Abstract
Obesity-associated metabolic disorders such as type 2 diabetes mellitus and metabolic dysfunction associated fatty liver disease are major global health concerns, yet current pharmacological treatments often present with major side-effects. Dietary interventions including polyphenol-rich foods offer a promising complementary option for obesity amelioration, but their efficacy is dependent on specific gut microbial metabolism and the underlying molecular mechanisms mostly remain elusive. Here, we demonstrated that dietary elderberry (Eld) extract abrogates the effects of an obesogenic diet in a gut microbiota-dependent manner, by preventing insulin resistance and reducing hepatic steatosis in mice. We developed a targeted, quantitative liquid chromatography-tandem mass spectrometry method for detection of gut bacterial polyphenol catabolites and identified hydrocinnamic acid as a key microbial metabolite, enriched in the portal vein plasma of Eld supplemented animals. Next, we showed that hydrocinnamic acid potently activates hepatic AMP-activated protein kinase α, explaining its role in improved liver lipid homeostasis. Furthermore, we uncovered the metabolic pathway cumulating in hydrocinnamic acid production in the common gut commensal Clostridium sporogenes. Our characterization of hydrocinnamic acid as a diet-derived, and microbiota-dependent metabolite with insulin-sensitizing and anti-steatotic activities will contribute to microbiome-targeted dietary interventions to prevent and treat obesity-associated metabolic diseases.
Keywords: gut microbiome, obesity, insulin resistance, hepatic steatosis, hydrocinnamic acid, MAFLD, type 2 diabetes
Introduction:
Obesity-associated metabolic disorders continue to increase in both incidence and severity, posing a challenge for our healthcare system1. Obesity initiates a sequence of metabolic disturbances, beginning with impaired glucose metabolism, which leads to hyperglycemia and subsequent hyperinsulinemia, the hallmark indicators of prediabetes2. If left untreated, prediabetes progresses with the development of insulin resistance due to the loss of a glucose-stimulated acute insulin response. The resulting increased demand on insulin-producing pancreatic β-cells results in their dysfunction, eventually developing into type 2 diabetes mellitus (T2DM)3. Furthermore, obesity is closely associated with an elevated risk of metabolic dysfunction-associated fatty liver disease (MAFLD), primarily due to an imbalance between hepatic fatty acid uptake from plasma and de novo fatty acid synthesis, as well as fatty acid export as triglycerides within very-low-density lipoproteins (VLDL). This imbalance leads to lipid accumulation in hepatocytes, contributing to hepatic steatosis4.
Sex significantly influences several aspects of susceptibility to, and progression of obesity-related metabolic diseases. Specifically, men exhibit a higher propensity for obesity compared to women, which in part can be explained by enhanced adiposity when subjected to obesogenic diets5,6. Moreover, men naturally exhibit higher insulin resistance, due to lower Hexokinase II expression, which decreases glucose uptake into skeletal muscle cells7,8. Finally, premenopausal women have a lower prevalence of MAFLD, attributed to the protective effects of estrogen9,10.
The AMP-activated protein kinase (AMPK) signaling pathway provides one of the key molecular targets for obesity treatment. AMPK functions as a cellular energy sensor, activated in response to reduced intracellular ATP levels, and plays a central role in maintaining energy homeostasis across all eukaryotic cells. Activation of AMPK through the phosphorylation of the α subunit, has been shown to enhance glucose uptake, promote fatty acid oxidation, and stimulate mitochondrial biogenesis11–13. In addition, AMPK activation suppresses lipogenesis and cholesterol biosynthesis14,15. In the context of metabolic disorders, dysregulation of AMPK signaling has been consistently observed16–18. Metformin and lifestyle changes are the first-line treatment of obesity-induced T2DM19. Although metformin decreases blood glucose levels by a hepatic AMPK-dependent mechanism, it has undesirable side effects, including upper respiratory infection, abdominal distension, dizziness, and vomiting20. Sulfonylureas, GLP-1 receptor agonists, and thiazolidinediones are also used to treat T2DM, but can present with even more severe side effects such as low glucose levels, pancreatitis, bone loss, hepatotoxicity, and heart failure21.
Lifestyle changes including improved exercise regimes and dietary interventions provide alternative options for the treatment and prevention of metabolic diseases. Colorful fruits and vegetables are an important component of a healthy diet and they are rich in polyphenols, including flavonoids and other phenolic acids22–24. Despite various health benefits being attributed to polyphenol consumption, key mechanistic insights remain to be discovered as they do not reach substantial systemic concentration after ingestion in the diet or as a supplement. The enzymatic repertoire expressed by the human host is not capable of extensive polyphenol metabolism, leading to the relatively unscathed passage of these compounds throughout the gastrointestinal tract. However, there is a growing interest in the metabolic transformations catalyzed by select members of the gut microbiota, resulting in smaller bioactive metabolites that can be absorbed in the colonic epithelium and enter the bloodstream24–27.
We previously reported that the anti-steatotic effects of dietary interventions with various berry extracts as the primary source of polyphenols hinge on gut microbial metabolism28. In particular, elderberry (Eld; Sambucus nigra) is a rich source of anthocyanins, flavanols, as well as other phenolic acids29. We showed that the gut microbial end-product 4-hydroxyphenylacetic acid (4-HPAA), a monophenolic acid (MPA), was sufficient to reverse obesity-associated fatty liver disease in male mice28. In the current work, we hypothesized that polyphenol-supplemented diets require gut microbial MPA production for improving host metabolic parameters in prediabetes and MAFLD development. We used Eld as a source of polyphenols, and protocatechuic acid (PCA), a bioactive MPA, as a positive control. Additionally to addressing the role of the gut microbiota in metabolic diseases, we assessed sex-specific differences in both male and female mice. This revealed an improvement in insulin homeostasis in males and females, and a prevention of hepatic steatosis in males only. Using LC-MS/MS analysis, we identified hydrocinnamic acid (or 3-phenylpropionic acid) as a potent AMPKα agonist and demonstrated that this MPA can be formed by a gut commensal C. sporogenes from Eld extract. Our work highlights a gut microbial pathway that can be stimulated with a prebiotic intervention, contributing to the management of prediabetic and MAFLD associated pathology.
Results:
Dietary supplementation with elderberry extract reduces high fat diet-induced weight gain
To assess the impact of dietary polyphenols in the context of improving obesity-associated metabolic parameters, we used a high fat diet (HFD)-induced obesity model, in which 4-week-old mice were randomly assigned to dietary groups with ad libitum access to a HFD (negative control group) or a HFD supplemented with 1% elderberry (Eld) extract as a polyphenol source. An additional positive control group received a HFD supplemented with 1% protocatechuic acid (PCA), a well-known monophenolic acid (MPA) formed from gut bacterial polyphenol catabolism involved in modulation of metabolic disease parameters24. We analyzed both male and female mice to account for metabolic sex-differences. To address the contribution of the microbiome, we compared the aforementioned groups on regular drinking water to animals that received an antibiotic cocktail (ABX; 1 g/L neomycin, 1 g/L ampicillin and 0.5 g/L vancomycin) during the course of the 12-week experiment.
We measured body weights at weekly intervals and as expected found that male HFD control mice had the highest weight gain (Fig. 1A and B). Male weight gain was attenuated in both the Eld and PCA supplemented groups, tracking with our observations in female mice (Fig. 1C and D). These observed differences were not due to animal aversion to the flavor of the dietary additives, as both male and female mice had higher food intake on the Eld or PCA supplemented HFD diets (Fig. 1E–H). Gut microbiome depletion in HFD mice led to a decrease in weight gain, but did not significantly impact body weight in Eld or PCA supplemented animals. No significant differences were observed in overall body composition (proportions of fat mass and lean mass to total body mass) among the experimental groups in either males or females (SI Fig. S1A–S1D).
Fig. 1. Elderberry extract reduces high fat diet-induced weight gain despite an increase in food intake.
(A, C) Body weight (g) of 4-week (wk)-old male (A) and female (C) C57BL/6 mice fed a control high fat diet (HFD), or the same diet supplemented with 1% w/w elderberry extract (Eld), or 1% w/w protocatechuic acid (PCA), with regular or antibiotic (ABX) drinking water for 12 wks; n = 9–10 per group. (B, D) Mean cumulative area under the curve (AUC) for body weights after 12 wks. (E) Food intake (net food/weight/day) for all male groups after 12 wks of diet, (F) Mean cumulative area under the curve (AUC) for food intake after 12 wks. (G) Food intake (net food/weight/day) for all female mice groups after 12 wks of diet. (H) Mean cumulative area under the curve (AUC) for food intake after 12 wks. Error bars represent SEM. Statistical analysis was performed via ANOVA.
