Development of an indirect ELISA based on a new specific lipoprotein LP53 for the detection of antibodies against Mycoplasma synoviae

Abstract

Background

Mycoplasma synoviae (MS) is considered to be one of the main mycoplasma pathogens of poultry, causing arthritis, airsacculitis, eggshell apex abnormalities and production drops in chickens and turkeys. Infection by MS usually results in considerable economic losses to the poultry industry worldwide. Therefore, it is essential to develop a highly sensitive and accurate diagnostic method in the livestock production.

Results

The MSLP53 was predicted as a highly conserved and specific membrane associated lipoprotein of MS by bioinformatics analysis. The His-tagged MSLP53 (rMSLP53) protein was expressed and purified using E. coli expression system, and was confirmed by Western blotting to react with each MS-positive serum, but not react with positive sera against other avian pathogens, suggesting that the rMSLP53 had strong immunoreactivity and specificity. An rMSLP53-based indirect ELISA was developed, compared to IDEXX kit with a pool of 277 chicken sera samples, and showed high sensitivity (85.54%), specificity (89.19%) and coincidence rate (87.00%) within these two methods. When detecting the sera from experimentally infected chickens, the newly established rMSLP53-ELISA had certain advantages over the IDEXX kit, that is, it could identify the serum 3–18 weeks after infection as MS-positive serum, while IDEXX kit could only identify the serum 3–12 weeks after infection as positive serum.

Conclusion

The MSLP53 protein is a specific immunogenic lipoprotein of MS, which was confirmed to be a promising antigen target for the detection of serum antibodies of MS. A rMSLP53-based indirect ELISA assay was successfully established in this study, showed high sensitivity, specificity and consistency with the commercial IDEXX kit, and could recognize the serum as MS-positive in a longer period after MS infection than IDEXX kit. This newly established rMSLP53-ELISA may be used as an effective detection method for MS serological monitoring and epidemiological investigation.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12917-025-04827-4.

Background

Avian mycoplasmosis is caused by pathogens from genus Mycoplasma within the class of Mollicutes, which was first described as chronic respiratory disease caused by coccobacilliform bodies in 1936 [1]. Among a total of 25 known species of mycoplasma in poultry, primarily four species, Mycoplasma gallisepticum (MG), Mycoplasma synoviae (MS), Mycoplasma meleagradis (MM) and Mycoplasma iowae (MI) are considered to be pathogenic [2]. MS is considered to be one of the main pathogenicity of poultry, causing abnormal ities in the synovial membranes of joints and tendon sheaths, with eggshell apex abnormal ities and production drops [3]. Furthermore, it causes synergistic effects in producing diseases with other pathogens, such as Newcastle disease virus (NDV), Infectious bronchitis virus (IBV), Avian influenza virus (AIV) and Escherichia coli (E. coli) [4–6]. Thus, MS infections are a huge concern for poultry farmers and cause huge economic losses to poultry industry every year [7]. MS was first isolated in the United States in 1954, although it can be found in poultry throughout the world [8–11]. Due to MS having been traditionally considered as one of the most important avian mycoplasma species in commercial chickens from the clinical and economic point of view, it was listed and notifiable to the World Organization for Animal Health (OIE) [12, 13]. In recent years, along with the increasing development of the poultry industry, multi-aged breeder farms were widely infected with MS between 2010 and 2015 in China. MS infection is very common in China and should prompt further research to develop effective control and prevention strategies [14]. The sero-prevalence of MS has been observed much higher than that of MG, especially in countries with control and eradication programmes for the latter [15]. Therefore, the efficient, sensitive, and rapid diagnostic method of MS is urgently required to identify infected poultry to reduce the risk of transferring the infection to healthy poultry, as well as prioritize care and controls measures in geographical regions in which MS is highly prevalent.

