Astragalus polysaccharide protects against cardiac injury in a tnnt2a mutant zebrafish model of dilated cardiomyopathy

Abstract

Background

Dilated cardiomyopathy (DCM) is a severe and irreversible heart disease characterized by dilated ventricles and decreased myocardial function. DCM has a poor prognosis and a very low survival rate, with a 5-year mortality rate ranging from 15 to 50%, and is an important cause of sudden cardiac death and heart failure. Genetic factors play important roles in the pathogenesis of DCM. Mutations in the cardiac troponin T (tnnt2) gene represent an important subset of known pathogenic variants that bind to DCM. However, few specific drugs are currently available to treat DCM caused by these gene mutations. Astragalus polysaccharide (APS), the main active ingredient of Astragalus mongholicus Bunge (Huangqi), is widely used in China to treat cardiovascular diseases, including DCM. This study explored drugs for the treatment of DCM caused by tnnt2a mutation and revealed the protective effect of APS on tnnt2a-mutant dilated cardiomyopathy.

Methods

The tnnt2a^−/− mutant zebrafish were used as a DCM model for comparison with the APS-treated group. The survival rate and the sinus venosus‒bulbus arteriosus (SV‒BA) distance were used to observe changes in cardiac output. Histopathological changes were observed via hematoxylin and eosin (HE) staining and TUNEL staining. The transcriptomes of the zebrafish in the DCM group and APS-treated group were investigated via RNA-seq. qRT‒PCR detection of apoptosis-related gene expression.

Results

We found that APS markedly increased the heart rate and ATP content, and significantly inhibited the level of cardiac tissue edema, which are essential for improving the survival rate of tnnt2a^−/−. Furthermore, APS modulates key muscle fiber-related genes (including ttnb and myom3) and significantly impacts multiple signaling pathways, including Rap1, PI3K-Akt, Jak-STAT, and Wnt signaling. The qRT‒PCR results revealed that APS decreased the expression of bax, caspase-3, and caspase-9 but increased the expression of bcl-2 in DCM zebrafish.

Conclusions

Our findings suggest that APS can improve the survival rate in dilated cardiomyopathy and has a positive protective effect on the myocardium in the tnnt2a mutant zebrafish model of DCM.

Introduction

Dilated cardiomyopathy (DCM) is a primary myocardial disease, characterized by enlargement of the left ventricle or both ventricles, accompanied by impaired systolic function, as evidenced by reduced contractility [1]. DCM has a poor survival rate, with a 5-year mortality rate of 15% to 50%, leading to a high risk of heart failure and sudden cardiac death (SCD) [2, 3].

Genetic variants that can be transmitted from one generation to another can significantly contribute to familial or sporadic hereditary DCM. Genetic testing is crucial for risk stratification, treatment decision-making, and family screening [4, 5]. Genetic screening of some Chinese patients with DCM revealed that the deletion of cardiac troponin T (tnnt2) may be one of the causative factors [6, 7]. It has been reported that the variation in TNNT2 is related to the high tendency for life-threatening cardiomyopathy in childhood and youth [8].

The current models of dilated cardiomyopathy are mostly drug-induced, such as doxorubicin [9] and furazolidone [10], which are insufficient to reflect all the causes of dilated cardiomyopathy. Additionally, transgenic mammalian DCM models are often laborious and costly. As a novel cardiovascular disease animal model, zebrafish exhibit excellent transparency, enabling effective evaluation of drug toxicity and efficacy, and facilitating high-throughput drug screening. Therefore, we used CRISPR/Cas9 technology to obtain tnnt2a knockout mutant zebrafish [11]. Homozygous mutant zebrafish (Tg:tnnt2a^−/−) exhibit phenotypes such as cardiac dilatation and asystole [12]. The tnnt2 mutant zebrafish is highly convenient and predictive for high-throughput in vivo efficacy assessment and screening of therapeutic drugs for DCM. Most importantly, the tnnt2a^−/− mutant zebrafish model represents a readily available and innovative DCM model.

