Comprehensive analysis of a novel LYST mutation in a Tunisian patient with Chediak-Higashi syndrome

Abstract

Background

Chediak-Higashi Syndrome (CHS) is a rare autosomal recessive disorder characterized by oculocutaneous albinism, recurrent infections, bleeding tendencies, and progressive neurological impairment. The syndrome is caused by mutations in the LYST gene, which plays a crucial role in lysosomal trafficking.

Objective

This study aims to characterize the molecular basis of CHS in a Tunisian patient by identifying mutations in the LYST gene and analyzing their impact on the protein function, correlating these findings with the patient’s clinical presentation.

Methods

A comprehensive clinical assessment was conducted on the patient, followed by biochemical, hematological, and microbiological analyses. Additionally, LYST protein levels were quantified in the patient and their parents using an ELISA assay. Genomic DNA was extracted from the patient’s blood, and Whole Exome Sequencing (WES) was performed to identify mutations in the LYST gene. The findings were confirmed through Sanger sequencing, and bioinformatic tools were employed to predict the functional consequences of the detected mutations.

Results

The patient presented with classical symptoms of CHS, including silver hair, hypopigmented skin, recurrent infections, and neurological decline, with an unusually late onset at 18 years. ELISA results demonstrated significantly reduced LYST levels in the patient (1.8 ng/ml) compared to heterozygous parents (7.8 ng/ml and 8.1 ng/ml) and controls (9.2 ng/ml). Genetic analysis revealed a novel homozygous deletion, c.10269_10275del (p.Gly3424SerfsTer15), in the LYST gene, leading to a frameshift mutation and premature termination of the protein. Bioinformatic analysis demonstrated that this mutation leads to the deletion of five out of sven WD40 repeats in the protein’s C-terminal region, which are critical for protein-protein interactions and lysosomal trafficking.

Conclusion

The study identifies a novel LYST mutation in a Tunisian patient with CHS, expanding the spectrum of known genetic variants associated with the disease. The findings highlight the importance of genetic screening in populations with high consanguinity and underscore the need for targeted therapies to address the molecular defects in CHS.

Introduction

Chediak-Higashi Syndrome (CHS) is an extremely rare autosomal recessive disorder first described in 1943 by Dr. Beguez-Cesar [1]. Characterized by a constellation of clinical features, CHS predominantly presents with immunodeficiency, partial oculocutaneous albinism, a predisposition to bleeding, progressive neurological degeneration, and recurrent infections [2]. The clinical spectrum of CHS is broad, ranging from mild to severe, with the majority of patients succumbing to the accelerated phase of the disease, known as hemophagocytic lymphohistiocytosis (HLH), which is often triggered by viral infections. The hallmark of CHS at the cellular level is the presence of giant lysosomal granules in various cell types, including neutrophils and melanocytes, which result from defects in intracellular trafficking mechanisms [2, 3].

The genetic basis of CHS has been traced to mutations in the LYST (Lysosomal Trafficking Regulator) gene, also known as CHS1. The LYST gene, located on chromosome 1q42-43, encodes a protein involved in the regulation of lysosomal size, number, and function [4]. Mutations in this gene disrupt normal lysosomal trafficking, leading to the formation of oversized and dysfunctional lysosomes. These aberrant lysosomes impair several critical cellular processes, including immune responses, pigmentation, and neural functions. To date, over 60 different mutations in the LYST gene have been identified, with most patients exhibiting unique or compound heterozygous mutations [3, 5].

Epidemiologically, CHS is exceedingly rare, with fewer than 500 cases reported globally. The disease affects individuals across all ethnicities, though it appears more frequently in populations with high rates of consanguinity. In Tunisia, where consanguineous marriages are relatively common, CHS cases are infrequently documented. The first reported Tunisian case of CHS was in 1998, and since then, only ten additional cases have been described. However, the genetic profiles of these patients remain largely unexplored, highlighting a significant gap in the literature [6–8]. The variable clinical presentation of CHS, particularly between the classic and attenuated forms, complicates both diagnosis and management.

The pathophysiology of CHS revolves around the dysfunction of the LYST protein. Under normal conditions, the LYST protein plays a crucial role in the maintenance of lysosomal size by regulating membrane fusion and fission events. It interacts with several other proteins involved in vesicular trafficking, including Rab GTPases and SNARE complexes [9]. In CHS, mutations in the LYST gene result in the production of a truncated or non-functional protein, leading to defective lysosomal trafficking. This defect manifests in various ways, including impaired degranulation of neutrophils, abnormal melanosome distribution in melanocytes, and the formation of giant cytoplasmic granules in platelets. The cumulative effect of these cellular abnormalities is the clinical phenotype observed in CHS patients.