Isolation and identification are the “gold standard” of mycoplasma diagnosis, but due to the difficulty of cultivation and long culture time, it is not suitable for rapid clinical diagnosis. Large-scale primary screening of flocks for MS infection typically uses serological diagnostic assays such as serum plate agglutination (SPA), enzyme linked immunosorbent assay (ELISA), and haemagglutination inhibition (HI) [2]. In both surveillance and epidemiological research, the serological detection has been widely utilized to identify infected and carrier animals [2]. While HI and SPA remain common diagnostic tools for MS, their reliance on whole-cell antigens or hemagglutination activity introduces notable limitations. HI assays are labor-intensive and exhibit limited sensitivity in subclinical infections, whereas SPA, despite rapid turnaround, suffers from subjective interpretation and cross-reactivity with non-MS mycoplasmas [16]. Numerous laboratories employ commercially available ELISA kits for screening or confirmation purpose. In general, ELISA tests exhibit slightly reduced sensitivity but greater specificity compared to SPA tests, while demonstrating higher sensitivity but lower specificity relative to HI tests [16–19]. Therefore, it is essential to screen out useful markers of MS infection for developing sensitive and specific serological tests. In MS, the membrane surface is abundant in lipoproteins, which play a critical role in adhesion to host cells and are considered key targets of the host immune response [20–22]. The membrane-associated lipoprotein MSPB, located at the amino-terminal end of the variable lipoprotein hemagglutinin (VlhA), has been recognized as an important immune response protein, and a highly specific and sensitive diagnostic antigen for detection of MS serum antibody [23, 24]. However, the MSPB contains a proline-rich repeat region, which is prone to insertion or deletion mutation and resulting in antigenic variation [25, 26]. This genetic instability may result in false-negative outcomes during clinical testing, significantly compromising diagnostic reliability. To overcome these challenges, there is an urgent demand for a novel diagnostic antigen that integrates strong immunoreactivity, exceptional specificity, high genetic stability, and compatibility with high-throughput platforms. In previous study, we screened an immunogenic protein MSLP53 by immunoproteomics with mass spectrometry analysis of MS membrane proteins (data not shown). Its remarkble intraspecific conservation significantly may reduce the risk of false-negative results due to strain-specific mutations, while its high interspecific specificity may minimize false-positive results by preventing cross-reactivity with other strains. The objective of this study is to develop and optimize an indirect ELISA assay utilizing the MSLP53 protein, thereby establishing a critical tool for the accurate monitoring and effective control of MS infections.

Results

Bioinformatic analysis of MSLP53

The MSLP53 protein contains 498 amino acids with an estimated molecular mass of 53.6 kDa and an isoelectric point of 6.81 using the Compute pI/Mw tool of ExPASy. It is speculated that MSLP53 is a membrane-associated lipoprotein because the MSLP53 protein was predicted containing a prokaryotic membrane lipoprotein lipid attachment site profile (PROKAR_LIPOPROTEIN) at the N-terminal by the Prosite tool. Homology alignment analysis by BLASTp against Non-redundant protein sequences (nr) database showed the similarities of LP53 between 26 different MS isolates (including MS WVU₁₈₅₃, MS NCTC10121, MS-H and MS 53, MS HB11, MS 86079-7NS, MS CH49, MS CH56, MS GX11-T, MS SH, MS 18DW, MS BS4S2, MS G3, MS A4, MS Zhejiang yqh71, MS Guangxi_zxm61, MS Guangxi_1mm64, MS GuangXi_wxm43, MS GuangXi_h12a15, MS Guangdong_tz159, MS JiangSu_xh51, MS JiangSu_gyw72, MS XiNan_ylk67, MS XiNan_wzy60, MS XiNan_zcs44, and MS Fujian_hzh45) were 97.79-100% under a query cover value of 100%, while the homology with other species was less than 26.34%.

Expression of MSLP53 protein in E. coli

The full length of MSlp53 gene, which was modified (TGA to TGG) at four sites, was obtained from the MSWVU₁₈₅₃ genome with overlap PCR (Fig. 1A). It was then subcloned to pCold I vector (Fig. 1B) and transformed into E. coli BL21(DE3). After induction with β-D-1-thiogalactopyranoside (IPTG), the His-tagged MSLP53 protein was expressed in E. coli as a soluble protein and was purified successfully (Fig. 1C). The concentration of the purified rMSLP53 protein was about 0.6 mg/mL as determined by a BCA protein concentration detection kit.

Fig. 1.