At present, dilated cardiomyopathy of all ages is inseparable from genetic factors, and treatment often lacks specificity [13]. The dried root of Astragalus mongholicus Bunge (Huangqi) is a traditional herbal medicine widely employed in the clinical management of DCM. It has been shown to enhance myocardial contractility and improve hemorheological properties [14]. A comprehensive network meta-analysis indicated that the combination of Huangqi injection with conventional Western medicine is associated with the highest likelihood of being the optimal intervention for augmenting the left ventricular ejection fraction (LVEF) in patients with DCM with heart failure [15]. Polysaccharides from Huangqi are a class of macromolecules that have strong anti-inflammatory and anti-atherosclerotic effects and have extensive pharmacological effects in the treatment of cardiac disease [16, 17]. Studies have shown that APS attenuates cardiac hypertrophy and improves cardiac hemodynamics in rats [18]. Moreover, APS protects against CVB3-induced myocardial damage and inflammation, which may be partly attributed to the regulation of the TLR-4/NF-κB p65 signaling pathway [19]. In addition, APS inhibits the TNFα-induced expression of adhesion molecules in HUVECs by disrupting NF-κB signaling and suppressing the generation of reactive oxygen species (ROS) [20]. These findings indicate that APS may exert a protective effect in the early stages of DCM by attenuating the inflammatory response [21].

Therefore, in this study, we used tnnt2a mutant zebrafish as a model of dilated cardiomyopathy to investigate the cardioprotective effect of APS on DCM.

Materials and methods

Materials and reagents

APS (LOT: C18M6Y1) was purchased from Shanghai Yuanye Biotechnology (China). Doxycycline (DOX), N-phenylthiourea (PTU), and TRIzol were purchased from Sigma‒Aldrich (America). The HE staining kit, One Step TdT-Mediated dUTP Nick End Labeling (TUNEL) Apoptosis Assay Kit, and 4,6-diamidino-2-phenylindole (DAPI) staining solution were purchased from Beyotime (China).

Zebrafish husbandry and reproduction

AB strain zebrafish(Danio rerio), Tg (cmlc2:EGFP) transgenic zebrafish and tnnt2a mutant zebrafish were used in the experiments. The mutant lines were a gift from Fudan University. Adult zebrafish were maintained under a 14 h light/10 h dark cycle at 28.5 °C with a recirculating aquaculture system. All animal experiments were performed according to European guidelines and in accordance with the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals.

Zebrafish toxicity analysis of APS

Tg (cmlc2:EGFP) 3dpf transgenic zebrafish were treated with different dosages of APS for 48 h, and the safe dosage of APS was determined by observing the morphology and heart rate of the zebrafish.

Zebrafish DCM model

We previously generated tnnt2a mutant zebrafish via CRISPR/Cas9 technology [11]. The tnnt2a^−/− zebrafish were acquired and phenotypically analyzed, as shown in Fig. 1. Genotyping was performed via PCR sequencing.

Fig. 1.

Acquisition and phenotypic analysis of tnnt2a^−/− zebrafish. A Model 1 is the tnnt2a^−/− homozygous juveniles produced by self-crossing of tnnt2a heterozygotes. Nevertheless, the homozygous mutant model used in this study has only a 25% probability of being obtained through self-crossing, and it exhibits a high mortality rate. To address these limitations, we employed the Tg:Tnnt2a^−/− transgenic zebrafish model (referred to as Model 2) in our study. This model features a recovered heartbeat after the addition of DOX, allowing for more reliable and sustainable experimental conditions. B Representative images of lateral view of AB and tnnt2a^−/− zebrafish. At 2 dpf, the tnnt2a^ex10Δ2 ( tnnt2a^−/−) exhibits a phenotype reminiscent of dilated cardiomyopathy, characterized by cardiac arrest and enlargement of both the atrium and ventricle. Concurrently, mutant zebrafish display significant pericardial effusion, a hallmark of heart failure, at approximately 3 dpf

tnnt2a Genotyping Primer Forward: 5’-gtaagcgcatggagaaggac-3’,

tnnt2a Genotyping Primer Reversed: 5’-gcgacatcacagagccaaat-3’.

The detailed procedures for establishing zebrafish DCM models are described below, with the schematic representation of the study model provided in Fig. 2. 

Fig. 2.

Phenotypic differences between model 1 and model 2

1. The tnnt2a^−/− DCM model (Model 1): Homozygous zebrafish (tnnt2a^−/−) were obtained by intracrossing tnnt2a^+/- heterozygous individuals.

2. tnnt2a^−/− + DOX DCM model (Model 2): This model was generated by administering DOX to homozygous mutant zebrafish (tnnt2a^−/−), thereby inducing partial recovery of cardiac function.