Eld supplementation improves insulin sensitivity in a microbiome-dependent manner
To evaluate glucose metabolism and homeostasis, we performed a glucose tolerance test (GTT) following a four hour fast on week 10 of the study. In male animals with an intact microbiome, blood glucose clearance was significantly improved in both the Eld and PCA groups compared to the HFD control (Fig. 2A and SI Fig. S2A), though this trend was not observed in female mice (Fig. 2C and SI Fig. S2B). This indicates that dietary supplementation with either parent polyphenols or their microbial metabolites can improve glucose metabolism in a sex-dependent manner. These sex differences in glucose tolerance and fasting blood glucose levels could be attributed to female mice generally exhibiting better glucose tolerance and being more refractory to obesity development5,30. The groups of mice that had their gut microbiota depleted by ABX overall showed a similar improvement in glucose clearance and fasting blood glucose, irrespective of their diets (Fig. 2E and 2F).
Fig. 2. Elderberry extract substantially increased insulin sensitivity, glucose homeostasis, and leptin levels.
(A-B) Glucose tolerance test (GTT) for all male and female mice groups on wk 10 following a 4 hours fast, n = 9–10 per group. (C-D) Insulin tolerance test (ITT) (mg/dL) for male and female mice groups on wk 11 following a 4 hours fast, n = 9–10 per group. (E-F) Fasting blood glucose for male and female mice following 4 hours fasting. End point male and female plasma (G-H) leptin, (I-J) GLP1. Error bars represent SEM. Statistical analysis was performed via one-way ANOVA.
One week after the GTT (11 weeks on diet), we performed insulin tolerance tests (ITT) to assess insulin sensitivity in our animals. Male mice supplemented with either Eld or PCA had significantly lower insulin resistance compared to the control animals (Fig. 2C and SI Fig. S2C). Interestingly, the effect of Eld was in part microbiome-dependent, as the Eld-ABX animals had a blood glucose response intermediate between the Eld and HFD groups. This emphasizes the importance of gut microbial metabolism in obtaining health benefits from Eld polyphenol supplementation. As anticipated, the microbiota did not have a noticeable effect on PCA supplementation. The improved insulin tolerance in Eld and PCA groups and importance of the gut microbiome for Eld metabolism replicated in female mice (Fig. 2D and SI Fig. S2D). It is of note that because of the profound insulin sensitivity effect, animals in the Eld group received glucose injections midway through the experiment to alleviate the discomfort. Overall, our findings suggest that the gut microbiota are required for metabolizing elderberry extract into bioactive metabolites that improve insulin tolerance in both male and female mice.
To further profile our animals’ metabolic state, we used a multiplex approach to measure the endpoint plasma concentration of gut active hormones. Interestingly, Male and female leptin levels in Eld treated animals were significantly higher compared to their Eld-ABX counterparts, indicating that a microbial byproduct of polyphenol metabolism may boost leptin production (Fig. 2G,H). Leptin is produced by adipose tissue and is involved in regulating energy balance by limiting appetite31. This finding is particularly interesting since we did not observe differences in fat mass (SI Fig. S1A–S1D). Glucagon-like peptide 1 (GLP-1) levels were overall higher across ABX treated groups, irrespective of their diets (Fig. 2I,J). We did not observe differences in the levels of insulin, glucagon, and peptide YY among the treatment groups (SI Fig. S2E–2J).
Eld supplementation requires an intact gut microbiome for hepatic steatosis prevention in male mice
Here, we assess the contribution of the microbiota to Eld metabolism in male and female animals. Hematoxylin and eosin (H&E)-stained liver histology slides were prepared and evaluated in a blinded manner by a board-certified pathologist. Liver sections from male Eld or PCA groups had reduced lipid accumulation compared to the HFD controls (Fig. 3A). The animals on Eld-ABX did not have a reduction in hepatic lipid droplet accumulation, emphasizing the importance of gut microbial metabolism in mediating the health benefits of dietary polyphenols. As expected, the steatosis protective effect of the monophenolic acid PCA is not significantly affected by the absence of the gut microbiota. Most notably, mice supplemented with Eld showed significant improvements in steatosis percentage (Fig. 3B), steatosis score (Fig. 3C), NAFLD activity score (Fig. 3D), and inflammation score (Fig. 3E) compared to their counterparts on Eld-ABX with an ablated gut microbiome. The female control mice only had minimal hepatic lipid accumulation after 12 weeks on HFD, which precluded us from further analyzing the histological effects of Eld, PCA or the microbiota on their livers (SI Fig. S3). This is consistent with previous studies showing that female mice are naturally more resistant to HFD-induced metabolic changes7,30. Our finding that ABX ablation impedes the effects of an Eld-supplemented diet further supports the gut microbiome’s role in protecting against steatosis in obese mice.
Fig. 3. Elderberry extract prevents hepatic steatosis in male mice in a microbiome-dependent manner.
(A) After 12 wks of the different diets, H&E-stained sections of the male mouse livers. Representative images shown from n = 6 per group. Pathologic assessment for the H&E-stained sections (B) Steatosis percentage (C) Steatosis score (D) NAFLD activity score (E) Inflammation. Error bars represent SEM. Statistical analysis was performed using unpaired two-tailed Student’s t test.
Eld mice have increased hepatic AMPKα activation and improved lipid metabolism
We tested for hepatic AMPKα activation via increased T172 phosphorylation by immunoblot analysis and found that both male and female mice showed increased AMPKα phosphorylation on Eld, but only when the gut microbiome remained intact (Fig. 4A and 4B, SI Fig. S4C and S4D). No differential activation was observed between the HFD and HFD-ABX control groups (Fig. 4A and 4B, SI Fig. S4E and S4F). These findings suggest that hepatic AMPKα activation may be in part responsible for the steatosis prevention observed in the livers of males on Eld (Fig. 3A) and further support the importance of the gut microbiome in this process. As expected, PCA-induced AMPKα activation (Fig. 4A and 4B, SI Fig. S4G–S4J) is not dependent on the microbiota, which is consistent with previous studies on PCA in mice32–34. We next analyzed phosphorylation of acetyl-CoA carboxylase (ACC), the enzyme catalyzing the committing step to fatty acid biosynthesis, and a downstream target of AMPKα regulation. However, no significant Eld-dependent differences were observed (SI Fig. S5A and S5B).
Fig. 4. Elderberry extract increases the activation of AMPKα and impacts hepatic gene expression in male and female mice in a microbiome-dependent manner.
(A-B) Western blot analysis of pAMPKα (T172), total AMPKα, and β-actin in male and female mice after 12 wks of the different diets and water. (C-D) RT-qPCR quantification of mRNA transcripts involved in metabolism and inflammation of the male and female mice liver normalized to CycloA n=6 per group. Error bars represent SEM. Statistical analysis was performed using unpaired two-tailed Student’s t test.
To further investigate metabolic changes, mRNA expression of several liver genes linked to lipid metabolism and inflammation were measured (Fig. 4C and 4D). In both male and female mice supplemented with Eld or PCA, transcripts of the fatty acid transporter Cd36, and peroxisome proliferator-activated receptor gamma (Pparg1), a key regulator of adipogenesis, lipid metabolism, and insulin sensitivity, were markedly reduced. Some genes showed sex-specific differences, including glucokinase (Gck) and peroxisome proliferator-activated receptor gamma coactivator-1 alpha (Pgc1a), a master regulator of mitochondrial biogenesis. Notably, stearoyl-CoA desaturase 1 (Scd1), which converts saturated fatty acids into monounsaturated fatty acids, showed opposing patterns between sexes. In male mice, Scd1 expression was significantly reduced in both the Eld and PCA groups, while in female mice, expression levels were higher compared to controls. This finding agrees with previous reports showing that Scd1 is more highly expressed in female skeletal muscle and adipose tissue due to sex differences in fatty acid metabolism8. Our study now also reports this difference in liver tissue (Fig. 4D). Taken together, these results suggest that both Eld metabolites and PCA promote monounsaturated fatty acid synthesis in the liver of female mice while reducing it in males. Additionally, an Eld diet lowered gene expression of the liver inflammation markers IL-6 and F4–80 in female mice only (Fig. 4D).