Clinically, CHS patients present with a combination of hypopigmentation, recurrent infections, and bleeding tendencies from an early age. The immunodeficiency in CHS is primarily due to the impaired function of neutrophils, natural killer (NK) cells, and cytotoxic T lymphocytes, which are essential components of the innate immune system. These cells exhibit defective chemotaxis, degranulation, and cytotoxicity, making CHS patients highly susceptible to bacterial, viral, and fungal infections [10]. Oculocutaneous albinism, another characteristic feature, results from abnormal melanosome trafficking, leading to hypopigmentation of the skin, hair, and eyes. The neurological manifestations of CHS, which include peripheral neuropathy, cognitive decline, and ataxia, are attributed to the accumulation of dysfunctional lysosomes in neurons, leading to progressive neurodegeneration [2, 11].

One of the most severe complications of CHS is the development of HLH, an often-fatal condition characterized by excessive immune activation and systemic inflammation. HLH in CHS is triggered by an uncontrolled immune response, typically following a viral infection. The condition is marked by fever, hepatosplenomegaly, pancytopenia, and elevated levels of ferritin and soluble CD25. Without timely intervention, HLH can lead to multi-organ failure and death. The only curative treatment for CHS is hematopoietic stem cell transplantation (HSCT), which must be performed before the onset of the accelerated phase to prevent irreversible damage [2, 9, 12].

This study aims to fill the existing knowledge gap by conducting a detailed genetic analysis of a Tunisian patient diagnosed with CHS. Using advanced molecular techniques such as Next-Generation Sequencing (NGS) and Sanger sequencing, we sought to identify the specific mutation in the LYST gene responsible for the disease. Furthermore, we employed bioinformatics tools to model the structural and functional consequences of the detected mutation on the LYST protein. By comparing our findings with known mutations in the literature, we hope to elucidate the molecular mechanisms underlying CHS and contribute to the development of more targeted therapeutic strategies.

In conclusion, Chediak-Higashi Syndrome remains a formidable challenge in clinical genetics and immunology due to its rarity and complex presentation. Early diagnosis through genetic testing is crucial for managing the disease and improving patient outcomes. This study not only enhances our understanding of the genetic basis of CHS but also underscores the importance of molecular research in the development of effective treatments for rare genetic disorders.

Materials and methods

Study design and ethical considerations

This study aimed to conduct a comprehensive molecular characterization of the Chediak-Higashi Syndrome (CHS) in a Tunisian patient, with a particular focus on identifying the specific genetic mutation responsible for the disease. The objectives were twofold: first, to identify the causative mutation in the LYST gene using advanced genetic techniques; and second, to analyze the potential impact of this mutation on the protein structure and function using bioinformatics tools. The study was conducted at the Fattouma Bourguiba University Hospital in Monastir, Tunisia, with the collaboration of Bechir Hamza Children’s Hospital of Tunis. The present study was conducted in accordance with the Declaration of Helsinki and was approved by the ethics committee of Fattouma Bourguiba University Hospital (Approval Number: HUFB − 2024 / 87). Informed consent was obtained from the patient and their parents for the use of their genetic material and clinical data in this research.

Biochemical, microbiological, and hematological analysis

Biochemical analyses were conducted using blood samples collected from the patient. The assays included measurements of ferritin, C-reactive protein (CRP), cholesterol, and triglycerides, all performed on the ROCHE COBAS INTEGRA 400 analyzer. Hematological analysis included a complete blood count (CBC) was performed using the Coulter^® LH 780^® analyzer. Morphological examination of blood cells was carried out through a peripheral blood smear, stained with May-Grünwald-Giemsa (MGG) stain, and observed under a microscope at 100x magnification to detect any cellular anomalies characteristic of CHS, such as large intracytoplasmic granules in leukocytes. The myelogram was performed to further evaluate the bone marrow. Blood and urine were cultured on selective media to identify bacterial pathogens. The organisms were identified based on colony morphology, Gram staining, and biochemical tests. Serology for common viral infections, including cytomegalovirus (CMV) and Epstein-Barr virus (EBV) was performed using enzyme immunoassays on the mini-vidas^® system. For positive cases, viral loads were quantified using real-time PCR with the Artus QS-RGQ Kit from Qiagen.

LYST protein levels were quantified in serum samples from the proband and parents using the Human Lysosomal Trafficking Regulator (LYST) ELISA Kit (Abbexa, Cambridge, UK) which is a quantitative sandwich enzyme-linked immunosorbent assay designed to measure LYST protein levels in biological fluids. Serum was separated from peripheral blood by centrifugation at 1,000 × g for 15 min and stored at -80 °C until analysis. The assay was performed according to the manufacturer’s instructions and the LYST protein levels were determined after measuring measured at 450 nm.