Amplification, recombinant plasmid construction, expression and purification of MSLP53. (A) Overlap PCR products for MSlp53 gene. M: DL2 000 DNA marker; 1–5: PCR product with primers MSlp53 1 F/1R-5 F/5R; 6: full length of MSlp53 gene produced by overlap PCR amplification. (B) Double enzyme digestion of recombinant expression plasmid. M: DL5 000 DNA marker; 1: the recombinant expression plasmid pCold I-MSlp53 digested by BamH I/EcoR I. (C) Expression and purification of recombinant MSLP53 protein. 1: IPTG-induced E. coli BL21 cells containing empty pCold I vector; 2: supernatants from IPTG induced E. coli BL21 containing pCold I-MSlp53; 3: purified rMSLP53 protein

Immunoreactivity and specificity analysis of rMSLP53

Immunoblot assays were performed to analyze the immunoreactivity and specificity of rMSLP53. The purified rMSLP53 protein was used as antigen to react with the standard MS-positive chicken serum and chicken positive sera against different MS isolates (MS WVU₁₈₅₃, JS1, SD1, SH1 and HB1), the results indicated that the rMSLP53 appeared to have a specific reaction band with each MS-positive serum (Fig. 2, lanes 1–6), but no band with standard MG-positive chicken serum and different MG-positive chicken sera (Fig. 2, lanes 7–13), positive sera against other avian pathogens including MI, SPG, E. coli O1/O2/O78, NDV, IBV and IBDV (Fig. 2, lanes 14–19), or MS-negative serum (Fig. 2, lane 20). These findings suggested that the rMSLP53 had strong immunoreactivity and specificity.

Fig. 2.

Immunoreactivity and specificity analysis of rMSLP53 with different chicken sera. The purified rMSLP53 protein was used as antigen to react with chicken positive sera against different MS isolates, MG-positive chicken sera and positive sera against other avian pathogens. M: protein marker; Lane1-6: the standard MS-positive chicken serum (positive control) and positive chicken sera of different MS isolates (MS WVU₁₈₅₃, JS1, SD1, SH1 and HB1); Lane7-13: standard MG-positive chicken serum and different MG-positive chicken sera (MG R_low, 013, 08, FBH, SGN, SS); Lane14-19: positive sera against other avian pathogens including (MI, SPG, E. coli O1/O2/O78, NDV, IBV and IBDV; Lane20: MS-negative serum (negative control)

Determination of optimal conditions for indirect ELISA

A square matrix titration test was used in this study to search for the optimal reaction conditions. The reaction conditions corresponding to the highest P/N values are generally considered to be the optimal conditions. As shown in Table 1, due to the highest P/N value, the optimal concentration of the rMSLP53 protein as the coating antigen was 0.63 µg/mL, and the optimal dilution of chicken serum was 1:500. The other reaction conditions were optimized by varying a single parameter at a time. The optimal dilution of HRP conjugated goat anti-chicken IgY antibody was 1:20 000 (Table 2).

Table 1.

Optimization of rMSLP53 protein coating amount and serum dilution

Serum dilutions	Serum	rMSLP53 protein coating concentration (µg/mL)
		10.00	5.00	2.50	1.25	0.63	0.31	0.16	0.08
	Positive	1.742	1.647	1.576	1.471	1.334	1.141	0.846	0.639
1: 200	Negative	0.498	0.478	0.454	0.318	0.219	0.145	0.138	0.123
	P/N	3.498	3.446	3.471	4.626	6.091	7.869	6.130	5.195
	Positive	1.444	1.332	1.284	1.202	1.274	0.929	0.685	0.471
1: 500	Negative	0.364	0.318	0.264	0.208	0.129	0.124	0.114	0.124
	P/N	3.967	4.189	4.864	5.779	9.876	7.492	6.009	3.798

Note: The values in the table represent the OD_450nm values for positive and negative serum samples. The P/N represents the ratio of positive to negative OD_450nm values

Table 2.

Optimization of indirect ELISA conditions of enzyme-labeled antibody

	Dilution of enzyme-labeled antibody
	1:10 000	1: 20 000	1: 40 000	1: 60 000
Positive (OD450nm)	1.340	1.249	0.689	0.521
Negative (OD450nm)	0.149	0.125	0.103	0.093
P/N	7.929	9.992	6.683	5.602

Note: The dilution of HRP conjugated goat anti-chicken IgY antibody was optimized under the conditions of 0.63 µg/mL rMSLP53 as the coating antigen and a serum dilution ratio of 1:500. The values in the table represent the OD_450nm values for positive and negative serum samples. The P/N represents the ratio of positive to negative OD_450nm values