Eld fed mice cecal microbiomes are enriched in polyphenol metabolizing commensals
To investigate a potential link between the observed sex differences and the gut microbiota, and to identify potential polyphenol catabolizing microbes, we determined the cecal microbial composition using 16S rRNA sequencing. Overall, control and PCA female animals had a higher alpha-diversity compared to males on the same diet as measured by Simpson index (Fig. 5A). While the alpha-diversity of the Eld male and female mice did not differ significantly, their community compositions distinctly clustered separate from each other, as well as from the other groups (Fig. 5B). These differences are also reflected in the total diversity plots (Fig. 5C) and heat map (Fig. 5D), which highlight an overall increased abundance of Faecalibaculum in males, as well as treatment-specific sex-differences, most notably Lactobacillus, Lachnospiraceae from the NK4A136 group, and Roseburia. Members of these bacterial genera are linked to improvements in hepatic steatosis and inflammation through the production of short-chain fatty acids35–38. Additionally, female mice on Eld displayed an increased abundance of Akkermansia and Bacteroides, bacterial taxa previously implicated in beneficial metabolic effects39,40. Bacterial genera that are typically associated with polyphenol metabolism, including Lachnospiraceae and Lactobacillus, were among the top contributors to the observed treatment-dependent beta-diversity in both male and female animals (Fig. 5F).
Fig. 5. Eld mice have an increased relative abundance of health-associated gut bacteria.
(A) Simpson alpha diversity estimates compared between male and female cecal communities on the different diets. Pairwise analysis was done using Wilcoxon rank sum t-test. (B) Principal component analysis (PCA) plot based on the Bray–Curtis dissimilarity index between the cecal 16S rRNA profile of all the six groups. (C) Stacked bar plot comparison of male and female total diversity by diet, representing the most abundant taxa in each group. (D) Heatmap of the differentially abundant bacterial taxa across comparing male and female microbiota across the different diet groups. (E) Differential abundance analysis plots for statistically significant taxa in the male (left) and female (right) cecal communities across the different diet groups. Pairwise test used was “metagenomeSeq” with Benjamini Hochberg correction. (F) Principal component analysis plot showing the Bray-Curtis dissimilarity between groups and highlight bacterial taxa that significantly contribute to beta diversity. (n = 4 animals for all 16S rRNA sequencing analyses).
Polyphenol-derived microbial catabolites are increased in the portal plasma from animals on Eld supplemented diet
To gain functional insights into which bioactive microbial metabolites contribute to the beneficial effects of Eld supplementation, we developed a targeted liquid chromatography-tandem mass spectrometry (LC-MS/MS) stable isotope dilution method for measuring monophenolic acids that are potential polyphenol catabolites, chromatographically separating different isomers. We analyzed plasma from the portal vein as this contains absorbed nutrients, xenobiotics, and other compounds from the gastrointestinal tract before they are processed by the liver41. Among the nine microbial polyphenol catabolites monitored in our LC-MS/MS method, hydrocinnamic (or 3-phenylpropionic acid) (Fig. 6A, 6B) and 3-hydroxyphenylacetic acid (3-HPAA) (Fig. 6C, 6D) were significantly elevated in both female and male mice on Eld. The Eld+ABX group did not have a similar increased portal plasma level in these MPAs. In contrast, ferulic acid (4-hydroxy-3-methoxycinnamic acid) a compound present in the Eld extract, was significantly reduced in the Eld compared to the Eld-ABX group, suggesting consumption by the microbiota (Fig. 6E, 6F). Likewise, phloretic acid (3-(4-hydroxyphenyl)propionic acid) levels were significantly higher in Eld-ABX female mice compared to their Eld counterparts (Fig. 6H). Other monophenolic acids measured showed no significant differences across groups (SI Fig. S6A, S6D) including the portal plasma levels of PCA in PCA treated animals when compared to the HFD group, suggesting potential microbial consumption of this MPA. Increased PCA levels in PCA-ABX mice compared the PCA group further corroborates the potential role of the gut microbiota in downstream PCA catabolism (Fig. 6I and 6J). It is tempting to speculate that this dietary PCA got converted to vanillic acid (4-hydroxy-3-methoxybenzoic acid) through 3-methylation in our male animals (Fig. 6K), a process which is known to be catalyzed by gut bacteria42,43. Intriguingly, we observed the opposite pattern in the female animals on PCA +/− ABX (Fig. 6L).
Fig. 6. LC-MS/MS portal plasma analysis of Eld fed mice revealed an increase in 3-PPA and 3-HPAA microbial polyphenol catabolites.
LC-MS/MS measured Portal plasma from male and female mice with different gut microbial metabolite n = 5–9 per group. (A-B) Hydrocinnamic acid. (C-D) 3-Hydroxyphenylacetic acid (3-HPAA). (E-F) Ferulic acid (FA). (G-H) 4-Hydroxybenzoic acid (4-HBA). (I-J) Protocatechuic acid (PCA). (K-L) Vanillic acid (VA). (M-N) Phloretic acid (PA). Error bars represent SEM. Statistical analysis was performed with one-way ANOVA.
Hydrocinnamic acid activates hepatic AMPKα signaling
Since both hydrocinnamic acid and 3-HPAA were significantly enriched in the Eld male and female mice in a microbiome-dependent manner (Fig. 6A–D), we next tested their capability to activate AMPKα. In vitro cultivated hepatocyte-derived cellular carcinoma cells (HuH-7) were treated with either MPA. Cells treated with hydrocinnamic acid demonstrated a significant increase in AMPKα phosphorylation compared to the vehicle control (Fig. 7A). Notably, 3-HPAA treatment had no effect on AMPKα total levels nor on phosphorylation. Hence, we speculate that the AMPKα activation observed in the livers of our male and female mice (Fig. 4A and 4B) can most likely be attributed to hydrocinnamic acid. To assess the dosage of hydrocinnamic acid required to activate AMPKα, we administered the compound to HuH-7 cells in a physiologically relevant concentration range (0.25–5 μM). Even at concentrations below the portal plasma levels (Fig. 6A and 6B), hydrocinnamic acid treatment resulted in robust AMPKα phosphorylation in a dose-independent manner (Fig. 7B and 7C). Accordingly, we observed an increase in phosphorylation of the downstream enzyme ACC (SI Fig. S7A and S7B). These findings demonstrate the potent effect of hydrocinnamic acid on AMPKα activation and downstream signaling and can explain the observed in vivo steatosis protective effect via promotion of fatty acid oxidation while suppressing de novo lipogenesis in the liver.
Fig. 7. Hydrocinnamic acid activates hepatic AMPKα signaling in HuH-7 cells at physiologically relevant concentrations.
(A) Western blot analysis of pAMPKα (T172), total pAMPKα, and β-actin for HuH-7 cells after treatment with either DMSO vehicle, 50 μM hydrocinnamic acid, or 50 μM 3-HPAA. (B) Western blot analysis of pAMPKα (T172), total pAMPKα, and β-actin for HuH-7 cells after treatment with DMSO vehicle control (0 μM) or 0.25, 1, and 5 μM hydrocinnamic acid. (C) Relative expression of the ratio of AMPKα activation after treatment with different physiological concentrations of hydrocinnamic acid. Error bars represent SEM.
The gut commensal Clostridium sporogenes converts cinnamic acid from Eld into hydrocinnamic acid
Various gut bacteria are capable of hydrocinnamic acid production, including strains of Clostridium sporogenes and Bacteroides fragilis44,45. A main metabolic pathway for this process involves a series of enzymatic conversions starting from the aromatic amino acid phenylalanine (Phe), which has been fully characterized in C. sporogenes (Fig. 8A)45. To investigate whether these bacteria are also capable of producing hydrocinnamic acid from substrates in the Eld extract, we supplemented liquid cultures of C. sporogenes and B. fragilis with Eld extract or vehicle control under anaerobic conditions. After 4 hours of incubation, we quantified hydrocinnamic acid levels using our LC-MS/MS panel. Hydrocinnamic acid levels were higher in vehicle-treated C. sporogenes ATCC 15579 as compared to the no bacteria control, a baseline level which is likely due to the breakdown of Phe from the culture medium (Fig. 8B). Addition of Eld extract resulted in a significant increase in hydrocinnamic acid levels, indicating that C. sporogenes ATCC 15579 can additionally metabolize Eld-derived compounds into hydrocinnamic acid. In contrast, B. fragilis 3_1_12 HM-20 did not produce hydrocinnamic acid from either Phe present in the growth medium or Eld extract, suggesting that this strain’s metabolic capabilities differ from previously studied B. fragilis strains.