Genetic analysis

DNA extraction

Peripheral blood samples were collected from the patient and his parents after obtaining informed consent. The blood was drawn into EDTA tubes to prevent clotting and preserve nucleic acids for downstream genetic analysis.

Genomic DNA was extracted from peripheral blood leukocytes using the QIAamp DNA Mini Kit (Qiagen^®) according to the manufacturer’s instructions. Briefly, blood samples were lysed in the presence of proteinase K and buffer AL, followed by binding of DNA to a silica membrane. The bound DNA was then washed with specific buffer to remove contaminants, and eluted in Acetate EDTA buffer.

Whole exome sequencing (WES)

To identify the mutation in the LYST gene, Whole Exome Sequencing (WES) was performed using an Illumina sequencing platform. This method enables the identification of genetic variants that could potentially be responsible for the observed phenotype, focusing on exonic regions that are most likely to harbor functional mutations. In this study, WES targets the entire coding region of the LYST gene. Library preparation involved the fragmentation of genomic DNA, followed by ligation of adaptors and amplification of the target regions. The amplified libraries were then subjected to sequencing, generating millions of reads that were aligned to the reference human genome (GRCh38). Bioinformatics tools within the CLC Genomic Workbench v23.0.4 (QIAGEN) were used for sequence alignment, variant calling, and annotation. Variants were annotated using the Variant Effect Predictor (VEP) tool from Ensembl to predict the impact of the mutations on the protein function.

Sanger sequencing

To validate the mutation identified by NGS, Sanger sequencing was performed. Primers (Forword primer; 5’ cagtgagaccatgagtgattgt 3’ and reverse primer 5’ aggccaggaccatgctattc 3’) were designed using Primer3 software (https://primer3.ut.ee/) to amplify the region of interest in the LYST gene. PCR amplification was carried out in a 50 µL reaction volume containing 100 ng of genomic DNA, 0.2 µM of each primer, 1.5 mM MgCl2, 0.2 mM dNTPs, and 1 U of Taq DNA polymerase. The PCR conditions were as follows: initial denaturation at 95 °C for 10 min, followed by 35 cycles of 95 °C for 30 s, 58 °C for 30 s, and 72 °C for 50 s, with a final extension at 72 °C for 5 min. The PCR products were purified using the QIAquick PCR Purification Kit (Qiagen^®) and sequenced using SeqStudio™ Genetic Analyzer System. The sequences obtained were analyzed using Sanger Sequencing and Fragment Analysis Software; SeqScape™ Software v4.0 (Applied Biosystems, Foster City, CA, USA) (https://www.thermofisher.com/order/catalog/product/A38880).

Bioinformatics analysis

The LYST protein is exceptionally large, comprising 3,801 amino acids, which presented challenges in determining the impact and precise location of the identified mutation within its 3D structure. To address these challenges, we used the Phyre2 online server (Protein Homology/analogY Recognition Engine V 2.0) to predict the overall structure of the LYST protein and to understand the positioning of each domain within the lysosome’s lipid bilayer [13]. Each domain’s structure was then refined using Swiss-Modeler, a widely used tool for protein structure prediction, to generate a detailed 3D model [14]. The amino acid sequence of LYST from the UniProt database was inputted into Swiss-Model, which applied comparative modeling techniques based on homologous structures from the Protein Data Bank (PDB). This model provided insights into LYST’s overall architecture and potential functional domains. Using this model, we pinpointed the new p.Gly3424SerfsTer15 mutation within the protein’s structure. Structural visualization tools helped identify the mutation site, enabling an assessment of its spatial context and potential impact on the protein’s function. This approach yielded valuable insights into the structural consequences of the mutation and its potential role in the pathogenesis of Chediak-Higashi syndrome.

Results

Clinical presentation

The proband was an 18-year-old male from a consanguineous marriage, with a history of febrile seizures at the age of 40 days, intellectual disability, and unexplored anemia. Initially referred by a private practice physician to the Infectious Diseases Department at Fattouma Bourguiba University Hospital in Monastir, the patient presented with persistent fever and left hypochondrial pain, which had not improved with paracetamol or a combination of amoxicillin and clavulanic acid (1 g/125 mg three times a day for 7 days).

Upon admission, clinical examination revealed a pale complexion, a fever of 40 °C, mucocutaneous pallor, and splenomegaly. The patient also exhibited partial oculocutaneous albinism, characterized by light skin and silvery-blond hair, while the remainder of the physical examination was normal. The patient’s medical history included recurrent respiratory infections, such as pneumonia and bronchitis, previously treated with broad-spectrum antibiotics. Additionally, there were signs of mild bleeding tendencies, including frequent nosebleeds (epistaxis) and easy bruising (ecchymosis). Neurological examination showed delayed motor milestones, mild ataxia, and coordination difficulties.

