Perish the thawed? EDTA reduces DNA degradation during extraction from frozen tissue

Ella Messner; Lev Becker; Mia L DeSanctis; Elizabeth A Soranno; Ryan Pianka; Caileigh Pierce; Molly Johnson; Rosalia Falco Poulin; Hannah J Appiah-Madson; Daniel L Distel

doi:10.1371/journal.pone.0321872

. 2025 Jun 3;20(6):e0321872. doi: 10.1371/journal.pone.0321872

Perish the thawed? EDTA reduces DNA degradation during extraction from frozen tissue

Ella Messner ^1,^2,^#, Lev Becker ^1,^3,^#, Mia L DeSanctis ^1,⁴, Elizabeth A Soranno ^1,⁵, Ryan Pianka ¹, Caileigh Pierce ^1,⁶, Molly Johnson ¹, Rosalia Falco Poulin ¹, Hannah J Appiah-Madson ¹, Daniel L Distel ^1,^*

Editor: Shailender Kumar Verma⁷

PMCID: PMC12132941 PMID: 40460139

Abstract

Cryopreservation is the gold standard for preserving high molecular weight (HMW) DNA (>10 kb) in tissue samples. However, frozen tissues are typically thawed either before or during DNA extraction, which can lead to substantial DNA degradation. In this study, we thawed the previously frozen tissues of 10 marine species (five fishes and five invertebrates) in the preservatives EDTA (250 mM, pH 10) or ethanol (EtOH, 95%) and maintained them in their respective preservatives overnight at 4°C before DNA extraction. We then compared the recovery of HMW DNA in these extracts to extracts prepared directly from frozen tissues. To evaluate the effect of these treatments on HMW DNA recovery, we determined the percentage of high molecular weight DNA (%HMW) and yield of HMW DNA normalized by tissue weight (nY) in each DNA extract. The average %HMW values for eight of the 10 species and the average nY values for five of the 10 species were significantly higher in extracts from EDTA-treated tissues compared to extracts from untreated frozen tissues. For all 10 species, we observed no significant decreases in average %HMW or nY values in extracts of EDTA-thawed tissues compared to those extracted directly from frozen tissues. In contrast, EtOH treatment did not significantly improve the average %HMW or nY values in extracts from tissues of nine of the 10 species when compared to extracts prepared directly from frozen tissues. Therefore, investigators may consider EDTA treatment as a simple method for improving HMW DNA recovery from frozen tissues.

Introduction

Cryopreservation at ultracold temperatures, typically -80 to -196°C, is the preferred method for preserving DNA in tissue samples for genetic or genomic research [1–6]. For example, a 2014 survey of 45 genomic resource collections associated with natural history museums and research institutions found that 91% maintained frozen materials, 78% maintained ultracold freezers, and 27% maintained liquid nitrogen dewars [7]. Low temperatures reduce DNA degradation by inhibiting chemical and biological activity, including nuclease activity that can rapidly reduce the average molecular weight of DNA in tissues [5,8]. Such fragmentation renders DNA less suitable for many downstream applications, including long-read DNA sequencing, reduced-representation sequencing, whole genome and metagenome sequence assembly, and preparation of large insert libraries [1,3,9,10].

While freezing may protect against DNA degradation, this protection is lost when the materials are thawed [1,11]. Because most DNA extraction procedures occur in liquid media, tissues must be thawed, at least briefly, either before or during extraction, which potentially allows DNA degradation to occur. To minimize DNA damage due to thawing, researchers often grind frozen tissues in liquid nitrogen or on dry ice before transferring the frozen material to an appropriate DNA extraction medium [12–14]. While effective, these methods are technically demanding, inconvenient, dangerous, and prone to accidental thawing and tissue loss during transfer, especially for small samples.

When applied to fresh tissues, chemical preservatives can substantially reduce DNA degradation during subsequent handling and storage [8]. In this investigation, we ask whether the same is true when applied to frozen tissues. Specifically, we ask whether placing frozen tissues in the chemical preservatives ethylenediaminetetraacetic acid (EDTA) or ethanol (EtOH) during the transition from the frozen to the thawed state can provide simple, convenient, safe, inexpensive, and effective methods for reducing DNA degradation during subsequent handling and DNA extraction.

We chose to evaluate EtOH as it is the most commonly used tissue preservative compatible with DNA preservation. It is widely employed for field collection and long-term storage of biological materials, particularly in natural history collections. EtOH protects DNA by dehydrating and denaturing proteins, thus slowing chemical and enzymatic reactions [15]. While EtOH at 70–95% is inexpensive, easy to obtain, and effective for short-term DNA preservation in biological materials, it is less effective for long-term tissue storage [16]. Additionally, EtOH is flammable and subject to shipping restrictions [8,17].

We chose to evaluate EDTA as it is a common ingredient in many preservative solutions [8] and is the primary active ingredient [18] in DESS [19], a widely used tissue preservative that is as or more effective than EtOH in preventing DNA degradation in tissues from a wide range of organisms [9,18–27]. EDTA reduces DNA degradation in tissues by chelating divalent cations that are required as cofactors by deoxyribonucleases (DNases) [17,18,28,29]. Although EDTA is used most frequently at pH 7.5–8, e.g., in DESS [19], a recent investigation found that EDTA solutions become significantly more effective at preserving HMW DNA when the pH of the solution is raised from 8 to 10, especially for tissues that display rapid DNA degradation in other preservatives [17]. This increased effectiveness correlates with EDTA’s increasing capacity to chelate divalent cations as pH rises [17]. EDTA is inexpensive, readily available, and has low toxicity, but unlike EtOH, it is nonflammable and can be shipped as a non-hazardous material [17].

In this study, we evaluate whether treatment with EDTA or EtOH can improve the recovery of HMW DNA from frozen tissues. Specifically, we thawed the previously frozen tissues of 10 marine species (five fishes and five invertebrates) in the preservatives EDTA (250 mM, pH 10) or EtOH (95%) and maintained them in their respective preservatives overnight at 4°C before DNA extraction. We then determined the percentage of high molecular weight DNA (%HMW) and yield of HMW DNA normalized by tissue weight (nY) in each DNA extract and compared these among treatments.

Materials and methods

Ethics statement

This study followed the guidelines recommended by the National Institutes of Health Guide for the Care and Use of Laboratory Animals and Northeastern University’s Institutional Animal Care and Use Committee policies. Although no live vertebrate animals were used in this study, the general principles of humane animal care were applied to the treatment of live invertebrate animals.

Specimen selection, storage, and sampling

In this investigation, we sampled a wide range of species, storage conditions, and tissues to reflect a diverse selection of materials from which researchers may wish to isolate high molecular weight DNA.

We chose 16 species that represent a wide range of animal taxa, including members of 16 genera, 12 families, and three phyla (S1 Table). DNA and images of all specimens have been deposited into the Ocean Genome Legacy Center Genomic Resource Collection [30] and are available via the Arctos database (arctosdb.org) [31] under the catalog numbers listed in S1 Table.