Fig. 8. C. sporogenes converts cinnamic acid from elderberry extracts into hydrocinnamic acid.
(A) The reductive pathways for phenylalanine metabolism in C. sporogenes to hydrocinnamic acid, with the addition of cinnamic acid from elderberry extracts. (B) C. sporogenes can convert 1% elderberry extract into hydrocinnamic acid from cinnamic acid as measured by LC-MS/MS but not B.fragillis, n=3 per group. (C) ΔfldH C. sporogenes can still produce the same levels of hydrocinnamic acid from elderberry extract compared to the wild-type C. sporogenes, as measured by LC-MS/MS, n=3 per group. Error bars represent SEM. Statistical analysis was performed using unpaired two-tailed Student’s t test.
We noticed that the Eld extract contains a substantial amount of cinnamic acid (phenylacrylic acid). Cinnamic acid can get converted to hydrocinnamic acid by 3-(aryl)acrylate reductase, the final enzymatic step in the Phe metabolic pathway (Fig. 8A), and we postulated that the Eld cinnamic acid is responsible for the increased hydrocinnamic acid production by C. sporogenes. To confirm this, we tested a C. sporogenes ΔfldH deletion mutant46. The fldH gene encodes phenyllactate dehydrogenase, an upstream enzyme in the Phe metabolism pathway, and its deletion abrogates hydrocinnamic acid production from Phe present in the culture medium45. The baseline hydrocinnamic acid production of the C. sporogenes ΔfldH knockout was significantly lower compared to the wildtype control (Fig. 8C). Upon addition of Eld extract, C. sporogenes ΔfldH hydrocinnamic acid production reached levels comparable to the wildtype control after 24 hours. Taken together, these findings demonstrate that Eld extract can be used by gut microbes to yield hydrocinnamic acid, and this could contribute to the in vivo mechanism by which dietary Eld supplementation resulted in increased hydrocinnamic acid levels in portal plasma.
Discussion:
A healthy lifestyle can be a more accessible alternative approach to prevent and treat metabolic diseases, compared to pharmaceutical therapies. An aspect of this is maintaining a healthy diet consisting of fruits, vegetables, grains, and green tea; components which are rich in phenolic compounds such as flavonoids and other polyphenols24,47. While several of these compounds have been implicated in the prevention of metabolic diseases24,28,48–50, the exact mechanism remains unclear. It is well-established that certain members of the gut microbiome metabolize polyphenols into monophenolic acids23, and our group demonstrated that the gut microbial catabolite 4-HPAA is key in reversing obesity-associated hepatic steatosis in mice28. In the current study, we further investigate the contribution of the gut microbiome and dietary Eld supplementation on physiological parameters associated with obesity in male and female mice. We used an ABX cocktail to ablate the gut microbiota of animals on a 12-week dietary prevention study and observed microbiome-dependent improvements in insulin sensitivity and hepatic steatosis.
Our findings contribute mechanistic insights to previous observations on the insulin sensitivity improving properties of Eld51–53. We reveal that the dietary effect on insulin homeostasis can in part be attributed to the presence of an intact gut microbiome, thereby emphasizing the importance of bacterial metabolism for the Eld prebiotic. This Eld-microbiota effect on insulin sensitivity was comparable, if not more profound than supplementation with the well-studied MPA PCA at similar dietary dosage. This underscores the potency of hydrocinnamic acid, and implies that Eld metabolism could yield several bioactive metabolites. Notably, the microbiome-dependent effect of dietary elderberry had a stronger phenotype in female mice with respect to insulin sensitivity, while male mice exhibited a more profound improvement of their fatty liver phenotype. These findings mimic previously observed sex differences in mice and humans with metabolic diseases, as well as emphasizes the importance of including both male and female research participants9,10,54,55.
We developed a new LC-MS/MS method for detecting monophenolic acids, chromatographically separating structural isomers, and observed gut microbial production of hydrocinnamic acid and 3-HPAA from an Eld extract substrate, in addition to the 4-HPAA and vanillic acid catabolites we previously reported28. We proceeded to identify hydrocinnamic acid as a key microbial metabolite responsible for hepatic steatosis alleviation and improvements in lipid metabolism, via activation of AMPKα. It is notable that robust AMPKα activation is achieved at submicromolar, physiologically relevant concentrations of hydrocinnamic acid, similar to our previous findings with 4-HPAA28. In addition to its role in AMPKα activation, hydrocinnamic acid has been reported to improve glucose metabolism and regulate insulin secretion, primarily due to its activity as an agonist for pancreatic free fatty acid receptor 1, a promising anti-diabetic target56–58. Hydrocinnamic acid also improves mitochondria biogenesis and function in muscle tissue59, indicating the compound could help combat the effects of aging. Our current work uncovers a novel hydrocinnamic acid activity in reducing fatty liver in a preclinical obesity model.
Previous studies have explored flavonoid supplementation in reducing fatty liver disease60–63, along with bacterial metabolites derived from flavonoids, such as PCA64–66, 4-HPAA28, vanillic acid26,27, and gallic acid67,68. For our study, we investigated the role of dietary Eld in comparison to the well-studied monophenolic acid PCA as a positive control. PCA has reported activities in reducing HFD-induced obesity25,69, inflammation70,71, and fatty liver disease48,66,72 when it’s consumed in a typical dietary amount. Conversely, it can be toxic at high doses, especially when administered via intraperitoneal injection, as it can cause significant hepatotoxicity and nephrotoxicity associated with glutathione depletion73. Elderberry has been traditionally used as a supplement because of its attributed abilities to reduce oxidative stress, reduce glycemia, and stimulate the immune system74. Eld extract is rich in cinnamic acid29, as well as the flavonoids quercetin and rutin, which can be metabolized by the gut microbiota to monophenolic acids such as 3-HPAA75,76.
Focusing on gut microbial metabolism of the Eld extract, we observed that C. sporogenes produces hydrocinnamic acid not only from Phe metabolism via a well-characterized reductive enzymatic pathway, but also from cinnamic acid which is present in a significant amount in the Eld extract. We validated this by blocking the upstream part of the Phe to hydrocinnamic acid metabolism pathway using a C. sporogenes ΔfldH knockout strain, which lacks phenyllactate dehydrogenase (Fig. 8A). Upon incubation with Eld extract, C. sporogenes ΔfldH sustained production of hydrocinnamic acid, thereby confirming our hypothesis that hydrocinnamic acid can be produced in substantial quantities from Eld substrates like cinnamic acid. C. sporogenes converts cinnamic acid to hydrocinnamic acid using the enzyme acyl-CoA dehydrogenase (AcdA, Fig. 8A)45,77 78 as the last step in the Phe metabolism pathway. Not only does this bypass the most energetically demanding step in Phe metabolism pathway (dehydration of phenyllactic acid to cinnamic acid)79,80, it also suggests that Eld provides an additional substrate for hydrocinnamic acid production under Phe-limiting conditions. Other Clostridia harbor the genes responsible for the reduction of Phe, for example Clostridium cadaveris, and Peptostreptococcus anaerobius81. Further experimentation using germ-free animals monocolonized with these and other candidate hydrocinnamic acid producing gut commensals will reveal whether they contribute to host metabolic health.
Our study has several limitations, including the potential effect of ABX on mouse weight gain and food intake as well as impairment of accurate gene expression in liver lysates82. Although these ABX-specific effects could be circumvented by using a gnotobiotic model, germ-free mice are mostly resistant to HFD-induced obesity83, and large multi-arm feeding studies are not feasible for practical reasons. Additionally, collecting blood plasma from fasted animals interfered with the detection of most hormones other than leptin. This collection from fasted animals might likewise prevent the LC-MS/MS detection of potentially interesting diet- and microbiota-derived metabolites with a short half-life in circulation.