The family history revealed consanguinity, with the parents being first cousins, but no history of Chediak-Higashi Syndrome (CHS) or similar genetic disorders. The patient’s condition progressively worsened, marked by increasing infection frequency and further decline in neurological function. A preliminary diagnosis of CHS was made, leading to further laboratory and genetic investigations.

The patient was ultimately diagnosed with Macrophage Activation Syndrome (MAS) secondary to Chediak-Higashi Syndrome, following the clinical presentation and subsequent biochemical and hematological analyses. Initial treatment included immunoglobulins, but the patient developed febrile neutropenia, necessitating broad-spectrum antibiotic therapy, which provided temporary improvement. Despite being discharged with a follow-up care plan, the patient was readmitted four days later due to recurring fever. Treatment adjustments included switching antibiotics and adding corticosteroids. However, the patient’s condition deteriorated further, with severe neutropenia and pancytopenia. Hemorrhagic complications due to thrombocytopenia arose, which did not improve despite platelet transfusions. After a prolonged and complex hospital stay, marked by multiple therapeutic interventions and recurrent severe symptoms, the patient’s condition continued to decline, leading to his death after 95 days of hospitalization.

Biochemical and hematological analysis

Biochemical findings

The biochemical analysis revealed several abnormalities. The patient had elevated levels of ferritin (800 ng/mL; reference range: 20–300 ng/mL) and cholesterol (total cholesterol: 280 mg/dL; reference range: 125–200 mg/dL). The lipid profile showed elevated levels of low-density lipoprotein (LDL) cholesterol (180 mg/dL; reference range: <100 mg/dL) and triglycerides (200 mg/dL; reference range: 40–160 mg/dL), with reduced levels of high-density lipoprotein (HDL) cholesterol (30 mg/dL; reference range: >40 mg/dL). The patient also had a mildly elevated C-reactive protein (CRP) level (43 mg/L; reference range: <5 mg/L), indicating a chronic inflammatory state, likely due to recurrent infections (Table 1).

Table 1.

Detailed clinical and laboratory profile of a Chediak-Higashi syndrome case

Category	Parameter	Value	Reference Range
Clinical	Fever (40 °C) Splenomegaly Oculocutaneous albinism Light skin and silvery-blond hair Neurological symptoms (ataxia, coordination issues) Recurrent respiratory infections Nosebleeds and bruising		--
Biochemical	Ferritin	800 ng/mL	20–300 ng/mL
	Triglycerides	200 mg/dL	40–160 mg/dL
	Total cholesterol	280 mg/dL	125–200 mg/dL
	LDL cholesterol	180 mg/dL	< 100 mg/dL
	HDL cholesterol	30 mg/dL	> 40 mg/dL
	CRP	43 mg/L	< 5 mg/L
Hematological	Hemoglobin	9 g/dL	13–17 g/dL
	Platelets	95 × 10⁹/L	150–450 × 10⁹/L
	White blood cell count	2.7 × 10⁹/L	4–11 × 10⁹/L
	Neutrophil count	0.6 × 10⁹/L	1.5–7.5 × 10⁹/L
	Peripheral blood smear	Giant granules in neutrophils and lymphocytes	Normal
	Myelogram	Large intracytoplasmic inclusions in neutrophils and lymphocytes, hemophagocytosis	Normal
	Red blood cell count	2.7 × 10⁶/µL	4–6 × 10⁶/µL
	Hematocrit	29%	42–52%
	Mean corpuscular volume (MCV)	84.7 fl.	80–100 fl.
	Mean corpuscular hemoglobin (MCH)	27 pg	27–32 pg
	Mean corpuscular hemoglobin concentration (MCHC)	32%	32–36%
	Monocyte count	0.5 × 10⁹/µL	0.1–1 × 10⁹/µL
	Lymphocyte count	1.7 × 10⁹/µL	1–4 × 10⁹/µL
	Eosinophils	0.01 103/µL	0.04–0.4 × 10⁹/µL
	Basophils	0.02 × 10⁹/µL	< 0.05 × 10⁹/µL
Microbiological	Blood Culture	Staphylococcus aureus (detected)	None detected
	Urine Culture	Escherichia coli(detected)	None detected
	Serology (EBV, CMV)	Positive IgG antibodies	Negative
	PCR (EBV, CMV)	Not detected	Negative

The LYST protein levels measured using the Human LYST ELISA Kit demonstrated significant differences between the proband, the parents, and a control group. The LYST protein level in the proband was markedly reduced at approximately 1.8 ng/ml, compared to 7.8 ng/ml in the father, 8.1 in the mother, and 9.2 ng/ml in the control group. The sensitivity of the ELISA technique was < 0.094 ng/ml, ensuring accurate detection of the reduced LYST levels in the proband (Fig. 1). These results highlight the significant reduction in LYST protein expression caused by the reported mutation, correlating with the proband’s clinical presentation.