To reflect the diversity of cryostorage conditions found across many frozen collections, we selected organisms that were frozen whole and stored for various periods and under various conditions, some of which are unknown. Specifically, 10 specimens each of five marine fish and five marine invertebrate species (S1 Table) were used for the qualitative and quantitative comparison of treatments (Fig 1). Specimens of Cololabis saira (Pacific saury), Larimichthys polyactis (redlip croaker), Odontesthes regia (silverside), Sardina pilchardus (European pilchard), Amphioctopus sp. (octopus), Magallana gigas (Pacific oyster), and Penaeus vannamei (whiteleg shrimp) were purchased as whole, frozen individuals at grocery stores and stored at -80°C for 0–43 days before sampling. Specimens of Centropristis striata (black sea bass) were collected in trawls by the Massachusetts Department of Marine Fisheries and maintained as frozen whole specimens at -23°C for 9.8 to 9.9 years before transfer to -80°C for 1 day before tissue sampling. Specimens of Homarus americanus (American lobster) and Mercenaria mercenaria (hard-shell clam) were obtained live from seafood suppliers and frozen at -80°C for 2.1 years before sampling. Specimens of H. americanus and M. mercenaria were euthanized by splitting, i.e., cutting quickly along the longitudinal midline with a large sharp knife. While proposed euthanasia methods are published for some invertebrate taxa, there is a lack of peer-reviewed literature evaluating their effectiveness [32]. Nonetheless, the methods described here have been judged as likely to be humane for lobsters [33]. To our knowledge, reliable data on euthanasia are not available for the bivalve M. mercenaria.

Fig 1 — Three frozen tissue samples were collected from each of 10 individuals of 10 marine species (five marine fishes and five marine invertebrates) for a total of 300 samples. One sample from each individual was then thawed in EDTA (250 mM, pH 10) overnight at 4°C and the second was thawed in ethanol (95%) overnight at 4°C, after which DNA was extracted, analyzed, and compared to DNA extracted directly from the third frozen tissue sample, which did not receive liquid preservative treatment.

Specimens of six additional fish species, Alosa mediocris (hickory shad; N = 3), Brevoortia tyrannus (Atlantic menhaden; N = 6), Cynoscion regalis (weakfish; N = 3), Peprilus triacanthus (Atlantic butterfish; N = 3), Scomberomorus maculatus (Spanish mackerel; N = 6), and Trinectes maculatus (hogchoker; N = 4), were collected in trawls by the Connecticut Department of Energy and Environmental Protection and were maintained as frozen whole specimens for 2.8 to 3.9 years at -80°C before tissue sampling. Because too few specimens were available to achieve statistical power sufficient for preservative treatment comparisons, specimens of these species were used only for qualitative analyses.

The samples we collected also reflected a range of tissues. Samples from all fish specimens were collected from the dorsal musculature posterior to the pectoral fin. Tissue samples from Amphioctopus sp., Magallana gigas, and Mercenaria mercenaria were collected from tentacles, visceral mass, and mantle, respectively. For H. americanus and Penaeus vannamei, tissue samples were collected from the abdominal musculature.

Tissue handling and DNA extraction

All specimens were dissected while frozen on a chilled aluminum plate to minimize thawing. For specimens of all species, excluding H. americanus and M. mercenaria, three tissue samples of 100 mg (avg. = 102.0 ± 7.9 mg) each were rapidly collected from each frozen specimen, placed into 1.5 mL microcentrifuge tubes, and immediately stored at -80°C for 5–31 days before subsequent processing. For each of these specimens, 1 mL of EDTA (250 mM, pH 10) was added to the first of the three frozen tissue samples and 1 mL of EtOH (95%) was added to the second. These samples were stored in their respective preservatives overnight at 4°C. Subsequently, a 25 mg (avg. = 25.5 ± 3.4 mg) subsample was removed from each 100 mg sample and transferred to the Qiagen DNeasy Blood and Tissue kit (Hilden, Germany) lysis solution for DNA extraction. The third tissue sample from each frozen specimen was dissected on a chilled aluminum plate and a 25 mg (avg. = 25.9 ± 4.1 mg) subsample was transferred directly into the lysis solution without additional liquid preservative treatment. For H. americanus and M. mercenaria, 100 mg (avg. = 99.9 ± 16.4 mg) samples were handled as above except (1) tissues were processed immediately rather than being stored at -80°C before 25 mg (avg. = 25.4 ± 1.7 mg) subsamples were taken for DNA extraction and (2) frozen 25 mg (avg. = 25.4 ± 1.4 mg) tissue subsamples with no subsequent liquid preservative treatment were taken directly from frozen specimens for DNA extractions. Samples for all species, excluding Centropristis striata, H. americanus, and M. mercenaria, were re-weighed after preservative treatment but before subsampling. We used this post-treatment weight to calculate changes in mass due to preservative treatment.

DNA was extracted using the Qiagen DNeasy Blood and Tissue kit (Hilden, Germany) according to the manufacturer’s protocol, with overnight digestions at 56°C and the following modifications: (1) after digestion, 4 µL of RNase A (100 mg/mL; Qiagen; Hilden, Germany) were added to each subsample and subsamples were incubated at room temperature for 2 minutes before proceeding with the extraction protocol and (2) DNA was eluted with two sequential 50 µL volumes of buffer AE and combined for a total of 100 µL.

DNA analysis

For qualitative visualization, 3 µL (between 4.98 and 720 ng DNA) of each purified DNA sample were size-separated by gel electrophoresis (0.8% agarose, 1X TAE, 5 volts/cm for 50 minutes), stained with 1% GelRed nucleic acid stain (Biotium; Fremont, CA), and imaged using a Gel Doc XR+ Molecular Imager (Bio-Rad; Hercules, CA). The first two and last two lanes of each gel were loaded with 0.33, 0.66, or 1 µL of Quick-Load Purple 1 kb Plus DNA Ladder (100 µg/mL; New England Biolabs; Ipswich, MA) as molecular weight standards. The specific volumes of ladder used are indicated in each figure legend.

To determine %HMW and nY, we analyzed 1 μL (between 1.66 and 240 ng DNA) of each DNA extract using the Agilent Technologies TapeStation 2200 DNA Analyzer (Santa Clara, CA) with Genomic DNA ScreenTapes and TapeStation Analysis Software version A.02.02 (SR1). In this investigation DNA fragments greater than 10 kb are considered HMW and fragments from 150 bp to 10 kb are considered low molecular weight (LMW). As in [17], we estimated the %HMW for each sample as 100 minus the percentage of low molecular weight DNA (%LMW) as measured by the DNA Analyzer. This method avoids the exclusion of DNA fragments greater than the 60 kb resolution limit of the DNA Analyzer from the %HMW estimate.

% H M W = (100 - % L M W) = 100 - (\frac{L M W D N A c o n c e n t r a t i o n (n g / µ L)}{t o t a l D N A c o n c e n t r a t i o n (n g / µ L)} * 100)

The normalized yield of HMW DNA (nY) was calculated for each sample by multiplying the %HMW by the total amount of DNA in the sample (%HMW x concentration x elution volume), then dividing that product by the weight of the tissue used for the extraction multiplied by a correction ratio (CR) to account for the effect of treatment on tissue mass.

n Y = \frac{% H M W * t o t a l D N A c o n c e n t r a t i o n (n g / µ L) * e l u t i o n v o l u m e (µ L)}{w e i g h t o f t i s s u e u s e d f o r t h e e x t r a c t i o n (m g) * 1000 (n g / m g) * C R}

For all species, excluding C. striata, H. americanus, and M. mercenaria, CR was determined by dividing the initial weight of the whole sample by its post-treatment weight [18].