In conclusion, our study underscores the importance of gut microbial metabolism in dietary prevention with a polyphenol-rich elderberry extract in the context of obesity-associated metabolic disease parameters. We identified hydrocinnamic acid as a potent microbe-derived metabolite capable of activating host AMPKα, and which is likely a key mechanistic contributor to improved insulin sensitivity and abrogation of obesity-associated hepatic steatosis. Our comparison of male and female animals revealed common effects on hepatic gene expression, AMPKα activation, gut microbial metabolism and insulin tolerance, as well as sex-specific differences in accumulation of fat in the liver. Overall, our in-depth analysis adds hydrocinnamic acid to a growing list of potent bioactive diet-microbe cometabolites which will help inform future dietary and probiotic interventions.
Methods:
Animal studies
Male and female C57BL/6 mice were bred and maintained under specific pathogen-free (SPF) conditions within the Biological Resources Unit (BRU) of Cleveland Clinic Lerner Research Institute. At 4 weeks old, animals were given ad libitum access to a standard HFD (D12492, Research Diets, Inc.), or the same HFD supplemented with 1% w/w Elderberry extract powder (70120034, Artemis International), or 1% w/w Protocatechuic acid (PCA) (BT211395, Avantor) for 12 weeks. Mice were also allowed free access to either regular water or antibiotic cocktail (ABX) water that consists of 1 g/L neomycin (21810031, Life Technologies), 1 g/L ampicillin (BP176025, Fisher Healthcare), and 0.5 g/L vancomycin (V06500, Research Products International). All of our experiments and procedures were approved by the Institutional Animal Care and Use Committee (IACUC).
Animal food consumption and body weights were measured weekly for the entire duration of the experiment. At endpoint, lean and fat mass were measured using EchoMRI body composition analysis (EchoMRI, LLC). Endpoint plasma levels of leptin, active glucagon-like peptide 1 (GLP-1), glucagon, insulin, and peptide YY (PYY), were measured by U-PLEX Gut Hormone Combo 1 assay according to manufacturer’s instructions (Meso Scale Diagnostics, Rockville, MD, USA). Right lobes of the murine livers were fixed by submersion in formalin for 16 hours, then dehydrated in histological grade ethanol, embedded in paraffin, sectioned, and stained with hematoxylin and eosin (H&E).
Glucose and insulin tolerance test
On week 10, mice were fasted for 4 hours and then injected intraperitoneally with 1 g/kg glucose for ITT. We measured blood glucose by using Accucheck glucometers before the glucose injection (baseline) and 15, 30, 60, and 120 min after the glucose injection. For ITT on week 11, mice were fasted for 4 hours and then injected intraperitoneally with 0.5U/kg insulin. We measured blood glucose by using Accucheck glucometers before the glucose injection (baseline) and 15, 30, 60, and 120 min after the glucose injection. During the ITT test, animals showing signs of severe hypoglycemia, observed by testing blood glucose levels, were immediately injected with glucose 1 g/kg I.P. to rescue those animals from the shock, according to the guidelines outlined in our IACUC protocol.
Cecal microbiome sequencing and analysis
DNA from mouse cecal contents was harvested using the QIAGENPowerSoil Pro kit according to the manufacturer’s protocol. 16S rRNA gene amplicon sequencing and bioinformatics analysis were performed using methods explained earlier84–86. Briefly, raw 16S amplicon sequence and metadata, were demultiplexed using the split_libraries_fastq.py script implemented in QIIME287. The demultiplexed fastq file was split into sample-specific fastq files using split_sequence_file_on_sample_ids.py script from QIIME2. Individual fastq files without non-biological nucleotides were processed using Divisive Amplicon Denoising Algorithm (DADA) pipeline88. The output of the dada2 pipeline (feature table of amplicon sequence variants (an ASV table)) was processed for alpha and beta diversity analysis using phyloseq89, and microbiomeSeq (http://www.github.com/umerijaz/microbiomeSeq) packages in R. We analyzed variance (ANOVA) among sample categories while measuring the of α-diversity measures using plot_anova_diversity function in microbiomeSeq package. Permutational multivariate analysis of variance (PERMANOVA) with 999 permutations was performed on all principal coordinates obtained during CCA with the ordination function of the microbiomeSeq package. Pairwise correlation was performed between the microbiome (genera) and metabolomics (metabolites) data was performed using the microbiomeSeq package.
Statistical analysis
Differential abundance analysis was performed using the random-forest algorithm, implemented in the DAtest package (https://github.com/Russel88/DAtest/wiki/usage#typical-workflow). Briefly, differentially abundant methods were compared with False Discovery Rate (FDR), Area Under the (Receiver Operator) Curve (AUC), Empirical power (Power), and False Positive Rate (FPR). Based on the DAtest’s benchmarking, we selected LEfSe and ANOVA as the methods of choice to perform differential abundance analysis. We assessed the statistical significance (P < 0.05) throughout, and whenever necessary, we adjusted P-values for multiple comparisons according to the Benjamini and Hochberg method to control False Discovery Rate90. Linear regression (parametric test), and Wilcoxon (Non-parametric) test were performed on genera and ASVs abundances against metadata variables using their base functions in R (version 4.1.2; R Core Team91).
Quantitative real-time polymerase chain reaction
10–20 mg of snap-frozen liver tissue was lysed using the tissue homogenizer in 1 mL TRIzol reagent (15596018, Thermo Fisher Scientific). Next, 200 μL chloroform was added, the sample was vortexed vigorously and centrifuged at 12,000 × g for 15 minutes. The upper clear layer was transferred to another tube with 500 μL isopropanol, centrifuged at 12,000 × g for 17 minutes until the RNA pellet precipitated. Finally, the RNA pellet was washed with 1 mL 75% ethanol and resuspended in molecular grade water. DNase treatment was performed using the DNA-free™ DNA Removal Kit (AM1906, Thermo Fisher Scientific) according to manufacturer instruction. cDNA was generated using qScript cDNA SuperMix (101414–106, Quanta- Bio) using ~1 μg of RNA as template. Real-time PCR was performed using an Applied Biosystems Step One Plus system. mRNA expression levels were calculated based on the ΔΔ-CT method and genes of interest were normalized to the house keeping gene CycloA. A list of primer sequences can be found in Table 1.
Table (1):
Primer sequences for quantitative real-time polymerase chain reaction.
| Gene | Forward primer sequence (5’−3’) | Reverse primer sequence (5’−3’) |
|---|---|---|
| Cd36 | GCAAAGAACAGCAGCAAAATC | CAGTGAAGGTCAAAGATGG |
| Gck | TGAGCCGGATGCAGAAGGA | GCAACATCTTTACACTGGCCT |
| Lcn13 | GTCATTCGGGATGGGAAAG | GCTGTTGCAGACCTGGGTA |
| Pparg1 | AACAAGACTACCCTTTACTGAAATTACCA | CACAGAGCTGATTCCGAAGTTG |
| Pgc1a | CCCTGCCATTGTTAAGAC | GCTGCTGTTCCTGTTTTC |
| FasN | GTCACCACAGCCTGGACCGC | CTCGCCATAGGTGCCGCCTG |
| Scd1 | TTCCCTCCTGCAAGCTCTAC | CAGAGCGCTGGTCATGTAGT |
| Il-6 | GCTACCAAACTGGATATAATCAGGA | CCAGGTAGCTATGGTACTCCAGAA |
| F4–80 | GGATGTACAGATGGGGGATG | CATAAGCTGGGCAAGTGGTA |
| CycloA | GCGGCAGGTCCATCTACG | GCCATCCAGCCATTCAGTC |
LC-MS/MS analysis of monophenolic acids
Portal plasma or bacterial supernatant were prepared for LC-MS/MS analysis and quantified as previously mentioned92. Stable-isotope-dilution high performance liquid chromatography tandem mass spectrometry (LC–MS/MS) was used for quantification of levels of different phenolic acids using a LCMS-8050 Triple Quadrupole (Shimadzu Scientific Instruments, Inc., Columbia, MD, USA), equipped with an electrospray ionization source operating in negative ion mode. XSelect HSS T3 Column (4.6 mm × 250 mm; 3.5 μm) (Cat # 186004788, Waters) was used for chromatographic separation. The D6 4-HPAA was used as an internal standard (D-7842, CDN Isotopes) at 10 μM. Monophenolic acids were monitored using multiple reaction monitoring (MRM) of precursor and characteristic product ions in negative mode as follows: m/z 157.1 → 112.9 for D6–4-HPAA; m/z 149 → 105.05 for hydrocinnamic acid (3-phenylpropionic acid); m/z 151.0 → 106.9 for 3-hydroxyphenyl acetic acid; m/z 193.0 → 178.15 ferulic acid; m/z 137.0 → 92.9 for 4-hydroxybenzoic acid (4-HBA); m/z 153.2 → 108.9 for protocatechuic acid (PCA); m/z 167 → 152.1 for vanillic acid (VA); m/z 165.1 → 121.0 for phloretic acid (PA); m/z 150.9 → 106.9 for 4-hydroxyphenyl acetic acid; m/z 151.2 → 107 for 2-hydroxyphenyl acetic acid.