Fig. 1.

Quantification of LYST protein levels in a Chediak-Higashi syndrome case using the human lysosomal trafficking regulator (LYST) ELISA kit

Hematological findings

The complete blood count (CBC) revealed the following: white blood cell count of 2.7 × 10^9/L (reference range: 4–11 × 10^9/L), hemoglobin level of 9 g/dL (reference range: 13–17 g/dL), and platelet count of 95 × 10^9/L (reference range: 150–450 × 10^9/L). The patient exhibited neutropenia, with an absolute neutrophil count (ANC) of 0.6 × 10^9/L (reference range: 1.5–7.5 × 10^9/L) (Table 1). A peripheral blood smear showed giant granules in neutrophils and lymphocytes, consistent with CHS (Fig. 2A and B). The myelogram revealed large intracytoplasmic inclusions in lymphocytes, neutrophils, and bone marrow precursors (Fig. 2C), accompanied by signs of hemophagocytosis (Fig. 2D). The erythroid and megakaryocytic series appeared normal.

Fig. 2.

Morphological examination of blood cells performed using a peripheral blood smear stained with May-Grünwald-Giemsa (MGG) and observed at 100x magnification. (A) The peripheral blood smear shows giant granules in neutrophils characteristic of Chediak-Higashi Syndrome (CHS). (B) Peripheral blood smear demonstrating a lymphocyte with a single prominent giant granule in its cytoplasm, consistent with CHS. (C) The myelogram reveals large intracytoplasmic inclusions in neutrophils and bone marrow precursors, further confirming the presence of CHS. (D) Myelogram showing a single macrophage actively engaged in hemophagocytosis, with cellular debris visible in its cytoplasm

Microbiological findings

Cultures from blood and urine samples yielded Staphylococcus aureus and Escherichia coli, respectively. Both pathogens are common in CHS due to impaired immune function. Serological tests were positive for Epstein-Barr virus (EBV) and cytomegalovirus (CMV) IgG antibodies, indicating past exposure. However, no active viral replication was detected by PCR (Table 1).

Genetic analysis

Next-generation sequencing (NGS) results

Genomic DNA from the patient was subjected to Next-Generation Sequencing (NGS) targeting the LYST gene. The sequencing data were aligned to the human reference genome (GRCh38) and analyzed for variants. A novel homozygous frameshift mutation, ENST00000389793.7: c.10269_10275del, was identified in exon 45 of the LYST gene. This mutation leads to a frameshift and results in a premature stop codon 15 amino acids downstream, denoted as ENSP00000374443.2:p.Gly3424SerfsTer15. This mutation truncates the LYST protein, likely resulting in a loss of function. This variant was absent from population databases such as gnomAD, indicating it is a novel mutation. In silico prediction tools classified the variant as likely pathogenic, given its predicted impact on protein structure and function. Both parents were confirmed to be heterozygous carriers of this mutation, as revealed by Sanger sequencing.

Sanger sequencing confirmation

To validate the NGS findings, Sanger sequencing was performed on the region encompassing the c.10269_10275del mutation in the LYST gene. The Sanger sequencing confirmed the presence of the homozygous frameshift mutation in the patient and heterozygous carrier status in both parents. The sequencing chromatograms displayed the deletion at the expected position, with the patient’s sequence showing a homozygous deletion leading to a frameshift (Fig. 3).

Fig. 3.

Family pedigree (A) and electropherograms (B) showing the identified frameshift mutation c.10269_10275del (p.Gly3424SerfsTer15) associated with Chediak-Higashi Syndrome

In panel (A), the arrow denotes the proband. In panel (B); (a) the upper row displays the normal control sequence, with the deleted 7 nucleotides (CGGAGCC) boxed in red. (b) The middle row shows the presence of the mutation in a homozygous state in the patient (IV₁), leading to a frameshift and premature stop codon p.Gly3424SerfsTer15. (c) The bottom row illustrates the heterozygous mutation detected in both the father (III₃) and mother (III₄), confirming their carrier status.