The homozygous tnnt2a^ex10Δ2 (tnnt2a^−/−) mutant zebrafish embryos were selected at 3 dpf, and the bodies were placed into 6-well plates (30 embryos per well). The normal control group was incubated with E3 medium. The APS-treated groups were treated with 15 μg/ml APS for 48 h. Three replicate wells were used for each group. The media of all the treatment groups were changed every 24 h.

Morphological observation of zebrafish

After treatment for 48 h with APS, the zebrafish were visually tracked from microplates and observed for viability, heart rate, and cardiac dilatation under a fluorescence microscope (Olympus IX81 Motorized Inverted Microscope, Japan) equipped with a digital camera (DP controller, Soft Imaging System, Olympus).

Terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL)

Zebrafish embryos from each experimental group were collected at specified developmental stages. Cardiac tissues were carefully dissected under a stereomicroscope (Leica M205 FA, Germany) and fixed in 4% paraformaldehyde at 4°C overnight. After three washes with PBST, the samples were incubated with the TUNEL reaction mixture in a light-protected humidified chamber at 37°C for 12 h. The nuclei were counterstained with DAPI for 10 min at room temperature. Following extensive washing with PBST, the samples were mounted with a glycerol gradient (20%, 50%, and 70%) and covered with glass coverslips. Fluorescence imaging was performed via a confocal laser scanning microscope (Zeiss LSM 880, Germany). DAPI staining was visualized in the blue channel, while TUNEL-positive cells were detected in the red channel.

RNA-seq and bioinformatics analysis

Total RNA was extracted from zebrafish samples via TRIzol reagent and sequenced on the Illumina HiSeq 2000 platform. Raw data in FASTQ format were processed via Cuffdiff (v2.2.1) for differential expression analysis. Differentially expressed genes (DEGs) were identified using a threshold of absolute log2-fold change (|log2FC|) > 1 and adjusted p value (padj) < 0.001 for statistical significance. Functional enrichment analysis of DEGs was performed via the Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) databases. Significantly enriched terms and pathways were identified with a threshold of padj < 0.05.

qRT‒PCR

Total RNA was extracted from zebrafish embryos via a TRIzol kit according to the manufacturer's protocol, and 1 μg of RNA was reverse-transcribed into cDNA. qRT‒PCR was performed on a StepOne Plus system using SYBR Green Master Mix. The reactions were run in triplicate under standard cycling conditions (95 °C for 10 min, 40 cycles of 95 °C for 15 s and 60 °C for 1 min). Relative mRNA levels were calculated via the 2 − ΔΔCt method. The primers for Bax, Bcl-2, Caspase-3, Caspase-9, and β-actin are shown in Table 1.

Table 1.

Primer sequence information in this study

Genes	Primer sequence (5'to3')
bax	Forward	CGGAGATGAGCTGGATGGAA
	Reverse	CAAGGCGACAGGCAAAGTAG
bcl-2	Forward	TGTGCGTGGAAAGCGTCAA
	Reverse	GTCTCTCTGCTGACCGTACAT
caspase-3	Forward	CCCAGTGGAGGCAGATTTCC
	Reverse	GAGCATTGAGACGATGCAGG
caspase-9	Forward	TAAATGACCGCAAGGGCTCC
	Reverse	GCCTCAGTGCCATGTGAAAG
β-actin	Forward	TTGACAACGGCTCCGGTATG
	Reverse	TCCCATGCCAACCATCACTC

Data analysis

All the results are expressed as the means ± standard deviations (SDs). The survival rates were compared via the Cox Mantel test. One-way ANOVA was used for comparisons between multiple groups, and the least significant difference (LSD) test was used for comparisons between two groups via GraphPad Prism 6.0 software. Values of p < 0.05 were considered to indicate statistical significance.

Results

Toxicity analysis of Astragalus polysaccharide in zebrafish

Severe cardiovascular toxicity, manifested as pericardial edema, bradycardia, or the absence of blood circulation, was observed in DCM zebrafish treated with APS across all tested concentrations (2.5 μg/ml, 5 μg/ml, 10 μg/ml, 15 μg/ml, and 20 μg/ml). As presented in Table 2, no observable toxicity or mortality was detected in DCM zebrafish when the APS concentration was maintained at or below 15 μg/ml, demonstrating that APS concentrations under 15 μg/ml are safe for treating DCM in zebrafish.

