rev B Condens Matter. 1988;37:785–9. [DOI] [PubMed] [Google Scholar]
  • 29.Weigend F, Ahlrichs R. Balanced basis sets of split valence, triple zeta valence and quadruple zeta valence quality for H to Rn: Design and assessment of accuracy. Phys Chem Chem Phys. 2005;7:3297–305. [DOI] [PubMed] [Google Scholar]
  • 30.Lu T, Chen F. Multiwfn: a multifunctional wavefunction analyzer. J Comput Chem. 2012;33:580–92. [DOI] [PubMed] [Google Scholar]
  • 31.Wang J, Wolf RM, Caldwell JW, Kollman PA, Case DA. Development and testing of a general amber force field. J Comput Chem. 2004;25:1157–74. [DOI] [PubMed] [Google Scholar]
  • 32.Van Der Spoel D, Lindahl E, Hess B, Groenhof G, Mark AE, Berendsen HJC. GROMACS: fast, flexible, and free. J Comput Chem. 2005;26:1701–18. [DOI] [PubMed] [Google Scholar]
  • 33.Maier JA, Martinez C, Kasavajhala K, Wickstrom L, Hauser KE, Simmerling C. ff14SB: Improving the Accuracy of Protein Side Chain and Backbone Parameters from ff99SB. J Chem Theory Comput. 2015;11:3696–713. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Srivastava DK, Navratna V, Tosh DK, Chinn A, Sk MF, Tajkhorshid E, et al. Structure of the human dopamine transporter and mechanisms of inhibition. Nature. 2024;632:672–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Zheng XL, Jiang S, Ren YY, Wang SX, Xie Y, Le T, et al. High-efficient selection of aptamers by magnetic cross-linking precipitation and development of aptasensor for 1-aminohydantoin detection. Lwt-Food Science and Technology. 2024;199:116128–116128. [Google Scholar]
  • 36.Holm JE, Botha EC. Leap-frog is a robust algorithm for training neural networks. Network. 1999;10:1–13. [PubMed] [Google Scholar]
  • 37.Bussi G, Donadio D, Parrinello M. Canonical sampling through velocity rescaling. J Chem Phys. 2007;126: 014101. [DOI] [PubMed] [Google Scholar]
  • 38.Bernetti M, Bussi G. Pressure control using stochastic cell rescaling. J Chem Phys. 2020;153: 114107. [DOI] [PubMed] [Google Scholar]
  • 39.Darden T, York D, Pedersen L. Particle mesh Ewald: An N ⋅log( N ) method for Ewald sums in large systems. J Chem Phys. 1993;98:10089–92. [Google Scholar]
  • 40.Valdés-Tresanco MS, Valdés-Tresanco ME, Valiente PA, Moreno E. gmx_MMPBSA: A New Tool to Perform End-State Free Energy Calculations with GROMACS. J Chem Theory Comput. 2021;17:6281–91. [DOI] [PubMed] [Google Scholar]
  • 41.Hou J, Gu Y, Zhao S, Huo M, Wang S, Zhang Y, et al. Anti-Inflammatory Effects of Aurantio-Obtusin from Seed of Cassia obtusifolia L. through Modulation of the NF-kappaB Pathway. Molecules. 2018;23. [DOI] [PMC free article] [PubMed]
  • 42.He L, Xu C, Wang Z, Duan S, Xu J, Li C, et al. Identification of naturally occurring inhibitors in Xian-Ling-Gu-Bao capsule against the glucuronidation of estrogens. Front Pharmacol. 2022;13. [DOI] [PMC free article] [PubMed]
  • 43.Tian S, Liu T, Jiang J, Zhao X, Fan Y, Zhang W, et al. Salvia miltiorrhiza ameliorates endometritis in dairy cows by relieving inflammation, energy deficiency and blood stasis. Front Pharmacol. 2024;15:1349139. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Xu BP, Yao M, Tian ZR, Zhou LY, Yang L, Li ZJ, et al. Study on efficacy and safety of Tong-luo Qu-tong plaster treatment for knee osteoarthritis: study protocol for a randomized, double-blind, parallel positive controlled, multi-center clinical trial. Trials. 2019;20:377. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Wang F, Shi L, Zhang Y, Wang K, Pei F, Zhu H, et al. A Traditional Herbal Formula Xianlinggubao for Pain Control and Function Improvement in Patients with Knee and Hand Osteoarthritis: A Multicenter, Randomized, Open-Label, Controlled Trial. Evid Based Complement Alternat Med. 2018;2018:1827528. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Chen W, Du S, Wu Q, Wu H. Chen X [Comparative study on dissolution of Xianlinggubao capsules prepared by different processes]. Zhongguo Zhong Yao Za Zhi. 2010;35:1541–6. [DOI] [PubMed] [Google Scholar]
  • 47.Marunaka Y, Marunaka R, Sun H, Yamamoto T, Kanamura N, Inui T, et al. Actions of Quercetin, a Polyphenol, on Blood Pressure. Molecules. 2017;22. [DOI] [PMC free article] [PubMed]
  • 48.Hu Y, Gui Z, Zhou Y, Xia L, Lin K, Xu Y. Quercetin alleviates rat osteoarthritis by inhibiting inflammation and apoptosis of chondrocytes, modulating synovial macrophages polarization to M2 macrophages. Free Radic Biol Med. 2019;145:146–60. [DOI] [PubMed] [Google Scholar]
  • 49.Nabavi SF, Braidy N, Gortzi O, Sobarzo-Sanchez E, Daglia M, Skalicka-Wozniak K, et al. Luteolin as an anti-inflammatory and neuroprotective agent: A brief review. Brain Res Bull. 2015;119(Pt A):1–11. [DOI] [PubMed] [Google Scholar]