Bioinformatics analysis

The Phyre2 online server predicted that the secondary structure of the LYST protein is composed mainly of 35% alpha-helices and 9% beta-sheets, with these structural elements primarily located in the C-terminal region starting from amino acid 3420, which is completely devoid of alpha-helices. The remainder of the protein consists of turns and disordered structure. Phyre2 also predicted the presence and location of transmembrane helices, identifying a total of 8 transmembrane regions in the LYST protein (Fig. 4). Each transmembrane domain is composed of helices positioned to span the lysosomal lipid bilayer. These domains are crucial for anchoring the protein to the lysosomal membrane, thereby maintaining its position and function in lysosomal trafficking.

Fig. 4.

Predicted transmembrane topology of the LYST protein using the Phyre2 server

The placement of amino acids within the lipid bilayer is indicated, with numbering from 1 to 3801. The composition of the protein’s domains is illustrated, with an explanatory legend provided. The emplacement of the novel mutation p.Gly3424SerfsTer15 in the WD40 Repeats region is indicated by blue dotted arrow.

The LYST protein, composed of 3801 amino acids, has a complex architecture that can vary due to factors like isoforms and alternative splicing. Using in silico tools like Swiss-Modeler and protein database like UniProt, we can propose an approximate distribution of its functional domains (Fig. 5).

Fig. 5.

3D Structure prediction of the LYST protein using Swiss-Modeler server

• ARM (Armadillo Repeats): Located in the N-terminal region, these repeats potentially span from position 1 to around 3000. They are involved in protein-protein interactions and may play a role in intracellular trafficking, particularly in regulating lysosomal fusion and exocytosis.

• PH (Pleckstrin Homology) Domain: Found near transmembrane helix 8, this domain may extend from positions 3009 to 3115. PH domains are known for their lipid-binding properties, aiding in membrane targeting and interaction with lipid components of intracellular membranes.

• BEACH (Beige and Chediak-Higashi) Domain: This key domain is crucial for LYST’s association with membranes. It begins near transmembrane helix 8, around position 3120, and extends to about 3422. The BEACH domain is involved in membrane trafficking and fusion within the endosomal-lysosomal system, and mutations here can disrupt these functions, contributing to Chediak-Higashi Syndrome (CHS).

• WD40 Repeats: Located toward the C-terminal end, these repeats, especially five found after the BEACH domain, likely span from position 3563 to the protein’s end. WD40 repeats facilitate protein-protein interactions, contributing to intracellular trafficking and lysosomal function.

The p.Gly3424SerfsTer15 mutation leads to the deletion of 362 amino acids, specifically removing the five WD40 repeats in the C-terminal region. Although the ARM, BEACH, and PH domains remain intact, the loss of these repeats may impair protein interactions and disrupt lysosomal function, potentially contributing to the pathology of CHS.

The ARM domain is colored in red and blue, with red representing transmembrane helices and blue indicating extra- or intracellular segments. The WD40 repeats are shown in green, while the PH and BEACH domains are colored in yellow and pink, respectively. The mutation which deleted the WD40 repeats from WD3 to WD 7 is indicated by a blue dotted arrow. Amino acid numbering is provided for each domain.

Discussion

Chediak-Higashi Syndrome (CHS) is a rare genetic disorder characterized by a complex clinical presentation. The patient described in this study exhibited classical signs of CHS, including silver-colored hair, hypopigmented skin, recurrent infections, and progressive neurological decline [2, 9]. These symptoms are consistent with the literature, which characterizes CHS as a multisystem disorder resulting from mutations in the LYST gene, which disrupt lysosomal trafficking and function. The patient’s clinical course, including frequent hospitalizations for bacterial and viral infections, reflects the profound immune deficiency associated with CHS, particularly the dysfunction of neutrophils and natural killer (NK) cells [10].

Neurological symptoms, including delayed motor and cognitive development, are also a hallmark of CHS and typically worsen over time. This progressive neurodegeneration is believed to result from the accumulation of dysfunctional lysosomes within neurons, leading to cellular damage and death. The patient’s history of spontaneous bruising and prolonged bleeding is indicative of a bleeding diathesis, which is another common feature of CHS due to the presence of abnormal lysosome-related organelles in platelets [14, 15].

The patient’s presentation is typical of the “accelerated phase” of CHS, which is often triggered by infections and characterized by hemophagocytic lymphohistiocytosis (HLH), a severe inflammatory condition that can lead to multi-organ failure and death if untreated. While the patient had not yet developed overt HLH at the time of diagnosis, the clinical history suggests a high risk for this life-threatening complication [2, 12].

The biochemical findings in this patient provide further evidence of the systemic nature of CHS. Elevated serum ferritin and C-reactive protein (CRP) levels indicate a state of chronic inflammation, which is often seen in patients with CHS due to recurrent infections and immune dysregulation. The lipid profile, particularly the low HDL-cholesterol level, may reflect a broader metabolic disturbance, although its direct relevance to CHS requires further investigation.