C R = \frac{i n i t i a l s a m p l e w e i g h t (m g)}{p o s t t r e a t m e n t s a m p l e w e i g h t (m g)}

For C. striata, H. americanus, and M. mercenaria, a post-treatment weight was not determined, and therefore, tissue weights were not corrected (i.e., CR = 1).

To evaluate DNA purity, optical absorbance was measured for 2 µL of each sample (between 3.32 and 480 ng DNA) at 230, 260, and 280 nm using a Nanodrop 1000 droplet spectrophotometer (Thermo Fisher Scientific; Waltham, MA) and the A₂₆₀/A₂₈₀ and A₂₆₀/A₂₃₀ absorbance ratios were calculated.

All statistics were analyzed and visualized in RStudio [34,35] using the tidyverse version 2.0.0 [36], conover.test version 1.1.6 [37], multcompView version 0.1–10 [38], cowplot version 1.1.3 [39], stringr version 1.5.1 [40], and rstatix version 0.7.2 [41] packages. The effect of preservative treatment on %HMW and nY values were analyzed independently for each species. To determine whether the data followed a normal distribution, a Shapiro-Wilk normality test was performed. If the data were normally distributed, Mauchly’s test of sphericity was performed, followed by a one-way repeated measures ANOVA and a Bonferroni-corrected Tukey post-hoc test. If the data were not normally distributed, a Friedman χ² test was performed, followed by a Bonferroni-corrected Conover post-hoc test.

PCR amplification and DNA sequencing

The suitability of the extracted DNA for typical downstream applications was evaluated as in [17]. Briefly, the barcode segment [42] of the cytochrome c oxidase subunit 1 (COI) gene from each DNA extract was amplified by polymerase chain reaction (PCR) and Sanger sequenced. PCR amplifications for all fish species used the primers FISHCOILBC (5’–TCAACYAATCAYAAAGATATYGGCAC–3’) and FISHCOIHBC (5’–ACTTCYGGGTGRCCRAARAATCA–3’) [43]. For invertebrate species, primers LCO1490_t1 (5’–TGTAAAACGACGGCCAGTGGTCAACAAATCATAAAGATATTGG–3’) and HCO2198_t2 (5’–CAGGAAACAGCTATGACTAAACTTCAGGGTGACCAAAAAATCA–3’) [44] were used. Each reaction consisted of 17.5 µL of OneTaq 2X Master Mix with Standard Buffer (New England Biolabs; Ipswich, MA), 14.1 µL of ultrapure water, 2 µL of DNA template, and 0.7 µL of each of the forward and reverse primers. The thermocycling conditions for fish species were: 30 seconds at 94°C; 30 cycles of 30 seconds at 94°C, 40 seconds at 52°C, and 60 seconds at 68°C; 5 minutes at 68°C; hold at 4°C. The thermocycling conditions for invertebrate species were: 30 seconds at 94°C; 34 cycles of 30 seconds at 94°C, 50 seconds at 45°C, and 60 seconds at 68°C; 5 minutes at 68°C; hold at 4°C. PCR success was evaluated by gel electrophoresis, as described above; when appropriately sized bands were visualized on the gel, the PCR amplification was considered successful.

All PCR products were bidirectionally sequenced by Sanger sequencing at Psomagen (Rockville, MD) using an ABI 3730XL Analyzer (Applied Biosystems; Foster City, CA). Sequences were analyzed with Geneious Prime (Auckland, New Zealand). Ends were automatically trimmed to remove primers sequences and sequence regions with greater than 1% error probability. Sequences greater than 500 bp in length and with a greater than 98% Q20 score were considered successful. Assembled contigs and sequences were deposited into the GenBank [45] database under the accession numbers listed in S1 Table.

Results

DNA was recovered from all samples, species, and treatments; %HMW values ranged from 3.85 to 86.21% and nY values ranged from 0.00030 to 0.44367 µg DNA/mg tissue (S2 Table). Treatment significantly affected %HMW and nY in eight and six of the 10 statistical models, respectively (Figs 2 and 3; Table 1). The absorbance and absorbance ratios A₂₆₀, A₂₆₀/A₂₈₀, and A₂₆₀/A₂₃₀ and Tapestation DNA Analyzer data are presented in S2 Table.

Fig 2 — Average values for percentage of high molecular weight DNA (%HMW) were determined for extracts prepared from frozen tissue samples collected from each of 10 individuals of 10 marine species (five marine fishes and five marine invertebrates). One sample from each individual was then thawed in EDTA (250 mM, pH 10; maroon) overnight at 4°C and the second was thawed in ethanol (95%; blue) overnight at 4°C, after which DNA was extracted, analyzed, and compared to DNA extracted directly from the third frozen tissue sample, which did not receive liquid preservative treatment (yellow). Error bars represent standard error. Within each histogram, treatments bearing different lower-case letters are significantly different at p < 0.05; matching lower-case letters indicate statistically indistinguishable treatments; an absence of letters indicates no significant differences among all treatments in a given model.

Fig 3 — Average values for yields of high molecular weight DNA normalized by tissue weight (nY) were determined for extracts prepared from frozen tissue samples collected from each of 10 individuals of 10 marine species (five marine fishes and five marine invertebrates). One sample from each individual was then thawed in EDTA (250 mM, pH 10; maroon) overnight at 4°C and the second was thawed in ethanol (95%; blue) overnight at 4°C, after which DNA was extracted, analyzed, and compared to DNA extracted directly from the third frozen tissue sample, which did not receive liquid preservative treatment (yellow). Error bars represent standard error. Within each histogram, treatments bearing different lower-case letters are significantly different at p < 0.05; matching lower-case letters indicate statistically indistinguishable treatments; an absence of letters indicates no significant differences among all treatments in a given model. Note that y-axis scales differ among species.

Table 1. The effect of preservative treatments on average percentages of high molecular weight DNA (%HMW) and average yields of high molecular weight DNA normalized by tissue weight (nY) for DNA extracts from frozen tissues of 10 specimens of each of 10 marine species.

	Species	Statistical Test	Test Statistic	df	p-value
%HMW	Centropristis striata	Friedman χ²	χ² = 16.8	2	< 0.001^*
	Cololabis saira	Friedman χ²	χ² = 15.8	2	< 0.001^*
	Larimichthys polyactis	Repeated measures ANOVA	F = 22.541	2	< 0.001^*
	Odontesthes regia	Friedman χ²	χ² = 10.4	2	0.006^*
	Sardina pilchardus	Repeated measures ANOVA	F = 15.295	2	< 0.001^*
	Amphioctopus sp.	Friedman χ²	χ² = 2.6	2	0.273
	Homarus americanus	Repeated measures ANOVA	F = 26.577	2	< 0.001^*
	Magallana gigas	Friedman χ²	χ² = 16.8	2	< 0.001^*
	Mercenaria mercenaria	Repeated measures ANOVA	F = 53.563	2	< 0.001^*
	Penaeus vannamei	Repeated measures ANOVA	F = 1.376	2	0.278
nY	Centropristis striata	Friedman χ²	χ² = 15	2	< 0.001^*
	Cololabis saira	Friedman χ²	χ² = 7.2	2	0.027^*
	Larimichthys polyactis	Friedman χ²	χ² = 2.4	2	0.301
	Odontesthes regia	Friedman χ²	χ² = 9.8	2	0.007^*
	Sardina pilchardus	Friedman χ²	χ² = 1.4	2	0.497
	Amphioctopus sp.	Friedman χ²	χ² = 9.6	2	0.008^*
	Homarus americanus	Friedman χ²	χ² = 3.8	2	0.150
	Magallana gigas	Friedman χ²	χ² = 12.2	2	0.002^*
	Mercenaria mercenaria	Friedman χ²	χ² = 3.8	2	0.150
	Penaeus vannamei	Friedman χ²	χ² = 12.2	2	0.002^*

Open in a new tab

Significant p-values (p < 0.05) indicated with

; df, degrees of freedom.