Application of the indirect ELISA assay in clinical samples

MS antibody test kit (IDEXX, USA) identified 111 clinical MS-positive serum and 166 clinical negative serum samples. The OD_450nm values of these clinical serum samples were observed by the optimal indirect ELISA method as described above. As shown in Fig. 3A, the area under the ROC curve (AUC) was calculated to be 0.8942 with a statistically significant p value of < 0.0001, indicating that the rMSLP53-indirect ELISA has satisfactory diagnostic performance. Based on the ROC curve analysis (Fig. 3B), an optimal cut-off value of OD_450nm = 0.2960 was identified, corresponding to the point closest to the top-left corner of the curve. This value maximizes Youden’s Index (sensitivity + specificity − 1), yielding a sensitivity of 85.54% and a specificity of 89.19%. The IDEXX kit and the rMSLP53-indirect ELISA together tested a total of 99 positive samples and 142 negative serum samples (Table 3). Thus, the positive and negative coincidence rates of the rMSLP53-indirect ELISA, compared to the IDEXX kit, are 89.19% and 85.54%, respectively, and the total coincidence rate of the two methods is 87.00%.

Fig. 3.

Determination of the cut-off value and analysis of sensitivity and specificity based on ROC curves. (A) ROC analysis used to determine area under the curve values (AUC = 0.8942, p value < 0.0001) for the indirect ELISA method using IDEXX kit test as the reference. The optimal cut-off value was determined as the point on the ROC curve closest to the top-left corner. Based on the ROC curve analysis, the optimized sensitivity and specificity were 85.54% and 89.19%, respectively, with the cut-off value set at OD_450nm = 0.2960. (B) Distributions of OD_450nm values for MS-positive and MS-negative serum samples using the indirect ELISA method. A total of 111 IDEXX kit test positive (IDEXXT+) and 166 IDEXX kit test negative (IDEXXT-) sera were evaluated by the indirect ELISA. The dashed line represents the cut-off value for this indirect ELISA based on ROC analysis. The values above the dashed line are considered as MS-positive and those below as MS-negative according to cut-off value for this indirect ELISA

Table 3.

Clinical Sera results from the indirect ELISA and IDEXX kit test

		IDEXX kit		Total
		Positive	Negative
rMSLP53-based indirect ELISA	Positive	99 (89.19%)	24	123
	Negative	12	142 (85.54%)	154
	Total	111	166	277

Note: The percentages indicate the positive and negative coincidence rates of the rMSLP53-indirect ELISA compared to the IDEXX kit

Application of the indirect ELISA assay in MS-infected chicken sera

Changes in MS antibody levels in antisera from eight MS-infected chickens were detected using both the rMSLP53-based ELISA assay and the IDEXX kit. As shown in Fig. 4, the antibodies were not detected in the first two weeks, but increased significantly in the third week for both two methods (p < 0.001). For the rMSLP53-based ELISA assay, the antibody level against MS showed a stable increase from the third week to the 9th week. After the 9th week, the antibody level decreased, but remained at a high level after 18th week. However, for the IDEXX kit, the sera antibodies against MS began to decrease after the third week, and no positive value was detected after 15th week.

Fig. 4.

Detection of MS antibody levels in MS-infected chicken sera using rMSLP53-based ELISA. Sera from eight MS-infected chickens were subjected to the established indirect rMSLP53-based ELISA assay and compared with the MS antibody test IDEXX kit. The sera were collected at 1, 2, 3, 4, 6, 9, 12, 15, 18 weeks (^*: p < 0.05; ^**: p < 0.01; ^***: p < 0.001). The cut-off value of rMSLP53-based ELISA was 0.2960 (horizontal straight line), which of the IDEXX kit was 0.1760 (horizontal dashed line)

Reactivity, specificity and sensitivity of the rMSLP53-based ELISA

To investigate the reactivity and specificity of the indirect ELISA, chicken sera that were positive for MS different isolates, MG different strains, MI, SPG, E. coli O1/O2/O78, NDV, IBV and IBDV were used as the samples and followed by the established procedures. The results showed that when the indirect ELISA reacted with different MS-positive sera, the OD_450nm values were at a high level (greater than 0.7), but when reacted with positive sera against other avian pathogens, the OD_450nm values were less than 0.2960 (cut-off value determined by ROC analysis), indicating that the established indirect ELISA had excellent reactivity and specificity (Fig. 5).

Fig. 5.