Hematological analysis revealed neutropenia, thrombocytopenia and anemia, which are common in CHS. The presence of giant granules within neutrophils and other leukocytes is a pathognomonic feature of the disorder, reflecting the underlying defect in lysosomal trafficking. These granules represent lysosomes that have failed to undergo normal maturation and function, resulting in impaired cellular processes, including phagocytosis and the release of cytotoxic substances.

The patient’s bone marrow examination confirmed the presence of dysplastic changes and abnormal lysosome-related organelles, which are characteristic of CHS. These findings correlate with the patient’s clinical symptoms, particularly the immune deficiency and bleeding tendencies. The identification of Staphylococcus aureus and Escherichia coli in microbiological cultures underscores the susceptibility of CHS patients to opportunistic infections, further complicating the clinical management of the disorder [15–17].

The identified mutation, c.10269_10275del, in the LYST gene was not detected in 100 healthy individuals from the same geographic region, further supporting its rarity and potential pathogenicity. Its absence in public databases, such as gnomAD, reinforces its novelty. Given the high rate of consanguinity in the Tunisian population, the possibility of a founder effect cannot be excluded. Founder mutations often arise in isolated populations or within family lineages with limited genetic diversity, leading to the increased prevalence of specific genetic variants. This hypothesis is particularly plausible in this case, as the patient’s family history indicates consanguinity. Future studies involving a larger cohort and haplotype analysis would be essential to confirm the founder effect and provide insights into the mutation’s origin and dissemination within the population.

The novel mutation described here adds to the growing catalog of LYST mutations associated with CHS. While many different mutations have been reported in CHS patients, including missense, nonsense, and splice-site mutations, deletions leading to frameshifts and premature stop codons tend to be associated with more severe phenotypes [3, 5]. This is consistent with the patient’s presentation, which includes early-onset symptoms.

CHS is a genetically heterogeneous disorder, with significant variability in the type and location of mutations in the LYST gene. The nonsense mutations and large deletions in the LYST gene often lead to a loss of function, resulting in the severe, classic form of CHS. Patients with missense mutations that allow for some residual LYST function tend to have milder disease and may survive into adulthood without developing the accelerated phase. In contrast, patients with truncating mutations, like the one described here, typically have a more severe course [3, 5, 18]. This highlights the need for personalized approaches to managing CHS, taking into account the specific genetic mutation and its predicted impact on protein function.

The p.Gly3424SerfsTer15 mutation in our study, leading to a truncated LYST protein, shares features with other truncating mutations reported in the literature, such as those linked to HLH and severe immunodeficiency. However, our case presents with atypical features, including delayed HLH progression and relatively preserved immune function. These contrasts with the more severe, early-onset phenotypes observed in other cases, suggesting that residual functionality of the retained LYST domains or compensatory mechanisms may explain the milder course. A similar case has been reported for the p.Gly3466Alafs*2 mutation, located nearby, which was described in a Japanese female with a milder phenotype. She survived into adulthood but developed progressive neurological dysfunction. Some patients with mutations in this region present an intermediate phenotype, with severe early infections but a milder course during adolescence, without an accelerated disease phase [19–20].

A missense mutation in Exon 48 of the WD40 domain of the Lyst gene (LystIng3618) in mice has been linked to progressive neurodegeneration, distinct from the immunodeficiency typically seen in beige mice. Mice with the LystIng3618/LystIng3618 mutation show signs of deteriorating Purkinje cells and experience neurological decline as they age, in comparison to wild-type mice. By 18 months, these mice exhibit enlarged lysosomes and a significant loss of Purkinje neurons [9, 21]. This phenotype mirrors the mild, atypical variants of Chediak-Higashi Syndrome identified in this study.

In this study, molecular modeling of the 3D structure of the protein, generated through structural homology, showed that the deletion of a large portion of the protein (p.Gly3424SerfsTer15) results in the loss of five out of seven WD40 repeats in the protein’s C-terminal regions, which are essential for mediating protein-protein interactions and facilitating lysosomal trafficking. This might explain why the patient survived beyond the age of 18 with a reduced LYST protein level of 1.8 ng/ml. The cells may compensate for the loss of 362 C-terminal amino acids by upregulating alternative pathways involved in lysosomal trafficking. This compensation could reduce the mutation’s severity compared to mutations that abolish critical functional domains (BEACH and PH).

The identification of a novel LYST mutation in this patient has significant clinical implications. First, it provides a definitive genetic diagnosis, which is crucial for guiding clinical management and genetic counseling. Given the autosomal recessive inheritance of CHS, identifying the specific mutation allows for accurate carrier testing in family members and informed decision-making regarding future pregnancies.