Cell culture and immunoblotting
Human hepatoma cells (HuH-7) were seeded at a density of 1×106/well in 6-well tissue culture plates (TP92406, MIDSCI) in Dulbecco’s Modified Eagle Medium (DMEM) containing 10% fetal bovine serum. Media was changed two hours prior to treatment with a DMSO vehicle control, hydrocinnamic acid (AAA1490822, Thermo Scientific Chemicals), or 3-HPAA (AAA1490822, Thermo Scientific Chemicals) for 60 minutes. Cell pellets or murine liver homogenates were suspended in radioimmunoprecipitation assay (RIPA) buffer with protease and phosphatase inhibitors (Thermo Scientific). Protein concentration was quantified using a Bradford Assay kit according to the manufacturer’s instructions (Thermo Scientific). Gel electrophoresis was carried out with samples diluted in Laemmli buffer with 2-mercaptoethanol. A 12% Mini-PROTEAN® TGX™ precast gel was loaded with 10 μg of sample per well and run at 100V for 2hrs (Biorad). Proteins were transferred to a 0.2 μm PVDF membrane (Biorad) using wet electroblotting at 4°C for 16hours. Images were taken using a GE Amersham Imager 6000 and ImageJ93 was used for densitometric protein expression analysis. Primary antibodies (pT172-AMPKα, 2535, Cell Signaling), (AMPKα, 5831, Cell Signaling), (β-actin, C825B47, Proteintech) were prepared 1:1000 in TBST buffer with 5% BSA (w/v) (pS79-ACC, 11818, Cell Signaling), (ACC, 3676, Cell Signaling), were prepared 1:10000 in TBST buffer with 5% (w/v) nonfat dried milk. Rabbit secondary (7074, Cell Signaling) and mouse secondary (405306, BioLegend) were prepared 1:5000 in TBST buffer with 5% BSA.
Microbial culturing
Microbial culture experiments were performed in an anaerobic chamber (Coy Laboratory Products, Inc.) under the following conditions: 90% N2, 5% H2, 5% CO2, and < 25 ppm O2. To examine the conversion of Eld into hydrocinnamic acid, C. sporogenes ATCC 15579, C. sporogenes ΔfldHΔcutC, and B. fragilis 3_1_12 HM-20 were plated on a 50:50 (v/v) mixture of Wilkins-Chalgren and Gifu Anaerobic or Tryptic Soy agar. Single colonies were cultured in liquid medium and incubated at 37° C for 24 hours. Next, these cultures were diluted 1:10 in fresh media with vehicle or 1% Eld extract. After 4 hours and 24 hours, bacteria were pelleted by centrifugation at 8000 × g for 5 minutes, and supernatant was filtered using Sterile Syringe Filters 0.22μm pore sizes (SLGVM33RS, MilliporeSigma). Next, the filtered supernatant was prepped and analyzed by LC-MS/MS as described above.
Supplementary Material
Acknowledgements:
The authors would like to thank Artemis International for providing the Eld extract. We thank Stanley Hazen for providing us the C. sporogenes ΔfldHΔcutC strain. This work was supported by seed funding from the Cleveland Clinic Foundation (J.C.), and in part by a Research Grant from the Prevent Cancer Foundation (PCF2019-JC), and a National Institutes of Health (NIH) grant R01 AI153173 (J.C.). I.N. was in part supported by the NIH R01HL16074 grant.
Footnotes
Competing interest declaration: J.C. was a Scientific Advisor for Seed Health, Inc. The other authors declare they have no competing interests.
Data availability statement
All data are available in the main text or the supplementary materials. Raw sequence files from the 16S rRNA gene sequencing were deposited in Zenodo’s Sequence Read Archive (accession DOI: 10.5281/zenodo.15208086).
References:
- 1.Liu J. et al. Estimating Global Prevalence of Metabolic Dysfunction-Associated Fatty Liver Disease in Overweight or Obese Adults. Clin. Gastroenterol. Hepatol. Off. Clin. Pract. J. Am. Gastroenterol. Assoc. 20, e573–e582 (2022). [DOI] [PubMed] [Google Scholar]
- 2.Khaodhiar L., Cummings S. & Apovian C. M. Treating Diabetes and Prediabetes by Focusing on Obesity Management. Curr. Diab. Rep. 9, 348–354 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Rohm T. V., Meier D. T., Olefsky J. M. & Donath M. Y. Inflammation in Obesity, Diabetes and related Disorders. Immunity 55, 31–55 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Fabbrini E., Sullivan S. & Klein S. Obesity and Nonalcoholic Fatty Liver Disease: Biochemical, Metabolic and Clinical Implications. Hepatol. Baltim. Md 51, 679–689 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Hong J., Stubbins R. E., Smith R. R., Harvey A. E. & Núñez N. P. Differential susceptibility to obesity between male, female and ovariectomized female mice. Nutr. J. 8, 11 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Català-Niell A., Estrany M. E., Proenza A. M., Gianotti M. & Lladó I. Skeletal muscle and liver oxidative metabolism in response to a voluntary isocaloric intake of a high fat diet in male and female rats. Cell. Physiol. Biochem. Int. J. Exp. Cell. Physiol. Biochem. Pharmacol. 22, 327–336 (2008). [DOI] [PubMed] [Google Scholar]
- 7.Pettersson U. S., Waldén T. B., Carlsson P.-O., Jansson L. & Phillipson M. Female mice are protected against high-fat diet induced metabolic syndrome and increase the regulatory T cell population in adipose tissue. PloS One 7, e46057 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Lundsgaard A.-M. & Kiens B. Gender Differences in Skeletal Muscle Substrate Metabolism – Molecular Mechanisms and Insulin Sensitivity. Front. Endocrinol. 5, (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Lonardo A. et al. Sex Differences in NAFLD: State of the Art and Identification of Research Gaps. Hepatol. Baltim. Md 70, 1457–1469 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Nagral A. et al. Gender Differences in Nonalcoholic Fatty Liver Disease. Euroasian J. Hepato-Gastroenterol. 12, S19–S25 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Carling D., Thornton C., Woods A. & Sanders M. J. AMP-activated protein kinase: new regulation, new roles? Biochem. J. 445, 11–27 (2012). [DOI] [PubMed] [Google Scholar]
- 12.Hardie D. G., Ross F. A. & Hawley S. A. AMPK: a nutrient and energy sensor that maintains energy homeostasis. Nat. Rev. Mol. Cell Biol. 13, 251–262 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Ruderman N. B., Carling D., Prentki M. & Cacicedo J. M. AMPK, insulin resistance, and the metabolic syndrome. J. Clin. Invest. 123, 2764–2772 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Ruderman N. & Prentki M. AMP kinase and malonyl-CoA: targets for therapy of the metabolic syndrome. Nat. Rev. Drug Discov. 3, 340–351 (2004). [DOI] [PubMed] [Google Scholar]
- 15.Fang C. et al. The AMPK pathway in fatty liver disease. Front. Physiol. 13, (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Steinberg G. R. & Kemp B. E. AMPK in Health and Disease. Physiol. Rev. 89, 1025–1078 (2009). [DOI] [PubMed] [Google Scholar]
- 17.Garcia D. & Shaw R. J. AMPK: Mechanisms of Cellular Energy Sensing and Restoration of Metabolic Balance. Mol. Cell 66, 789–800 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Yuan H.-X., Xiong Y. & Guan K.-L. Nutrient sensing, metabolism, and cell growth control. Mol. Cell 49, 379–387 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Holman R. R. et al. Addition of biphasic, prandial, or basal insulin to oral therapy in type 2 diabetes. N. Engl. J. Med. 357, 1716–1730 (2007). [DOI] [PubMed] [Google Scholar]
- 20.Rena G., Hardie D. G. & Pearson E. R. The mechanisms of action of metformin. Diabetologia 60, 1577–1585 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Sterrett J. J., Bragg S. & Weart C. W. Type 2 Diabetes Medication Review. Am. J. Med. Sci. 351, 342–355 (2016). [DOI] [PubMed] [Google Scholar]