Effect of treatments on %HMW

DNA extracts from muscle tissue samples of all five of the fish species examined quantitatively (Centropristis striata, Cololabis saira, L. polyactis, O. regia, and Sardina pilchardus) yielded significantly greater %HMW values when thawed in EDTA before DNA extraction as compared to those isolated directly from frozen tissues (Fig 2). This effect was most extreme in tissues of Centropristis striata, where DNA extracts from EDTA-thawed tissues yielded an average %HMW value more than three-fold higher than extracts from frozen tissues (54.8 ± 13.9% vs. 14.9 ± 7.6%). DNA extracts from EDTA-thawed tissues also yielded higher %HMW values than those from EtOH-thawed tissues for four of the five fish species (Centropristis striata, Cololabis saira, L. polyactis, and S. pilchardus). No significant differences in %HMW values were observed between DNA extracts obtained from EtOH-thawed tissues and those obtained directly from frozen tissues among these five fish species.

Similarly, DNA extracts from tissues of three of the five invertebrate species (H. americanus, Magallana gigas, and Mercenaria mercenaria) yielded significantly greater %HMW values when isolated from tissues thawed in EDTA compared to those purified directly from frozen tissues (Fig 2). This difference was greatest in H. americanus, where tissues thawed in EDTA yielded an average %HMW value more than two-fold greater than extracts prepared directly from frozen tissues (45.3 ± 13.3% vs. 19.4 ± 10.0%). DNA extracts from tissues of two of the five invertebrate species (H. americanus and Magallana gigas) showed significantly greater %HMW values when thawed in EDTA than when thawed in EtOH. For four of the five invertebrate species (Amphioctopus sp., H. americanus, M. gigas, and P. vannamei), %HMW values of DNA extracts from EtOH-thawed tissues were not significantly different or significantly lower than those from frozen tissues.

For all 10 species, we observed no significant decreases in %HMW values in extracts of EDTA-thawed tissues compared to those extracted directly from frozen tissues.

Effect of treatments on nY

Patterns observed for nY were similar to those seen in %HMW. For three of the five fish species (Centropristis striata, Cololabis saira, and O. regia), the nY values of DNA extracts from muscle tissue samples were significantly greater when thawed in EDTA before extraction as compared to those isolated directly from frozen tissues (Fig 3). This effect was most extreme in tissues of O. regia, where the average nY value of DNA extracts from EDTA-thawed tissues was more than four-fold higher than extracts from frozen tissues (0.02400 ± 0.02350 µg DNA/mg tissue vs. 0.00511 ± 0.00358 µg DNA/mg tissue). The nY values of DNA extracts from EDTA-thawed tissues were also greater than those from EtOH-thawed tissues for two of the five fish species (Centropristis striata and Cololabis saira). No significant differences in nY values were observed between DNA extracts obtained from EtOH-thawed tissues and those obtained directly from frozen tissues for all five of the fish species.

Similarly, for two of the five invertebrate species (M. gigas and P. vannamei), the nY values of DNA extracts were significantly greater when isolated from tissues thawed in EDTA compared to those purified directly from frozen tissues (Fig 3). This difference was greatest in P. vannamei, where the average nY value of tissues thawed in EDTA was nearly eight-fold greater than extracts prepared directly from frozen tissues (0.15825 ± 0.09017 µg DNA/mg tissue vs. 0.01981 ± 0.01359 µg DNA/mg tissue). The nY values of DNA extracts from tissues of three of the five invertebrate species (Amphioctopus sp., M. gigas, and P. vannamei) were significantly greater when thawed in EDTA than when thawed in EtOH. The nY values of DNA extracted from frozen tissues were significantly greater than those from tissues thawed in EtOH for only one species (Amphioctopus sp.).

For all 10 species, we observed no significant decreases in nY values in extracts of EDTA-thawed tissues compared to those extracted directly from frozen tissues.

Qualitative DNA analyses

The quantitative results for the 10 species described above are consistent with qualitative observations made by gel electrophoresis (S1 Fig). Gel electrophoresis also revealed qualitatively similar trends for DNA extracts from tissues of six additional fish species for which too few specimens were available for conclusive statistical analyses (S2 Fig).

PCR amplification and DNA sequencing

To determine if DNA extracts were of sufficient quality for downstream applications, PCR amplification and COI sequencing success were evaluated for all 16 species. Across all species and treatments, 96% of PCR amplifications were successful as determined by the presence of a single appropriately sized band on an electrophoretic gel (S2 Table). Specifically, only 1 of 125 (0.8%) reactions from extracts of EDTA-thawed tissues was unsuccessful, whereas 6 (4.8%) and 8 (6.4%) reactions from extracts of EtOH-thawed and frozen tissues were unsuccessful, respectively. These failed reactions were limited to three species: Centropristis striata, T. maculatus, and Amphioctopus sp.

The overall success rate of sequencing was also high, with 92.5% of reactions producing sequences longer than 500 bp and with Q20 scores greater than 98% (S2 Table). Specifically, 7 (5.6%), 11 (8.8%), and 10 (8.0%) of 125 reactions each from extracts of EDTA-thawed, EtOH-thawed, and frozen tissues were unsuccessful, respectively. These failed reactions were limited to eight species—six fishes and two invertebrates. Note that all sequencing reactions for T. maculatus were unsuccessful, regardless of treatment. In all cases, successful sequences from the same organism were identical regardless of treatment. Additionally, sequencing revealed that two species of octopus, Amphioctopus aegina (N = 8) and A. fangsiao (N = 2), were present among our specimens although they were all purchased as A. membranaceus. These are closely related sister species and so were grouped together as Amphioctopus sp. in our analysis.

Discussion

Cryopreservation is one of the most common ways that individual researchers and curators of biological collections preserve tissues for genetic and genomic research applications [2]. Under optimal conditions, cryopreservation can indefinitely maintain DNA integrity in tissues [8,46,47]. Storage in liquid nitrogen dewars (-196°C) is considered best for HMW DNA preservation, effectively halting enzymatic and chemical activity [5]. Storage in ultracold freezers (-80°C) dramatically reduces but does not entirely halt enzymatic activity, so gradual DNA degradation may still occur [8,46,48]. Nonetheless, storage at -80°C is an excellent option that can preserve DNA in tissues for decades [48]. Storage at -20°C in standard laboratory freezers may also be suitable for shorter-term preservation of HMW DNA in tissues [8].