Second, the nature of the mutation suggests that the patient is at high risk for developing the accelerated phase of CHS, which necessitates close monitoring and early intervention. Hematopoietic stem cell transplantation (HSCT) is currently the only curative treatment for CHS and is most effective when performed before the onset of the accelerated phase [2, 9]. The genetic findings in this case support the consideration of early HSCT to prevent the severe complications associated with the accelerated phase.

In populations with limited access to advanced therapies like HSCT, alternative management strategies for Chédiak-Higashi syndrome (CHS) are crucial. While HSCT remains the gold standard for curative treatment, many patients, particularly in resource-limited settings, may not have access to this therapy due to age, lack of suitable donors, or financial constraints. Our findings suggest that the clinical course of CHS can vary depending on the nature of the LYST mutation, with some patients showing milder disease progression due to residual protein function. This variability opens the door for alternative therapeutic strategies tailored to the individual patient’s genetic and clinical profile. For patients with partial mutations, immunomodulatory treatments, such as intravenous immunoglobulin (IVIG) or granulocyte-colony stimulating factor (G-CSF), could help manage immune dysfunction and reduce the frequency of infections, which are a key concern in CHS.

In addition, supportive care, including blood transfusions, antibiotic prophylaxis, and early intervention for neurological complications, is essential. In settings where HSCT is unavailable, early diagnosis, genetic counseling, and comprehensive symptom management should be prioritized to improve patient outcomes.

Another important research direction is the development of targeted therapies for CHS. While HSCT remains the standard of care for preventing the accelerated phase of CHS, it is associated with significant risks and complications. Gene therapy, which involves correcting the underlying genetic defect, represents a promising avenue for treatment. Recent advances in gene editing technologies, such as CRISPR/Cas9, offer the potential to repair LYST mutations directly in hematopoietic stem cells, providing a more targeted and potentially curative approach [22, 23].

Furthermore, therapies that enhance lysosomal function or mitigate the effects of dysfunctional lysosomes could be explored. Small molecules that promote lysosomal biogenesis or function have shown promise in other lysosomal storage disorders and could be investigated as potential treatments for CHS. Additionally, understanding the cellular pathways affected by LYST mutations may reveal new targets for pharmacological intervention [24].

While our bioinformatics analysis provides valuable insights into the structural and functional implications of the LYST mutation, we recognize the importance of experimental validation to strengthen these mechanistic claims. Protein stability assays would be critical to confirm the size and expression of the mutated protein, providing a more direct link between the mutation and its phenotypic consequences. Additionally, functional studies, including cellular assays to evaluate immune cell, would further elucidate the biological consequences of this mutation as previously described in patients with IL7RA Mutation [25]. However, the large size of the LYST gene, which comprises 53 exons with a transcript length of 13,466 base pairs, and the LYST protein, which is 429 kilodaltons (kDa), presents a significant technical barrier to performing these functional studies. Unfortunately, due to limited patient-derived samples and these technical challenges, such experiments were not feasible in this study.

Conclusion

In summary, this study reports the identification of a novel homozygous deletion in the LYST gene in a Tunisian patient with Chediak-Higashi Syndrome. The mutation leads to a truncated LYST protein, resulting in significant clinical manifestations, including immune deficiency. This study contributes to the expanding knowledge of CHS genetics, highlighting the importance of early diagnosis and personalized treatment approaches. As our understanding of the molecular mechanisms underlying CHS continues to grow, so too will our ability to develop more effective therapies and improve outcomes for patients with this challenging disorder.

Author contributions

Y.A and S.C: Writing– original draft, Visualization, Methodology, Investigation, Formal analysis, Conceptualization. HF, AA, and IK: Writing– review & editing, Visualization, Methodology, Investigation, Formal analysis. T.A and K.HK: Writing– review & editing, Investigation, Formal analysis. R.M: Writing– review & editing, Investigation. T.M and M.H: Investigation, Methodology,. R. D: Writing– original draft, Visualization, Conceptualization.

Funding

No funding.

Data availability

No datasets were generated or analysed during the current study.

Declarations

Ethics approval and consent to participate

This study was carried out under the principles of theDeclaration of Helsinki developed by the World Medical Association and approved by the Human Ethics committee of Fattouma Bourguiba University Hospital of Monastir (Approval Number: HUFB − 2024 / 87). Informed consent to participate was obtained from all participants after receiving all the necessary information about the research. All data and identities of patients were processed with strict confidentiality.

Consent for publication

Written informed consent for publication of personal and clinical details was obtained from all participants and the parents of the minor patient. This consent was obtained in accordance with ethical guidelines and institutional regulations.

Competing interests

The authors declare no competing interests.