Reactivity and specificity analysis of the indirect ELISA. Positive chicken sera for common pathogens in poultry, including the standard MS-positive chicken serum (control), different MS isolates, different MG strains, MI, SPG, E. coli O1/O2/O78, NDV, IBV and IBDV were detected by the indirect ELISA and the OD_450nm values were recorded. The mean OD450nm values for each serum were shown directly above their corresponding data points in the figure. The OD_450nm values of standard MS-negative serum and the positive serum for 13 other pathogens were below the cut-off value (0.2960) except those of MS-positive sera

The indirect ELISA detected five MS-infected serum samples in comparison with the IDEXX kit. The results confirmed that the sensitivity of the indirect ELISA was significantly better than that of the IDEXX kit (Table 4).

Table 4.

Comparison of sera titers detected by two methods

Serum	rMSLP53-based ELISA	IDEXX kit
1	1: 25 600	1: 800
2	1: 102 400	1:3200
3	1: 25 600	1:400
4	1: 6 400	1:1600
5	1: 25 600	1:1600

Discussion

Avian mycoplasmosis mainly caused by MG and MS is an economically important disease of poultry industry [27]. MG and MS cause persistent infection in chickens, which have been in long-term clinical or subclinical state, triggering immunosuppression and other important infectious diseases such as NDV, AIV, and IBV [16]. Eradication is the most important control measure for MG and MS infections in poultry. For eradication of vertically transmitted agents, early detection of new infections is essential [28]. Many countries and integrations are involved in monitoring programmes to control both mycoplasma species. The epidemiology and harmfulness of MS in the poultry industry are becoming increasingly apparent, necessitating the development of an effective detection technology to prevent and control the spread of MS [29, 30]. At present, MS infection is often diagnosed using SPA, HI, or ELISA. Diagnosis of avian mycoplasmosis infections in poultry breeder flocks is often performed in the absence of overt clinical signs, and screening for infection is usually based on a presumptive test performed by SPA test and a confirmative test accomplished by ELISA [31]. SPA is highly efficient in detecting the earliest immune response of immunoglobulin M (IgM) to mycoplasma infection [31]. Although the SPA test is rapid, highly sensitive, and relatively inexpensive, it is prone to false positive results due to its tendency to cross-react with other sera such as MG, MI, and other sera, which can affect the accuracy of the diagnosis [31]. HI is a specific serological detection method and does not cause cross reaction between MG- and MS- positive serum. However, due to strict requirements for antigen preparation and storage, as well as complex operations and poor sensitivity, its use is limited to some extent. By comparison, ELISA can simultaneously detect a large number of samples with higher specificity, sensitivity, and accuracy, which is relatively stable and currently the most widely used method [32, 33]. In mycoplasma, a large amount of lipoproteins were exposed on the surface, which can be used as antigen to induce host immune response or play a toxic role [34–38]. In our early study, the immuno-proteomics analysis of MS membrane protein was conducted combining with mass spectrometry sequencing, the lipoprotein MSLP53 was found to be an immunogenic protein (data not shown). The MSLP53 protein is predicted to be a membrane-associated lipoprotein because the N-terminal of the MSLP53 protein contains a prokaryotic membrane lipoprotein binding domain. Due to the homology of MSLP53 protein sequence between 26 different MS isolates reaching 97.79-100%, while the homology with other species was less than 26.34%, the MSLP53 was considered a highly conserved and specific protein of MS. Later, the western blot analysis showed the purified rMSLP53 protein displayed a specific immune reaction with the positive sera of various isolates of MS and not with those of other avian diseases, indicating it is appropriate as an antigen for detecting specific antibodies against MS.

Here we established an indirect ELISA detection method based on rMSLP53 protein as a coated antigen. The rMSLP53-ELISA method was evaluated using 277 clinical serum samples from 3 poultry farms in different areas of China (including Shanghai, Shandong and Guangdong), and was then compared with the IDEXX kit. The sensitivity and specificity were detected at 85.54% and 89.19%, respectively, and the total coincidence rate of the two methods is 87.00%, which confirmed the application potential of rMSLP53-ELISA for MS antibody detection. In addition, the rMSLP53-based ELISA revealed that chickens infected by MS could produce high levels of antibodies against MSLP53 from 3 to 18 weeks after infection. However, the IDEXX testing method could only detect positive serum from 3 to 12 weeks after MS infection. These results suggest that the rMSLP53-based ELISA assay has certain advantages over the IDEXX kit in detection of MS-infected sera, because it can detect the positive value for a longer time after infection than the IDEXX kit.