- 22.Di Lorenzo C., Colombo F., Biella S., Stockley C. & Restani P. Polyphenols and Human Health: The Role of Bioavailability. Nutrients 13, 273 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Alqudah S. & Claesen J. Mechanisms of gut bacterial metabolism of dietary polyphenols into bioactive compounds. Gut Microbes 16, 2426614 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Osborn L. J., Claesen J. & Brown J. M. Microbial Flavonoid Metabolism: A Cardiometabolic Disease Perspective. Annu. Rev. Nutr. 41, 433–454 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Nour O. A., Ghoniem H. A., Nader M. A. & Suddek G. M. Impact of protocatechuic acid on high fat diet-induced metabolic syndrome sequelae in rats. Eur. J. Pharmacol. 907, 174257 (2021). [DOI] [PubMed] [Google Scholar]
- 26.Obydah W. O., Shaker G. A., Samir S. M., Bassiony S. F. E. & Moneim H. A. A. E. Effect of vanillic acid and exercise training on fatty liver and insulin resistance in rats: Possible role of fibroblast growth factor 21 and autophagy. Physiol. Int. 108, 412–426 (2021). [DOI] [PubMed] [Google Scholar]
- 27.Shekari S., Khonsha F., Rahmati-Yamchi M., Nejabati H. R. & Mota A. Vanillic Acid and Non-Alcoholic Fatty Liver Disease: A Focus on AMPK in Adipose and Liver Tissues. Curr. Pharm. Des. 27, 4686–4692 (2021). [DOI] [PubMed] [Google Scholar]
- 28.Osborn L. J. et al. A gut microbial metabolite of dietary polyphenols reverses obesity-driven hepatic steatosis. Proc. Natl. Acad. Sci. U. S. A. 119, e2202934119 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Liu D. et al. Elderberry (Sambucus nigra L.): Bioactive Compounds, Health Functions, and Applications. J. Agric. Food Chem. 70, 4202–4220 (2022). [DOI] [PubMed] [Google Scholar]
- 30.Jo S. et al. Sex Differences in Pancreatic β-Cell Physiology and Glucose Homeostasis in C57BL/6J Mice. J. Endocr. Soc. 7, bvad099 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Al-hussaniy H. A., Alburghaif A. H. & Naji M. A. Leptin hormone and its effectiveness in reproduction, metabolism, immunity, diabetes, hopes and ambitions. J. Med. Life 14, 600–605 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Zhang Q. & Gonzalez de Mejia E. Protocatechuic acid attenuates adipogenesis-induced inflammation and mitochondrial dysfunction in 3T3-L1 adipocytes by regulation of AMPK pathway. J. Funct. Foods 69, 103972 (2020). [Google Scholar]
- 33.Talagavadi V., Rapisarda P., Galvano F., Pelicci P. & Giorgio M. Cyanidin-3-O-β-glucoside and protocatechuic acid activate AMPK/mTOR/S6K pathway and improve glucose homeostasis in mice. J. Funct. Foods 21, 338–348 (2016). [Google Scholar]
- 34.Lin M.-C., Ou T.-T., Chang C.-H., Chan K.-C. & Wang C.-J. Protocatechuic acid inhibits oleic acid-induced vascular smooth muscle cell proliferation through activation of AMP-activated protein kinase and cell cycle arrest in G0/G1 phase. J. Agric. Food Chem. 63, 235–241 (2015). [DOI] [PubMed] [Google Scholar]
- 35.Seo B. et al. Roseburia spp. Abundance Associates with Alcohol Consumption in Humans and Its Administration Ameliorates Alcoholic Fatty Liver in Mice. Cell Host Microbe 27, 25–40.e6 (2020). [DOI] [PubMed] [Google Scholar]
- 36.Tamanai-Shacoori Z. et al. Roseburia spp.: a marker of health? Future Microbiol. 12, 157–170 (2017). [DOI] [PubMed] [Google Scholar]
- 37.Park J. Y. et al. Dysbiotic change in gastric microbiome and its functional implication in gastric carcinogenesis. Sci. Rep. 12, 4285 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Molino S., Lerma-Aguilera A., Jiménez-Hernández N., Rufián Henares J. Á. & Francino M. P. Evaluation of the Effects of a Short Supplementation With Tannins on the Gut Microbiota of Healthy Subjects. Front. Microbiol. 13, (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Si J., Kang H., You H. J. & Ko G. Revisiting the role of Akkermansia muciniphila as a therapeutic bacterium. Gut Microbes 14, 2078619. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Wexler H. M. Bacteroides: the Good, the Bad, and the Nitty-Gritty. Clin. Microbiol. Rev. 20, 593–621 (2007). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Carneiro C. et al. All about portal vein: a pictorial display to anatomy, variants and physiopathology. Insights Imaging 10, 38 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Brandl K., Kumar V. & Eckmann L. Gut-liver axis at the frontier of host-microbial interactions. Am. J. Physiol. - Gastrointest. Liver Physiol. 312, G413–G419 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Karlsson P. C. et al. Human Fecal Water Inhibits COX-2 in Colonic HT-29 Cells: Role of Phenolic Compounds1. J. Nutr. 135, 2343–2349 (2005). [DOI] [PubMed] [Google Scholar]
- 44.Hu J. et al. Gut microbiota-derived 3-phenylpropionic acid promotes intestinal epithelial barrier function via AhR signaling. Microbiome 11, 102 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Dodd D. et al. A gut bacterial pathway metabolizes aromatic amino acids into nine circulating metabolites. Nature 551, 648–652 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Nemet I. et al. A Cardiovascular Disease-Linked Gut Microbial Metabolite Acts via Adrenergic Receptors. Cell 180, 862–877.e22 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Panche A. N., Diwan A. D. & Chandra S. R. Flavonoids: an overview. J. Nutr. Sci. 5, e47 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Tan J. et al. Protection against Metabolic Associated Fatty Liver Disease by Protocatechuic Acid. Gut Microbes 15, 2238959. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Gil-Cardoso K. et al. Effects of flavonoids on intestinal inflammation, barrier integrity and changes in gut microbiota during diet-induced obesity. Nutr. Res. Rev. 29, 234–248 (2016). [DOI] [PubMed] [Google Scholar]
- 50.Zhou M. et al. Flavonoids, gut microbiota, and host lipid metabolism. Eng. Life Sci. 24, 2300065 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Salvador Â. C. et al. Effect of Elderberry (Sambucus nigra L.) Extract Supplementation in STZ-Induced Diabetic Rats Fed with a High-Fat Diet. Int. J. Mol. Sci. 18, 13 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Zielińska-Wasielica J., Olejnik A., Kowalska K., Olkowicz M. & Dembczyński R. Elderberry (Sambucus nigra L.) Fruit Extract Alleviates Oxidative Stress, Insulin Resistance, and Inflammation in Hypertrophied 3T3-L1 Adipocytes and Activated RAW 264.7 Macrophages. Foods Basel Switz. 8, 326 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Ulusoy Ş. et al. Evaluation of the anti-obesity effect of Sambucus nigra L. (elderberry) and Vitex agnus-castus L. (chasteberry) extracts in high-fat diet-induced obese rats. Front. Pharmacol. 15, (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Balakrishnan M. et al. Women have Lower Risk of Nonalcoholic Fatty Liver Disease but Higher Risk of Progression vs Men: A Systematic Review and Meta-analysis. Clin. Gastroenterol. Hepatol. Off. Clin. Pract. J. Am. Gastroenterol. Assoc. 19, 61–71.e15 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Chen X.-Y., Wang C., Huang Y.-Z. & Zhang L.-L. Nonalcoholic fatty liver disease shows significant sex dimorphism. World J. Clin. Cases 10, 1457–1472 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Kuranov S. O. et al. Exploring bulky natural and natural-like periphery in the design of p-(benzyloxy)phenylpropionic acid agonists of free fatty acid receptor 1 (GPR40). Bioorganic Chem. 99, 103830 (2020). [DOI] [PubMed] [Google Scholar]
- 57.Li Z. et al. Design, synthesis, and biological evaluation of deuterated phenylpropionic acid derivatives as potent and long-acting free fatty acid receptor 1 agonists. Bioorganic Chem. 76, 303–313 (2018). [DOI] [PubMed] [Google Scholar]