However, because most DNA extractions are performed in liquid media, frozen tissue samples must typically be thawed either before or during DNA extraction, potentially exposing their DNA to chemical or enzymatic degradation. In this investigation, we show that thawing frozen tissues in EDTA (250 mM, pH 10) and maintaining them in this preservative overnight at 4°C can significantly improve the recovery of HMW DNA from those tissues. For eight of the 10 fish and invertebrate species examined, %HMW values were up to three-fold greater in DNA extracts from EDTA-treated tissues compared to extracts from untreated frozen tissues. Similarly, nY values were improved up to eight-fold in extracts from five of the 10 species examined compared to extracts prepared directly from frozen tissues. Indeed, we observed significant improvement in %HMW, nY, or both in nine of the 10 species examined.

Importantly, we observed no significant decreases in %HMW or nY values for extracts of EDTA-thawed tissues compared to those extracted directly from frozen tissues, nor were harmful effects observed on PCR amplification or DNA sequencing. Indeed, success rates for PCR amplification and Sanger sequencing of the mitochondrial COI gene were highest for DNA extracts from tissues thawed in EDTA.

Furthermore, EDTA treatment was effective in improving recovery of HMW DNA from a variety of frozen tissue types across a broad range of taxa. Significant improvements in %HMW, nY, or both were observed in tissue types derived from dorsal musculature, tentacles, mantle, and abdominal musculature from representatives of three phyla (Chordata, Mollusca, and Arthropoda), including 5 fish and 4 invertebrate species. Additionally, we saw qualitative evidence for reduced DNA degradation in extracts of EDTA-thawed samples from an additional six fish species where statistical analyses were not performed.

In contrast, EtOH treatment provided little or no protection for DNA during the transition from frozen tissue to purified DNA. Specifically, for nine of the 10 species examined, average %HMW values for extracts from EtOH-thawed tissues were not significantly different or were significantly lower than those from frozen tissues. The same is true for nY in all 10 species.

Interestingly, thawing frozen tissue samples in EDTA prior to DNA extraction improved recovery of HMW DNA from frozen tissues maintained under a range of cryostorage conditions. For example, %HMW and nY values were significantly improved for H. americanus and Mercenaria mercenaria, which were stored at -80°C for two years, as well as C. striata, which was stored under less ideal conditions at -23°C for nine years. These results indicate that regardless of freezer storage conditions, EDTA treatment can improve the recovery of HMW DNA.

In conclusion, our results indicate that, although cryopreservation can provide excellent protection for HMW DNA, substantial DNA degradation can occur during the preparation of frozen tissues for DNA extraction. In these experiments, we took care to minimize the thawing of frozen tissues before DNA extraction by working quickly and subsampling tissues on a chilled aluminum plate. Nonetheless, we observed substantial DNA degradation in most extracts prepared directly from frozen tissues. While this degradation might have been reduced by performing the tissue dissections under colder conditions, e.g., in liquid nitrogen or on dry ice, such stringent conditions are difficult, inconvenient, dangerous, and expensive to maintain. Our results show that thawing frozen tissues in EDTA provides a convenient alternative that reduces DNA degradation and allows tissues to be safely subsampled, weighed, and handled at room temperature with significantly reduced DNA degradation.

Finally, we note that tissues of different types and taxonomic origin may vary widely in physical, chemical, and biological properties, e.g., hardness, surface area to volume ratio, permeability, pH, chemical composition, enzymatic activity, etc., and that these properties can influence the performance of preservative treatments. Nonetheless, in this investigation, EDTA improved the recovery of HMW DNA across a wide variety of marine animal species and tissues, suggesting the potential of this method for broader application. Further investigation is warranted to determine if EDTA treatment can improve DNA recovery from frozen tissues of other marine and non-marine organisms across the tree of life, thereby adding value to the enormous variety of samples held in frozen research collections worldwide.

Supporting information

S1 Fig. Visualization of DNA extracts by gel electrophoresis for 10 marine species.

DNA was extracted from frozen tissue samples collected from each of 10 individuals of 10 marine species (five marine fishes and five marine invertebrates) that were thawed in EDTA (250 mM, pH 10; lanes 1–10) or ethanol (95%; lanes 11–20) overnight at 4°C or extracted directly from frozen tissues without subsequent liquid preservative treatment (lanes 21–30). Lanes marked with an L contain 0.66 μL of Quick Load Purple 1 kb Plus DNA Ladder (100 μg/mL; New England Biolabs; Ipswich, MA), except for Centropristis striata, for which lanes marked with an L contain 1 μL of Quick Load Purple 1 kb Plus DNA Ladder. Specimens are presented in the same order across all treatments.

(PDF)

pone.0321872.s001.pdf^{(5.1MB, pdf)}

S2 Fig. Qualitative visualization of DNA extracts from six additional fish species by gel electrophoresis.

DNA was extracted from tissues of six additional marine fish species that were thawed in EDTA (250 mM, pH 10; lanes 1–2) or ethanol (95%; lanes 3–4) overnight at 4°C or extracted directly from frozen tissues without subsequent liquid preservative treatment (lanes 5–6) from two randomly selected specimens of each species. Lanes marked with an L contain 0.66 μL of Quick Load Purple 1 kb Plus DNA Ladder (100 μg/mL; New England Biolabs; Ipswich, MA). Specimens are presented in the same order across all treatments.

(PDF)

pone.0321872.s002.pdf^{(1.3MB, pdf)}

S3 Fig. Raw gel images for S1 Fig.

DNA was extracted from frozen tissue samples collected from each of 10 individuals of 10 marine species (five marine fishes and five marine invertebrates) that were thawed in EDTA (250 mM, pH 10; lanes 21–30) or ethanol (95%; lanes 11–20) overnight at 4°C or extracted directly from frozen tissues without subsequent liquid preservative treatment (lanes 1–10). Lanes marked with an L contain either 0.33 or 0.66 μL of Quick Load Purple 1 kb Plus DNA Ladder (100 μg/mL; New England Biolabs; Ipswich, MA), except for Centropristis striata, for which lanes marked with an L contain 1 μL of Quick Load Purple 1 kb Plus DNA Ladder. Specimens are presented in the same order across all treatments. Dashes indicate empty lanes.

(PDF)

pone.0321872.s003.pdf^{(2.7MB, pdf)}

S4 Fig. Raw gel images for S2 Fig.

DNA was extracted from tissues of six additional marine fish species that were thawed in EDTA (250 mM, pH 10; lanes 3–4) or ethanol (95%; lanes 5–6) overnight at 4°C or extracted directly from frozen tissues without subsequent liquid preservative treatment (lanes 1–2) from two randomly selected specimens of each species. Lanes marked with an L contain 0.66 μL of Quick Load Purple 1 kb Plus DNA Ladder (100 μg/mL; New England Biolabs; Ipswich, MA). Specimens are presented in the same order across all treatments.

(PDF)

pone.0321872.s004.pdf^{(391.4KB, pdf)}

S1 Table. Specimen information.

Taxonomic, source, collection, and storage information as well as Ocean Genome Legacy (OGL) catalog and NCBI accession numbers are presented for specimens of 16 marine fish and invertebrate species. N/a indicates samples for which NCBI accession numbers were not assigned due to sequencing failures.

(PDF)

pone.0321872.s005.pdf^{(71.6KB, pdf)}

S2 Table. Supporting data.