This study is the first to use LP53 protein as a coating antigen to establish an indirect ELISA method for detecting MS serum antibodies and assess its potential application in clinical sera, providing a reference approach for the diagnosis and epidemiological investigation of MS.

Conclusion

In conclusion, we identified a lipoprotein MSLP53 with strong intraspecific conservation and interspecific specificity that could effectively recognize MS-positive serum. This newly established rMSLP53-ELISA showed high sensitivity, specificity and consistency with the commercial IDEXX kit, and could recognize the serum as MS-positive in a longer period after MS infection compared with IDEXX kit, which may be used as an effective detection method for MS serological monitoring and epidemiological investigation.

Materials and methods

Experimental strains and serum

The MS strain WVU₁₈₅₃ was purchased from the China Veterinary Culture Collection Center (CVCC). The positive chicken sera against different MS clinical isolates (including MS strain WVU₁₈₅₃, JS1, SD1, SH1 and HB1), MG strains (MG R_low, 013, 08, FBH, SGN, SS), MI 695, or E. coli O1/O2/O78 were prepared and preserved in our lab [20]. The standard MS/MG-positive, Salmonella pullorum/gallinarum (SPG)-positive, NDV-positive, IBV-positive chicken sera or Infectious bursal disease virus (IBDV)-positive, and standard negative chicken serum, were all obtained from the CVCC. A total of 277 clinical serum samples were collected from poultry farms in three different provinces of China, including 126 from Shanghai, 78 from Shandong and 73 from Guangdong.

Bioinformatics analysis

The amino acid and nucleotide sequences of MSLP53 (VY93_02170) protein from MSWVU₁₈₅₃ (GenBank accession no: CP011096.1) were retrieved from the National Center for Biotechnology Information (NCBI) database and were used to conduct online BLASTp searches (https://blast.ncbi.nlm.nih.gov/Blast.cgi) against non-redundant protein sequences (nr) database. The theoretical isoelectric point (pI) and molecular weight (Mw) of the MSLP53 protein were calculated by Compute pI/Mw tool in Expasy (https://web.expasy.org/compute_pi/). The functional domains analysis of MSLP53 was using Prosite online software (https://prosite.expasy.org/cgi-bin/prosite/).

Cloning and expression

The MS strain WVU₁₈₅₃ was obtained from the China Veterinary Culture Collection Center (CVCC, Beijing, China) and was grown in Modified Frey medium (BD, USA) supplemented with 0.01% NAD (Roche, Shanghai, China) and 10% porcine serum (Gibco, Carlsbad, CA, USA) at 37 °C in an atmosphere of 5% CO₂. The lp53 gene of MS (MSlp53) was cloned from the MSWVU₁₈₅₃ genome DNA with overlapping PCR. To circumvent the specific translational barrier of the TGA codon of mycoplasma in E. coli, the site-directed mutagenesis was conducted by overlapping PCR [39] to alter the TGA codon into TGG with 5 pairs of primer (Table 5). The full-length of MSlp53 gene with the TGA to TGG modification at four sites was cloned into pCold I to generate the recombinant plasmid pCold I-MSlp53. The plasmid pCold I-MSlp53 was transformed into E. coli strain BL21 (DE3), and the recombinant MSLP53 (rMSLP53) protein was then expressed with 0.5 mM IPTG induction at 16 °C, 110 rpm for 24 h. At last, the rMSLP53 protein was purified with BeaverBeads™ His protein purification kit (Beaver, Suzhou, China), and was analyzed with 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and coomassie brilliant blue staining.

Table 5.

Primers used for PCR amplification of MSlp53 gene

Primers	Sequence (5´→3´)	sizes
MSlp53 1 F	GGATCCATGAAAAAATTTGAATTTTTACTAC	329 bp
MSlp53 1R	GCACCCCATTTACCCGTCCA
MSlp53 2 F	TGGACGGGTAAATGGGGTGC	587 bp
MSlp53 2R	GATGCAGGCCATTTGTCGTATTTT
MSlp53 3 F	AATACGACAAATGGCCTGCATCTAC	374 bp
MSlp53 3R	CGTTAAGTGCCCATTGCCAGC
MSlp53 4 F	TTAAGCTGGCAATGGGCACTTAAC	56 bp
MSlp53 4R	GATCTTTAGCAGGGTTTGCCCATAA
MSlp53 5 F	TTATTATGGGCAAACCCTGCTAAAG	258 bp
MSlp53 5R	GAATTCCTATTTTTTAGTTGCTGCAAGC