- 58.Li Z. et al. Free fatty acid receptor agonists for the treatment of type 2 diabetes: drugs in preclinical to phase II clinical development. Expert Opin. Investig. Drugs 25, 871–890 (2016). [DOI] [PubMed] [Google Scholar]
- 59.Li P. et al. Microbiota-derived 3-phenylpropionic acid promotes myotube hypertrophy by Foxo3/NAD+ signaling pathway. Cell Biosci. 14, 62 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Bell W. et al. A flavonoid-rich diet is associated with lower risk and improved imaging biomarkers of nonalcoholic fatty liver disease: a prospective cohort study. Am. J. Clin. Nutr. 120, 1325–1334 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Burke A. C. et al. Intervention with citrus flavonoids reverses obesity and improves metabolic syndrome and atherosclerosis in obese Ldlr−/− mice. J. Lipid Res. 59, 1714–1728 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Liao Y., Lv F., Quan T., Wang C. & Li J. Flavonoids in natural products for the therapy of liver diseases: progress and future opportunities. Front. Pharmacol. 15, (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Wan L. & Jiang J.-G. Protective effects of plant-derived flavonoids on hepatic injury. J. Funct. Foods 44, 283–291 (2018). [Google Scholar]
- 64.Xiang Y. et al. Protocatechuic Acid Ameliorates High Fat Diet-Induced Obesity and Insulin Resistance in Mice. Mol. Nutr. Food Res. 67, e2200244 (2023). [DOI] [PubMed] [Google Scholar]
- 65.Li J. et al. Protocatechuic Acid Suppresses Lipid Uptake and Synthesis through the PPARγ Pathway in High-Fat Diet-Induced NAFLD Mice. J. Agric. Food Chem. (2025) doi: 10.1021/acs.jafc.4c01354. [DOI] [PubMed] [Google Scholar]
- 66.Zeinalian Boroujeni Z., Khorsandi L., Zeidooni L., Badiee M. S. & Khodayar M. J. Protocatechuic Acid Protects Mice Against Non-Alcoholic Fatty Liver Disease by Attenuating Oxidative Stress and Improving Lipid Profile. Rep. Biochem. Mol. Biol. 13, 218–230 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67.Zhang J. et al. Phytochemical gallic acid alleviates nonalcoholic fatty liver disease via AMPK-ACC-PPARa axis through dual regulation of lipid metabolism and mitochondrial function. Phytomedicine 109, 154589 (2023). [DOI] [PubMed] [Google Scholar]
- 68.Hsu C.-L. & Yen G.-C. Effect of gallic acid on high fat diet-induced dyslipidaemia, hepatosteatosis and oxidative stress in rats. Br. J. Nutr. 98, 727–735 (2007). [DOI] [PubMed] [Google Scholar]
- 69.Xiang P. et al. Dietary Achievable Dose of Protocatechuic Acid, a Metabolite of Flavonoids, Inhibits High-Fat Diet-Induced Obesity in Mice. Mol. Nutr. Food Res. 68, e2300451 (2024). [DOI] [PubMed] [Google Scholar]
- 70.Scazzocchio B. et al. Protocatechuic acid influences immune-metabolic changes in the adipose tissue of pregnant women with gestational diabetes mellitus. Food Funct. 12, 7490–7500 (2021). [DOI] [PubMed] [Google Scholar]
- 71.Zhang Q. & Gonzalez de Mejia E. Protocatechuic acid attenuates adipogenesis-induced inflammation and mitochondrial dysfunction in 3T3-L1 adipocytes by regulation of AMPK pathway. J. Funct. Foods 69, 103972 (2020). [Google Scholar]
- 72.Xu K., Lu G., Feng Q., Chen S. & Wang Y. Hepatoprotective effect of protocatechuic acid against type 2 diabetes-induced liver injury. Pharm. Biol. 61, 737–745. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 73.Nakamura Y., Torikai K. & Ohigashi H. Toxic dose of a simple phenolic antioxidant, protocatechuic acid, attenuates the glutathione level in ICR mouse liver and kidney. J. Agric. Food Chem. 49, 5674–5678 (2001). [DOI] [PubMed] [Google Scholar]
- 74.Sidor A. & Gramza-Michałowska A. Advanced research on the antioxidant and health benefit of elderberry (Sambucus nigra) in food – a review. J. Funct. Foods 18, 941–958 (2015). [Google Scholar]
- 75.Dias P., Pourová J., Vopršalová M., Nejmanová I. & Mladěnka P. 3-Hydroxyphenylacetic Acid: A Blood Pressure-Reducing Flavonoid Metabolite. Nutrients 14, 328 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 76.Aura A.-M. et al. Quercetin Derivatives Are Deconjugated and Converted to Hydroxyphenylacetic Acids but Not Methylated by Human Fecal Flora in Vitro. J. Agric. Food Chem. 50, 1725–1730 (2002). [DOI] [PubMed] [Google Scholar]
- 77.Nemet I. et al. Atlas of gut microbe-derived products from aromatic amino acids and risk of cardiovascular morbidity and mortality. Eur. Heart J. 44, 3085–3096 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 78.Sova M. & Saso L. Natural Sources, Pharmacokinetics, Biological Activities and Health Benefits of Hydroxycinnamic Acids and Their Metabolites. Nutrients 12, 2190 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 79.Dickert S., Pierik A. J. & Buckel W. Molecular characterization of phenyllactate dehydratase and its initiator from Clostridium sporogenes. Mol. Microbiol. 44, 49–60 (2002). [DOI] [PubMed] [Google Scholar]
- 80.Dickert S., Pierik A. J., Linder D. & Buckel W. The involvement of coenzyme A esters in the dehydration of (R)-phenyllactate to (E)-cinnamate by Clostridium sporogenes. Eur. J. Biochem. 267, 3874–3884 (2000). [DOI] [PubMed] [Google Scholar]
- 81.Dodd D. et al. A gut bacterial pathway metabolizes aromatic amino acids into nine circulating metabolites. Nature 551, 648–652 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 82.Liu P. et al. Antibiotic-Induced Dysbiosis of the Gut Microbiota Impairs Gene Expression in Gut-Liver Axis of Mice. Genes 14, 1423 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 83.Rabot S. et al. Germ-free C57BL/6J mice are resistant to high-fat-diet-induced insulin resistance and have altered cholesterol metabolism. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 24, 4948–4959 (2010). [DOI] [PubMed] [Google Scholar]
- 84.Barot S. V. et al. Tumor microbiome variation in young versus average onset colorectal cancer. J. Clin. Oncol. 40, 144–144 (2022). [Google Scholar]
- 85.Chambers L. M. et al. Disruption of the Gut Microbiota Confers Cisplatin Resistance in Epithelial Ovarian Cancer. Cancer Res. 82, 4654–4669 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 86.Weiss K. et al. Barrier Housing and Gender Effects on Allergic Airway Disease in a Murine House Dust Mite Model. ImmunoHorizons 5, 33–47 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 87.Bolyen E. et al. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat. Biotechnol. 37, 852–857 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 88.Callahan B. J. et al. DADA2: High-resolution sample inference from Illumina amplicon data. Nat. Methods 13, 581–583 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 89.McMurdie P. J. & Holmes S. phyloseq: An R Package for Reproducible Interactive Analysis and Graphics of Microbiome Census Data. PLOS ONE 8, e61217 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 90.Benjamini Y. & Hochberg Y. Controlling the False Discovery Rate: A Practical and Powerful Approach to Multiple Testing. J. R. Stat. Soc. Ser. B Methodol. 57, 289–300 (1995). [Google Scholar]
- 91.Team, R. R: A language and environment for statistical computing. (2010).
- 92.Orabi D. et al. A surgical method for continuous intraportal infusion of gut microbial metabolites in mice. JCI Insight 6, e145607, 145607 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 93.Schneider C. A., Rasband W. S. & Eliceiri K. W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 9, 671–675 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
All data are available in the main text or the supplementary materials. Raw sequence files from the 16S rRNA gene sequencing were deposited in Zenodo’s Sequence Read Archive (accession DOI: 10.5281/zenodo.15208086).