Supporting data are presented for DNA extracts of tissues from specimens of 16 marine fish and invertebrate species that were thawed in EDTA (250 mM, pH 10) or ethanol (95%) overnight at 4°C or extracted directly from frozen tissues without subsequent liquid preservative treatment. Specifically, species, sample ID, specimen and replicate numbers, treatments, initial and post-treatment sample weights, correction ratios, measured and corrected weights of tissue subsamples used for DNA extraction, A₂₆₀, A₂₆₀/A₂₈₀ ratios, and A₂₆₀/A₂₃₀ ratios calculated using the Nanodrop 1000 droplet spectrophotometer, total and low molecular weight (150 bp–10kb) DNA concentration values determined by the Agilent Tapestation DNA Analyzer 2200, percentages of low molecular weight (%LMW) and high molecular weight (%HMW) DNA and nY calculated based on Tapestation data, as well as mitochondrial COI PCR amplification and sequencing success are presented for each DNA sample analyzed in this study. N/a indicates samples for which data were not collected.

(PDF)

pone.0321872.s006.pdf^{(153.1KB, pdf)}

Acknowledgments

We thank Bob and Eileen Matz, the Comb family, Emily Condon and the Northeastern University co-op program, the Northeastern University Marine Science Center community, and the many others who have supported the Ocean Genome Legacy Center at Northeastern University. We would also like to thank the Connecticut Department of Energy and Environmental Protection, the National Oceanic and Atmospheric Administration Fisheries, and the Grabowski lab at Northeastern University for donating specimens used in this study.

Data Availability

All relevant data are within the manuscript and its Supporting Information files except sequence data, which are deposited to NCBI Nucleotide Database under the accession numbers listed in S1 Table.

Funding Statement

This work was funded by a grant from Cell Signaling Technologies Inc. Annual Research Grant Program ( to DLD) and received support from the Donald Comb Research Scholarship Fund (to DLD), the Ocean Genome Legacy Operations Fund (to DLD), and the Francis Goelet Charitable Lead Trust (to DLD). Resources purchased with funds from the National Science Foundation’s Field Stations and Marine Laboratories program (DBI 1722553 to Northeastern University) were used to generate data for this manuscript. The funders had no role in study design, data collection and analysis, decision to publish, or manuscript preparation.