Note: the restriction enzyme sites of BamH I (GGATCC) and EcoR I (GAATTC) were underlined; the mutated nucleotides were in bold

Immunoblot analysis of rMSLP53

The immunoreactivity and specificity analysis of rMSLP53 were evaluated by immunoblot assays. A total of 6.5 µg of purified rMSLP53 protein was divided into 13 portions and were subjected to 10% SDS-PAGE at a dose of 0.5 µg/lane. The 13 SDS-PAGE gels were transferred to NC membranes and blocked with 5% (w/v) no-fat milk in PBST (PBS buffer containing 0.05% Tween-20) at 4 °C overnight. After that, the membranes were individually incubated with positive chicken sera (1:500 diluted in PBST) of different avian pathogens at 37 °C for 1 h on a plate shaker. To assess the immunoreactivity of MSLP53 protein, the positive chicken sera against different MS strains (MS WVU₁₈₅₃, JS1, SD1, SH1 and HB1) were used. For specificity analysis, the positive chicken sera against different MG strains (MG R_low, 013, 08, FBH, SGN, SS), standard MG-positive chicken serum, MI, SPG-positive, Escherichia coliO1/O2/O78-positive, NDV-positive, IBV-positive and IBDV-positive sera were used. The standard MS-positive and MS-negative chicken sera were used as positive and negative control respectively. Then the membranes were washed three times with PBST and incubated with HRP-conjugated goat anti-chicken IgY antibody (1:20 000; Abcam, UK) at room temperature at 37 °C for 30 min. After washing four times with PBST, the membranes were stained with an ECL chromogenic kit (Thermo, USA) and scanned using a multifunctional imaging system (Tanon 5200, China).

Establishment of an indirect ELISA assay

Conventional indirect ELISA was performed as published by Wang et al. [36] with some modifications. The 96-wells ELISA plates (Corning, USA) were coated with rMSLP53 protein in 100 µL of 0.05 M carbonate-bicarbonate buffer (pH = 9.6) at 37°C for 2 h. The plates were then washed three times with PBST and blocked with 5% (w/v) no-fat milk in PBST (200 µL/well) for 2 h at 37°C. After washing three times, the plates were incubated with chicken sera to be checked (diluted in PBST, 100 µL/well) at 37°C for 1.5 h. After four washes, HRP-goat anti-chicken IgY antibody (diluted in PBST; Abcam) was added to the plates and incubated at 37°C for 1 h. Plates were thoroughly washed and reacted with 100 µL of 3,3’,5,5’-Tetramethyl benzidine (TMB) substrate solution at 37 °C for 15 min in complete darkness. The color reaction was stopped by the addition of 50 µL of 2 M H₂SO₄ to each well. Finally, the OD_450nm values were measured and recorded immediately using a multi-mode microplate reader (Synergy H1; BioTek, USA).

A checkerboard titration was performed on 96-well ELISA microplates to optimize the conditions for detection based on the method mentioned above. To determine the best concentration of the coating protein, rMSLP53 was diluted to the following concentrations: 10.00, 5.00, 2.50, 1.25, 0.63, 0.31, and 0.16 and 0.08 µg/mL. The standard MS-positive and MS-negative serum were diluted 1:200 and 1:500. The HRP-goat anti-chicken IgY antibody (100 µL/well) was optimized with different dilutions (1:10 000, 1: 20 000, 1:40 000, or 1:60 000) by PBST. The OD_450nm value of standard MS-positive value (P) was around 1.0, and the standard negative value (N) was less than 0.2, resulting in a maximum ratio of P and N (P/N) of no less than 2.1, which was regarded to be the best reaction circumstances [40].

Clinical serum samples test

A total of 277 clinical serum samples from poultry farms in three different provinces in China (including Shanghai, Shandong and Guangdong) were examined in parallel, comparing a MS antibody test kit (IDEXX) and the newly developed rMSLP53-based ELISA. The cut-off value indicative of optimal sensitivity and specificity of the rMSLP53-based indirect ELISA were evaluated by receiver operating characteristic (ROC) analysis using GraphPad Prism 6.