Table 2.

Toxicity analysis of APS in zebrafish (n = 30)

Group	Concentration of APS (μg/mL)	Number of deaths (tail)	Mortality (%)
Normal control		0	0
Model control		0	0
APS	2.5	0	0
	5	0	0
	10	0	0
	15	0	0
	20	30	100

Astragalus polysaccharide improves the survival rate and morphology of DCM zebrafish

Compared with that of the zebrafish in the DCM model 1 group, the survival rate of the zebrafish after APS treatment was significantly greater. Specifically, some of the zebrafish in the Model 1 and Model 2 groups presented a marked reduction in survival rate at 5 dpf. In contrast, after APS intervention, the survival rate of the zebrafish increased (Fig. 3A). We investigated whether the rise of the survival rate is consistent with cardic output in DCM zebrafish model systems. We found that the heart rate of the DCM zebrafish in the APS treatment group was significantly increased (P < 0.01). (Fig. 3B). APS can increase ATP content (Fig. 3C), thereby increasing cardiac energy reserves, increasing cardiac output, and thus improving the survival rate. After treatment with APS, the embryos presented an enlarged heart, and the degree of tissue edema decreased (Fig. 3D). To confirm the ventricular dilatation of the zebrafish in each group, we measured the distance of the arterial bulbar sinus (SV-BA), and the SV-BA of the zebrafish in both model groups increased (Fig. 3E-F). These results indicate that increasing the survival time of Astragalus polysaccharide may be necessary for increased heart contraction and increased cardiac output.

Fig. 3.

APS improves the cardiac function of DCM zebrafish. A The survival rates of zebrafish in each group, n = 30. B The heart rate of zebrafish after APS administration. Data are mean ± SD ( n = 10; ^△P < 0.01, compared with control; ^☆P < 0.01, compared with the model 2). C Effects of APS on the ATP of zebrafish in model groups. ( n = 10; ^△P < 0.01, compared with control; ^■P < 0.05, compared with model 1). D Representative images of zebrafish in each group at 4dpf. E–F. Comparison of SV-BA of zebrafish in model groups and after APS treatment. Data are mean ± SD ( n = 8; ^△P < 0.01, compared with control). The experiment was repeated three times

Astragalus polysaccharide can relieve swelling and cardiac hypertrophy in DCM zebrafish

We performed HE staining on zebrafish and found that compared with the control zebrafish, the model zebrafish presented tissue edema, disordered arrangement, enlarged cell space, and significantly larger hearts. APS treatment revealed that zebrafish cardiomyocytes were more tightly packed and that cardiac tissue edema was reduced (Fig. 4).

Fig. 4.

APS reduces swelling to protect myocardial cells from injury on DCM Zebrafish. H&E staining of the heart area in zebrafish

Astragalus polysaccharide interferes with transcriptome sequencing in DCM zebrafish

To further understand the molecular mechanism of APS cardioprotection, we analyzed changes in gene expression levels in zebrafish after APS treatment by transcriptomic techniques.

Subsequently, using RNA sequencing, we explored the functional annotation of different genes in cardiomyocytes using Gene Ontology (GO) enrichment analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis. The DEGs were significantly involved in biological process (GO: BP), including cardiac muscle fiber development, and cardiac muscle tissue morphogenesis. The DEGs were enriched in the cellular component (GO: CC) category and included mitochondrial outer membrane translocase, and myosin. DEGs were included in the molecular function (GO: MF) category, which included modulation of ATPase activity, and G-protein coupled serotonin receptor activity (Fig. 5A, B, C). Additionally, the DEGs associated with APS intervention significantly participated in dilated cardiomyopathy, the MAPK signaling pathway, the TGF-β signaling pathway, the Rap1 signaling pathway, the PI3K-Akt signaling pathway, the Jak-STAT signaling pathway, and the ErbB signaling pathway (Fig. 5D). In some cases, the related genes and regulated transcription factors involved in the Rap1 signaling pathway are fgf11b, ephb2a, sipa1, and rapgef5b; those associated with the MAPK signaling pathway are sbno2a and hsp70. Our work also revealed that nfkb1 and fhad1 are involved in the NF-κB pathway and that chico, fosl1, and fmnl2 are related to the Wnt pathway.