  • 50.Fei J, Liang B, Jiang C, Ni H, Wang L. Luteolin inhibits IL-1beta-induced in fl ammation in rat chondrocytes and attenuates osteoarthritis progression in a rat model. Biomed Pharmacother. 2019;109:1586–92. [DOI] [PubMed] [Google Scholar]
  • 51.Zhuang Z, Ye G, Huang B. Kaempferol Alleviates the Interleukin-1beta-Induced Inflammation in Rat Osteoarthritis Chondrocytes via Suppression of NF-kappaB. Med Sci Monit. 2017;23:3925–31. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Beklen A, Ainola M, Hukkanen M, Gurgan C, Sorsa T, Konttinen YT. MMPs, IL-1, and TNF are regulated by IL-17 in periodontitis. J Dent Res. 2007;86:347–51. [DOI] [PubMed] [Google Scholar]
  • 53.Laavola M, Leppanen T, Hamalainen M, Vuolteenaho K, Moilanen T, Nieminen R, et al. IL-6 in Osteoarthritis: Effects of Pine Stilbenoids. Molecules. 2018;24. [DOI] [PMC free article] [PubMed]
  • 54.Li L, Lan J, Ye Y, Yang B, Yang X, Cai Z. CPEB1 Expression Correlates with Severity of Posttraumatic Ankle Osteoarthritis and Aggravates Catabolic Effect of IL-1beta on Chondrocytes. Inflammation. 2019;42:628–36. [DOI] [PubMed] [Google Scholar]
  • 55.Tang SC, Liao PY, Hung SJ, Ge JS, Chen SM, Lai JC, et al. Topical application of glycolic acid suppresses the UVB induced IL-6, IL-8, MCP-1 and COX-2 inflammation by modulating NF-kappaB signaling pathway in keratinocytes and mice skin. J Dermatol Sci. 2017;86:238–48. [DOI] [PubMed] [Google Scholar]
  • 56.Chen B, Deng Y, Tan Y, Qin J, Chen LB. Association between severity of knee osteoarthritis and serum and synovial fluid interleukin 17 concentrations. J Int Med Res. 2014;42:138–44. [DOI] [PubMed] [Google Scholar]
  • 57.Liu Y, Peng H, Meng Z, Wei M. Correlation of IL-17 Level in Synovia and Severity of Knee Osteoarthritis. Med Sci Monit. 2015;21:1732–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Fu D, Shang X, Ni Z, Shi G. Shikonin inhibits inflammation and chondrocyte apoptosis by regulation of the PI3K/Akt signaling pathway in a rat model of osteoarthritis. Exp Ther Med. 2016;12:2735–40. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Furman BD, Kent CL, Huebner JL, Kraus VB, McNulty AL, Guilak F, et al. CXCL10 is upregulated in synovium and cartilage following articular fracture. J Orthop Res. 2018;36:1220–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Li H, Xie S, Qi Y, Li H, Zhang R, Lian Y. TNF-alpha increases the expression of inflammatory factors in synovial fibroblasts by inhibiting the PI3K/AKT pathway in a rat model of monosodium iodoacetate-induced osteoarthritis. Exp Ther Med. 2018;16:4737–44. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Yao Q, Wu X, Tao C, Gong W, Chen M, Qu M, et al. Osteoarthritis: pathogenic signaling pathways and therapeutic targets. Signal Transduct Target Ther. 2023;8:56. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Ni S, Miao K, Zhou X, Xu N, Li C, Zhu R, et al. The involvement of follistatin-like protein 1 in osteoarthritis by elevating NF-kappaB-mediated inflammatory cytokines and enhancing fibroblast like synoviocyte proliferation. Arthritis Res Ther. 2015;17:91. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Wu X, Sun S, Wu X, Sun Z. Multitech-Based Study on Medicinal Material Basis and Action Mechanism of Herbal Formula Xian-Ling-Gu-Bao Capsule in Treatment of Osteoarthritis. Evid Based Complement Alternat Med. 2022;2022:6986372. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

12906_2025_4928_MOESM1_ESM.xls (42.5KB, xls)

Supplementary Material 1. Table S1: Predicted targets of bioactive compounds in XLGB.

12906_2025_4928_MOESM2_ESM.xls (1.2KB, xls)

Supplementary Material 2. Table S2: Differentially expressed genes (DEGs) between OA and normal samples.

12906_2025_4928_MOESM3_ESM.jpg (1.8MB, jpg)

Supplementary Material 3. Figure S1: Differential gene expression analysis based on the GSE1919 database. (A) Volcano plot of DEGs comparing OA and normal samples. Red and green nodes represent upregulated and downregulated genes, respectively. (B) Heatmap of DEGs comparing samples from OA and normal groups.

12906_2025_4928_MOESM4_ESM.jpg (838KB, jpg)

Supplementary Material 4. Figure S2: Heatmaps of docking scores for hub genes activated by bioactive compounds in XLGB.

Data Availability Statement

All datasets presented in this study are included in the article/Supplementary Materials.


Articles from BMC Complementary Medicine and Therapies are provided here courtesy of BMC

RESOURCES