Detection of MS antibody levels change in MS-infected chicken

The rMSLP53-based ELISA assay was also used to evaluate the development of antibodies in chickens after infected by MS. A total of 16 3-week-old SPF chickens were purchased from Zhejiang Hengda Agricultural Development Co., Ltd., China, and divided into two groups. The MS WVU₁₈₅₃ were cultivated to late logarithmic growth stage, collected by centrifugation at 8000 g for 10 min, resuspended with PBS, and then were used for tracheal challenge to eight SPF chickens at the dose of 1 × 10⁶ color change units (CCUs) per chicken. The remaining 8 SPF chickens were tracheal challenged with equal volume PBS. After challenge, the chicken sera were collected at 1, 2, 3, 4, 6, 9, 12, 15, 18 weeks and then preserved at -40 ℃. The MS-infected sera were detected by rMSLP53-based ELISA and compared with the IDEXX kit.

Specificity and sensitivity test

The rMSLP53-based ELISA method described above was used to simultaneously detect the OD_450nm values of chicken sera (1:500) positive for different MS isolates (WVU₁₈₅₃, JS1, SD1, SH1, and HB1), different MG isolates (R_low, 013, 08, FBH, SGN, SS), and other avian pathogens including MI, SPG, E.coli O1/O2/O78, NDV, IBV, and IBDV. The standard MS-positive and MS-negative sera (1:500) were served as the positive and negative controls. Five MS-infected serum samples were serially diluted in a 2-fold series from 1: 50 to 1: 102,400 and conducted by the indirect ELISA procedures to determine sensitivity. The results were compared with those from IDEXX MS antibody test kit.

Statistical analysis

The optimal cut-off value for the rMSLP53-based indirect ELISA, balancing sensitivity and specificity, was determined through ROC analysis using GraphPad Prism 6. The AUC serves as an indicator of a test’s capacity to accurately differentiate between individual samples. An AUC of 1.0 indicates perfect diagnostic performance, while a value of ≤ 0.5 suggests that the test lacks meaningful diagnostic utility [41]. The optimal cut-off value was identified as the point on the ROC curve nearest to the top-left corner, as this point equally maximizes sensitivity and specificity, thus maximizing the Youden’ Index (calculated as sensitivity + specificity − 1) [42].

Electronic supplementary material

Below is the link to the electronic supplementary material.

Abbreviations

ELISA

Enzyme-linked immunosorbent assay

MS

Mycoplasma synoviae

rMSLP53

Recombinant LP53 from MS

MG

Mycoplasma gallisepticum

MI

Mycoplasma iowae

E. coli

Escherichia coli

SPG

Salmonella pullorum/gallinarum

NDV

Newcastle disease virus

IBV

Avian infectious bronchitis virus

IBDV

Infectious bursal disease virus

SPA

Serum plate agglutination

HI

Haemagglutination inhibition

pI

Isoelectric point

Mw

Molecular weight

PCR

Polymerase chain reaction

IPTG

β-D-1-thiogalactopyranoside

ROC

Operating characteristic

AUC

Area under the ROC curve

SDS-PAGE

Sodium dodecyl sulfate polyacrylamide gel electrophoresis

HRP

Horseradish peroxidase

ECL

Enhanced chemiluminescence

TMB

3,3’,5,5’-Tetramethyl benzidine

NC

Nitrocellulose filter

SPF

Specific pathogen free

CCU

Color change unit

PBS

Phosphate buffer saline

OD

Optical density

NAD

Nicotinamide adenine dinucleotide

Author contributions

HRL and ZJH performed most of the experiments and drafted the manuscript. YW participated in the cloning and expression of rMSLP53 protein. WGJ contributed in experiment design and manuscript revision. SHW, MXT and YQB helped to revise the manuscript. JJQ and SQY conceived the study, designed the experiment, revised and finalized the manuscript. All authors read and approved the final manuscript.

Funding

This research was supported by the National Key Research and Development Program of China (2023YFD1800602) and National Natural Science Foundation of China (31902244).

Data availability

No datasets were generated or analysed during the current study.

Declarations

Ethics approval and consent to participate

The animal experiments were performed in strict accordance with the guidelines of the Care and Use of Laboratory Animals of Shanghai Veterinary Research Institute, the Chinese Academy of Agricultural Sciences (CAAS). All animal experimental procedures were approved by the Committee on the Ethics of Animal Experiments of Shanghai Veterinary Research Institute, CAAS (Permit Number: SHVRI-SZ-20200430-01). The clinical chicken serum samples used in our study were collected by the permission of the poultry farm owners in Shanghai, Shandong and Guangdong. The study was carried out in compliance with the ARRIVE guidelines.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.