Fig. 5.

Bioconductor database-enriched pathways and GO entries. A GO enrichment entries in the top 20 about the biological process (BP). B GO enrichment entries in the top 20 about cellular component (CC). C GO enrichment entries in the top 20 about molecular function (MF). D KEGG enrichment entries in the top 20 (p < 0.05). The color of the bubble represents the value of p, and the size of the bubble represents the count of relative entries

Astragalus polysaccharide can inhibit apoptosis in DCM zebrafish

We used TUNEL staining to observe the nuclei and apoptosis of dissected zebrafish hearts and the apoptosis of zebrafish hearts after drug administration. In the control group, the zebrafish presented a normal heart outline, closely packed cells, and fewer apoptotic cells. The atria and ventricles of zebrafish in both the Model 1 group and Model 2 group were significantly enlarged, the number of cells decreased, and the number of apoptotic cells increased. Moreover, the cells in the model group were sparse, and the nuclei became larger. After APS intervention, the number of apoptotic cells was lower than that in the model group, and the atria and ventricles were still enlarged (Fig. 6).

Fig. 6.

Effects of APS on the cardiomyocytes apoptosis of zebrafish in model groups. TUNEL staining of zebrafish hearts showing the apoptotic cells (red indicates apoptotic cells and blue indicates nuclei)

In addition, APS inhibited apoptosis and regulated the expression of key apoptotic proteins, including B-cell lymphoma-2 (Bcl-2) and Bcl-2-associated X protein (Bax) and caspase-3 and -9. Notably, the mRNA expression of Bax, Caspase-3, and Caspase-9 in APS-treated zebrafish significantly decreased, but the mRNA expression of Bcl-2 increased. (Fig. 7).

Fig. 7.

Comparison of mRNA expression of Bax, Bcl-2, caspase-3 and caspase-9 of DCM zebrafish treated with APS. Data are presented as mean ± SD. n = 30. ^△P < 0.01, Compared with control; ^□P < 0.01, compared with model 1; ^☆P < 0.01, compared with model 2; ^★P < 0.05,compared with model 2

Discussion

Dilated cardiomyopathy is one of the most common causes of chronic heart failure. The main clinical manifestations of dilated cardiomyopathy are low ejection fraction values, progressive heart failure, malignant arrhythmias, cardiogenic shock and sudden death, which can occur at any stage of disease progression [22]. Familial DCM accounts for approximately 20%-50% of all cases, and more than 50 gene mutations have been confirmed to cause DCM [23].

Evaluating the genetic and clinical evidence of DCM revealed that mutations in 12 genes, including MYH7, LMNA, BAG3, tnnt2, TNNC1, and PLN, were significantly enriched in specific patient subgroups. Mutations in these genes may account for the majority of DCM patients [24]. The sarcomere is the target of mutations in cardiomyopathy [25]. Mutations in the gene encoding cTnT, TNNT2, are significantly correlated with DCM [26]. Genetic screening of some Chinese DCM patients revealed that the deletion of tnnt2 may be one of the causes. The variation in TNNT2 is reportedly related to the high tendency for life-threatening cardiomyopathy.

However, there are no Tnnt2a mutant mice or rat models. We previously reported that tnnt2a^−/− mutated zebrafish presented phenotypes such as cardiac dilatation and asystole, which are similar to the clinical symptoms of patients with clinical DCM. Our results revealed that compared with normal controls, tnnt2a^−/− zebrafish presented distinct DCM phenotypes, such as cardiac enlargement and venous congestion. We confirmed the presence of ventricular dilation in this model zebrafish by measuring the SV‒BA distance. Specifically, some of the zebrafish in the Model 1 and Model 2 groups died at 5 dpf, the survival rate decreased significantly, the heart rate in the Model 2 group decreased, and the SV-BA of the zebrafish in both model groups increased. The zebrafish in the model group became wider overall, with tissue edema, disordered arrangement, relaxation of muscle fibers, enlarged intercellular spaces, and an enlarged heart. These data demonstrate that the DCM zebrafish model is successfully replicated and can serve as a reproducible, replaceable, simple, and novel experimental animal model for DCM.

As we know, dilated cardiomyopathy is caused by a genetic defect, and there are currently no specific drugs for the treatment of this disease. This study is the first to explore drugs for the treatment of tnnt2a mutant DCM. In addition, we also used this model to study the effectiveness of the traditional Chinese medicinal compound Kuoxinfang and its sovereign drug Astragalus mongholicus Bunge(Huangqi), and found that it has a certain effect on the treatment of cardiomyopathy. Astragalus polysaccharide (APS) is an important active ingredient extracted from Huangqi, and has been widely used in the treatment of cardiovascular diseases [27].

In this study, we used tnnt2a^−/− mutant zebrafish to demonstrate that the cardioprotective effects of APS may be associated with a reduction in cardiomyocyte apoptosis. We determined the maximum tolerated concentration (MTC) of APS in zebrafish prior to the intervention study of APS. As a result,our data showed that zebrafish can tolerate it at a concentration of 15 μg/ml.

DCM is one of the leading causes of heart failure, and survival is poor [28]. Therefore, relieving patients' symptoms and increasing survival time are the overall goals of DCM treatment. Our findings show that APS has certain efficacy in reducing mortality and improving symptoms when used to treat DCM zebrafish, which to a certain extent provides new ideas for clinical treatment. In addition, APS can significantly reduce the enlargement of DCM zebrafish hearts and venous congestion areas and can increase ATP content, cardiac bleeding volume, and blood flow velocity, and improve heart rate. Our work provides clues for the treatment of DCM, but more research is needed for further confirmation.

Apoptosis is one of the mechanisms leading to cardiomyocyte injury [29]. The reduction in cardiomyocyte number and insufficient compensation of residual cardiomyocyte systolic function caused by apoptosis are important factors promoting the deterioration of left ventricular dysfunction and ventricular remodeling in DCM heart failure patients [30]. Bax and Bcl-2 are endogenous mitochondrial apoptosis-related proteins [31]. The caspase family mediates the apoptotic process mainly through the mitochondrial pathway and the membrane death receptor pathway, and is another key factor in signal transduction during apoptosis process. As the upstream initiating factor of the Bcl-2 family, caspase-9 can activate the apoptosis executive factor caspase-3, induce the disappearance of the mitochondrial membrane potential, change mitochondrial permeability, cause nucleic acid breakage, and ultimately lead to apoptosis [32]. APS protects the heart by inhibiting apoptosis and inflammation. Mechanistically, it downregulates caspase-3, caspase-9 and Bax and increases Bcl-2 protein levels in zebrafish. In this study, TUNEL staining revealed that the myocardial injury of the zebrafish in the model group was closely related to apoptosis and that Astragalus polysaccharide could reduce the degree of apoptosis in the zebrafish.

Conclusion

Our findings suggest that APS has a positive effect on cardioprotection in the tnnt2 mutant zebrafish model of DCM, which is dependent on the inhibition of cell apoptosis. These findings may provide new ideas for the treatment of dilated cardiomyopathy with gene mutation.

Abbreviations

APS

Astragalus polysaccharide

Bax

Bcl-2 Associated X

Bcl-2

B-cell lymphoma2

DCM

Dilated cardiomyopathy

DEGs

Differentially Expressed Genes

GO

Gene Ontology

KEGG

Kyoto Encyclopedia of Genes and Genomes

LVEF

Left ventricular ejection fraction

MTC

Maximum tolerated concentration

ROS

Reactive oxygen species

SCD

Sudden cardiac death

SV-BA

Sinus venosus-bulbus arteriosus

TCM

Traditional Chinese medicine

TNNT2

Troponin T2

Authors’ contributions

XW and YhW conceived and designed the experiments. CZ, HZ, LpP, and YdD performed the experiments. CZ and QW analyzed the data. CZ and HZ wrote the manuscript. XW, YjX and YhW critically revised the manuscript.

Funding

This study is supported by the National Natural Science Foundation (81873264, 82004319, and 82205073), the Shanghai Municipal Health Commission, Excellent youth talent training program (2022YQ040), and the Science and Technology Commission of Shanghai Municipality (22Y11922000).

Data availability

The RNA-seq data are publicly available at the NCBI SRA (http://www.ncbi.nlm.nih.gov/bioproject), with the accession number PRJNA1018267.

Declarations

Ethics approval and consent to participate

Ethical approval (PZSHUTCM210813008) for the animal experiments was granted by the Animal Research Ethics Committee of Shanghai University of Traditional Chinese Medicine.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.