References

1.Blom MPK. Opportunities and challenges for high-quality biodiversity tissue archives in the age of long-read sequencing. Mol Ecol. 2021;30(23):5935–48. doi: 10.1111/mec.15909 [DOI] [PubMed] [Google Scholar]
2.Card D, Shapiro B, Giribet G, Moritz C, Edwards S. Museum genomics. Annu Rev Genet. 2021;55:633–59. [DOI] [PubMed] [Google Scholar]
3.Minich JJ, Moore ML, Allsing NA, Aylward A, Murray ER, Tran L, et al. Generating high-quality plant and fish reference genomes from field-collected specimens by optimizing preservation. Commun Biol. 2023;6(1):1246. doi: 10.1038/s42003-023-05615-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
4.Phillips CD, Dunnum JL, Dowler RC, Bradley LC, Garner HJ, MacDonald KA, et al. Curatorial guidelines and standards of the American Society of Mammalogists for collections of genetic resources. J Mammalogy. 2019;100(5):1690–4. doi: 10.1093/jmammal/gyz111 [DOI] [Google Scholar]
5.Zimkus BM, Ford LS. Best practices for genetic resources associated with natural history collections: Recommendations for practical implementation. Collection Forum. 2014;28(1–2):77–112. doi: 10.14351/0831-0005-28.1.77 [DOI] [Google Scholar]
6.Jackson JA, Laikre L, Baker CS, Kendall KC. Guidelines for collecting and maintaining archives for genetic monitoring. Conservation Genet Resour. 2011;4(2):527–36. doi: 10.1007/s12686-011-9545-x [DOI] [Google Scholar]
7.Zimkus BM, Ford LS, editors. Genetic resource collections associated with natural history museums: A survey and analysis to establish a benchmark of standards. DNA Banking for the 21st Century: Proceedings of the US Workshop on DNA Banking; 2014 2014-01: The William L. Bowen Center at the Missouri Botanical Garden. [Google Scholar]
8.Nagy ZT. A hands-on overview of tissue preservation methods for molecular genetic analyses. Org Divers Evol. 2010;10(1):91–105. doi: 10.1007/s13127-010-0012-4 [DOI] [Google Scholar]
9.Oosting T, Hilario E, Wellenreuther M, Ritchie PA. DNA degradation in fish: Practical solutions and guidelines to improve DNA preservation for genomic research. Ecol Evol. 2020;10(16):8643–51. doi: 10.1002/ece3.6558 [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Dahn HA, Mountcastle J, Balacco J, Winkler S, Bista I, Schmitt AD, et al. Benchmarking ultra-high molecular weight DNA preservation methods for long-read and long-range sequencing. Gigascience. 2022;11:giac068. doi: 10.1093/gigascience/giac068 [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Hanner R, Corthals A, Dessauer HC. Salvage of genetically valuable tissues following a freezer failure. Mol Phylogenet Evol. 2005;34(2):452–5. doi: 10.1016/j.ympev.2004.10.008 [DOI] [PubMed] [Google Scholar]
12.Wang TY, Wang L, Zhang JH, Dong WH. A simplified universal genomic DNA extraction protocol suitable for PCR. Genet Mol Res. 2011;10(1):519–25. doi: 10.4238/vol10-1gmr1055 [DOI] [PubMed] [Google Scholar]
13.Athanasio CG, Chipman JK, Viant MR, Mirbahai L. Optimisation of DNA extraction from the crustacean Daphnia. PeerJ. 2016;4:e2004. doi: 10.7717/peerj.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Fan H, Gulley ML. DNA extraction from fresh or frozen tissues. In: Killeen AA, editor. Mol Pathol Protoc. Totowa, NJ: Humana Press; 2001. p. 5–10. [DOI] [PubMed] [Google Scholar]
15.Dessauer H, Cole C, Hafner M. Collection and storage of tissues. Mol Syst. 1996:29–47. [Google Scholar]
16.Kilpatrick CW. Noncryogenic preservation of mammalian tissues for DNA extraction: an assessment of storage methods. Biochem Genet. 2002;40(1–2):53–62. doi: 10.1023/a:1014541222816 [DOI] [PubMed] [Google Scholar]
17.DeSanctis ML, Soranno EA, Messner E, Wang Z, Turner EM, Falco R, et al. Greater than pH 8: The pH dependence of EDTA as a preservative of high molecular weight DNA in biological samples. PLoS One. 2023;18(1):e0280807. doi: 10.1371/journal.pone.0280807 [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Sharpe A, Barrios S, Gayer S, Allan-Perkins E, Stein D, Appiah-Madson HJ, et al. DESS deconstructed: Is EDTA solely responsible for protection of high molecular weight DNA in this common tissue preservative? PLoS One. 2020;15(8):e0237356. doi: 10.1371/journal.pone.0237356 [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Seutin G, White BN, Boag PT. Preservation of avian blood and tissue samples for DNA analyses. Can J Zool. 1991;69(1):82–90. doi: 10.1139/z91-013 [DOI] [Google Scholar]
20.Carvalhais LC, Dennis PG, Poudel A, Birt HWG, Bhuiyan SA, Card SD, et al. Simple solution to preserve plant samples for microbiome analyses. Mol Ecol Resour. 2022;22(3):1055–64. doi: 10.1111/1755-0998.13538 [DOI] [PubMed] [Google Scholar]
21.Dawson MN, Raskoff KA, Jacobs DK. Field preservation of marine invertebrate tissue for DNA analyses. Mol Mar Biol Biotechnol. 1998;7(2):145–52. [PubMed] [Google Scholar]
22.Gaither MR, Szabó Z, Crepeau MW, Bird CE, Toonen RJ. Preservation of corals in salt-saturated DMSO buffer is superior to ethanol for PCR experiments. Coral Reefs. 2010;30(2):329–33. doi: 10.1007/s00338-010-0687-1 [DOI] [Google Scholar]
23.Gordeeva NV, Kobyliansky SG, Evseenko SA. A method for fixation of fish larvae for morphological and genetic studies. J Ichthyol. 2019;59(5):818–22. doi: 10.1134/s0032945219050035 [DOI] [Google Scholar]
24.Lee KM, Adams M, Klassen JL. Evaluation of DESS as a storage medium for microbial community analysis. PeerJ. 2019;7:e6414. doi: 10.7717/peerj.6414 [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Michaud CL, Foran DR. Simplified field preservation of tissues for subsequent DNA analyses. J Forensic Sci. 2011;56(4):846–52. doi: 10.1111/j.1556-4029.2011.01771.x [DOI] [PubMed] [Google Scholar]
26.Mulcahy DG, Macdonald KS 3rd, Brady SG, Meyer C, Barker KB, Coddington J. Greater than X kb: a quantitative assessment of preservation conditions on genomic DNA quality, and a proposed standard for genome-quality DNA. PeerJ. 2016;4:e2528. doi: 10.7717/peerj.2528 [DOI] [PMC free article] [PubMed] [Google Scholar]
27.Tatangelo V, Franzetti A, Gandolfi I, Bestetti G, Ambrosini R. Effect of preservation method on the assessment of bacterial community structure in soil and water samples. FEMS Microbiol Lett. 2014;356(1):32–8. doi: 10.1111/1574-6968.12475 [DOI] [PubMed] [Google Scholar]
28.Kolarevic A, Yancheva D, Kocic G, Smelcerovic A. Deoxyribonuclease inhibitors. Eur J Med Chem. 2014;88:101–11. doi: 10.1016/j.ejmech.2014.07.040 [DOI] [PubMed] [Google Scholar]
29.Guéroult M, Picot D, Abi-Ghanem J, Hartmann B, Baaden M. How cations can assist DNase I in DNA binding and hydrolysis. PLoS Comput Biol. 2010;6(11):e1001000. doi: 10.1371/journal.pcbi.1001000 [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Falco R, Appiah-Madson HJ, Distel DL. The Ocean Genome Legacy: a genomic resource repository for marine life. Biopreserv Biobank. 2022;20(1):104–6. doi: 10.1089/bio.2021.0148 [DOI] [PubMed] [Google Scholar]
31.Cicero C, Koo MS, Braker E, Abbott J, Bloom D, Campbell M, et al. Arctos: Community-driven innovations for managing natural and cultural history collections. PLoS One. 2024;19(5):e0296478. doi: 10.1371/journal.pone.0296478 [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Wahltinez SJ, Stacy NI, Hadfield CA, Harms CA, Lewbart GA, Newton AL, et al. Perspective: Opportunities for advancing aquatic invertebrate welfare. Front Vet Sci. 2022;9:973376. doi: 10.3389/fvets.2022.973376 [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Conte F, Voslarova E, Vecerek V, Elwood R, Coluccio P, Pugliese M. Humane slaughter of edible decapod crustaceans. Animals. 2021;11(4). [DOI] [PMC free article] [PubMed] [Google Scholar]
34.RStudio Team. RStudio: Integrated development for R. Boston, MA: RStudio, PBC; 2020. [Google Scholar]
35.R Core Team. R: A language and environment for statistical computing. Vienna, Austria: R Foundation for Statistical Computing; 2021. [Google Scholar]
36.Wickham H, Averick M, Bryan J, Chang W, McGowan L, François R, et al. Welcome to the tidyverse. JOSS. 2019;4(43):1686. doi: 10.21105/joss.01686 [DOI] [Google Scholar]
37.Dinno A. conover.test: conover-iman test of multiple comparisons using rank sums. 2024.
38.Graves S, Piepho H-P, Selzer L, Dorai-Raj S. multcompview: visualizations of paired comparisons. 2024.
39.Wilke CO. cowplot: Streamlined plot theme and plot annotations for ‘ggplot2’. 2024.
40.Wickham H. stringr: Simple, consistent wrappers for common string operations. 2023.
41.Kassambara A. rstatix: Pipe-friendly framework for basic statistical tests. 2023.
42.Hebert PDN, Ratnasingham S, deWaard JR. Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proc Biol Sci. 2003;270 Suppl 1(Suppl 1):S96-9. doi: 10.1098/rsbl.2003.0025 [DOI] [PMC free article] [PubMed] [Google Scholar]
43.Handy SM, Deeds JR, Ivanova NV, Hebert PDN, Hanner RH, Ormos A, et al. A single-laboratory validated method for the generation of DNA barcodes for the identification of fish for regulatory compliance. J AOAC Int. 2011;94(1):201–10. doi: 10.1093/jaoac/94.1.201 [DOI] [PubMed] [Google Scholar]
44.Foottit RG, Maw HEL, Havill NP, Ahern RG, Montgomery ME. DNA barcodes to identify species and explore diversity in the Adelgidae (Insecta: Hemiptera: Aphidoidea). Mol Ecol Resour. 2009;9 Suppl s1:188–95. doi: 10.1111/j.1755-0998.2009.02644.x [DOI] [PubMed] [Google Scholar]
45.Sayers EW, Bolton EE, Brister JR, Canese K, Chan J, Comeau DC, et al. Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 2022;50(D1):D20–6. doi: 10.1093/nar/gkab1112 [DOI] [PMC free article] [PubMed] [Google Scholar]
46.Corthals A, Desalle R. An application of tissue and DNA banking for genomics and conservation: the Ambrose Monell Cryo-Collection (AMCC). Syst Biol. 2005;54(5):819–23. doi: 10.1080/10635150590950353 [DOI] [PubMed] [Google Scholar]
47.Kelly R, Albert M, de Ladurantaye M, Moore M, Dokun O, Bartlett JMS. RNA and DNA integrity remain stable in frozen tissue after long-term storage at cryogenic temperatures: a report from the Ontario Tumour Bank. Biopreserv Biobank. 2019;17(4):282–7. doi: 10.1089/bio.2018.0095 [DOI] [PubMed] [Google Scholar]
48.Soniat TJ, Sihaloho HF, Stevens RD, Little TD, Phillips CD, Bradley RD. Temporal-dependent effects of DNA degradation on frozen tissues archived at −80°C. J Mammalogy. 2021;102(2):375–83. doi: 10.1093/jmammal/gyab009 [DOI] [Google Scholar]

PLoS One. 2025 Jun 3;20(6):e0321872. doi: 10.1371/journal.pone.0321872.r001

Author response to Decision Letter 0

1 Oct 2024

PLoS One. doi: 10.1371/journal.pone.0321872.r002

Decision Letter 0

Shailender Kumar Verma

8 Jan 2025

PONE-D-24-43598Perish the thawed? EDTA reduces DNA degradation during extraction from frozen tissue.PLOS ONE

Dear Dr. Distel,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Feb 22 2025 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org . When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols . Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols .

We look forward to receiving your revised manuscript.

Kind regards,

Shailender Kumar Verma, Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

1. When submitting your revision, we need you to address these additional requirements.

Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. To comply with PLOS ONE submissions requirements, in your Methods section, please provide additional information regarding the experiments involving animals and ensure you have included details on (a) methods of sacrifice, (b) methods of anesthesia and/or analgesia, and (c) efforts to alleviate suffering.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: No

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The manuscript addresses an important issue in DNA preservation during tissue thawing, offering a potential solution using EDTA. The study's relevance is significant for genomic and genetic research, especially in cryopreserved biological samples.

There are several questions.

1. Why was the focus placed specifically on EDTA and ethanol (EtOH)? Were other preservatives considered but excluded, and if so, why?

2. What novel insights does this study add beyond previous research on EDTA in DNA preservation?

3�Explain why authors chose these 10 organisms as target species.

4.Were any controls implemented to account for potential variability in tissue type (muscle vs. visceral mass)? Could tissue composition impact the efficacy of EDTA treatment?

5. Is there variability in tissue degradation across species that could confound the interpretation of EDTA's effectiveness? Would standardized storage conditions for all species improve the reliability of cross-species comparisons?

6. What mechanisms might explain the species-specific variations observed in DNA preservation? Expand on potential biological or chemical factors.

7. How does this study inform protocols for non-marine or plant tissues? Discuss the generalizability of findings to other types of biological samples.

Reviewer #2: This study presents a comparative analysis of the effects of EDTA and ethanol on the preservation of high-molecular-weight (HMW) DNA in frozen tissues. The authors hypothesize that EDTA, known for its metal chelation properties, can reduce DNA degradation during the thawing process, which is a common step in DNA extraction that can lead to DNA damage. The study involved ten marine species, with tissues treated with EDTA at pH 10 or ethanol, and then analyzed for HMW DNA recovery. The results indicate that EDTA, particularly at pH 10, significantly improves the recovery of HMW DNA compared with that of ethanol and untreated tissues. These findings suggest that EDTA treatment can be a simple and effective method to increase DNA recovery from frozen tissues, which has implications for genetic and genomic research. Before this manuscript can be published, several questions need to be addressed:

1. Since EDTA is one of the primary active ingredients of DESS, why not compare it with DESS instead of choosing ethanol for comparison?

2. In the Materials and methods section, the authors describe taking 100 mg of tissue and adding EDTA or ethanol, then placing it at 4°C for 12-24 hours before dividing it into 25 mg pieces for DNA extraction. Therefore, what is the purpose of the remaining three 25 mg tissues? If only 25 mg is used for testing, would not it be better to directly immerse the 25 mg tissue into EDTA or ethanol for better protection of DNA? Please provide a detailed explanation.

3. Regarding the above question, does the N=10 in Figure 1 refer to 10 marine fish or 10 marine invertebrate species, or is it 10 samples taken for testing? The S1 Table shows 10 fish, whereas the S2 Table shows 10 measurements for each treatment.

4. Lines 198-200: The authors calculated the concentration of HMW DNA for each sample by subtracting the low molecular weight DNA concentration from the total concentration of DNA present. However, quantitative results of the total DNA concentration and the low molecular weight DNA concentration are lacking. Please supplement more detailed data on how to calculate the concentration of HMW DNA.

5. Lines 195-215 & S2 Table: Table S2 shows only the raw results of the Nanodrop 1000. The %HMW and nY values were calculated from the DNA concentration analyzed via the Agilent Technologies TapeStation 2200 DNA Analyzer. Please provide raw results from Agilent and the detailed data on how to calculate the concentration of HMW DNA. In addition, why are not Agilent's results provided in S2 Fig?

6. Lines 301--304: For four of the five invertebrate species (Amphioctopus sp., H. americanus, M. gigas, and P. vannamei), the %HMW values of DNA extracts from EtOH-thawed tissues were the same as or significantly lower than those from frozen tissues. However, for H. americanus, as shown in Fig. 2, the %HMW value from EtOH-thawed tissues was obviously higher than that from frozen tissues. Please clarify further.

7. Line 159: The samples were stored in preservative for 12 to 24 hours at 4°C. This means that the thawing times of the samples in the preservatives were inconsistent. Therefore, are the data in manuscript accurately compared under the same variable?

8. Lines 147--151: Tissue samples were collected from different tissue parts of different species, such as the musculature posterior to the pectoral fin, tentacles, visceral mass, and mantle. Does the difference between tissue samples affect the determined results and conclusions?

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean? ). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy .

Reviewer #1: No

Reviewer #2: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/ . PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org . Please note that Supporting Information files do not need this step.

PLoS One. 2025 Jun 3;20(6):e0321872. doi: 10.1371/journal.pone.0321872.r003

Author response to Decision Letter 1

3 Feb 2025

PONE-D-24-43598

Perish the thawed? EDTA reduces DNA degradation during extraction from frozen tissue.

PLOS ONE

Shailender Kumar Verma, Ph.D.

Academic Editor

PLOS ONE

Dear Dr. Verma,

We thank you and reviewers 1 and 2 for providing insightful comments on our manuscript. As requested, we have revised the manuscript to address the concerns of each reviewer. We hope you agree that these changes have substantially improved the manuscript. In the following letter, you will find detailed responses to each reviewer’s questions. Author responses are in red typeface (in the pdf version, text formatting is not supported here) and identified with line numbers corresponding to the edits in the clean manuscript copy.

Reviewer #1: The manuscript addresses an important issue in DNA preservation during tissue thawing, offering a potential solution using EDTA. The study's relevance is significant for genomic and genetic research, especially in cryopreserved biological samples.

There are several questions.

1. Why was the focus placed specifically on EDTA and ethanol (EtOH)?

We have modified the text on lines 73-75 and 81-84 to explain why we focus specifically on EDTA and EtOH in this investigation.

Lines 73-75: We chose to evaluate EtOH as it is the most commonly used tissue preservative compatible with DNA preservation. It is widely employed for field collection and long-term storage of biological materials, particularly in natural history collections.

Lines 81-84: We chose to evaluate EDTA as it is a common ingredient in many preservative solutions (Nagy 2010) and is the primary active ingredient (Sharpe et al. 2020) in DESS (Seutin et al. 1991), a widely used tissue preservative that is as or more effective than EtOH in preventing DNA degradation in tissues from a wide range of organisms.

Were other preservatives considered but excluded, and if so, why?

We did not consider other preservatives. We agree that it would be very interesting to compare these two preservatives to others and don’t doubt that other preservatives may have similar or superior effects. It is simply beyond the scope of this investigation and the limits of our resources to compare EDTA and EtOH to a wider range of preservatives. However, because we compared the results of EDTA with those of EtOH, we can say that not every preservative will improve HMW DNA recovery from frozen tissue.

2. What novel insights does this study add beyond previous research on EDTA in DNA preservation?

Although freezing is typically considered the gold standard in DNA preservation, tissues must be thawed before DNA extraction. During the thawing period, even if brief, extensive DNA degradation can occur. The insight we provide is that 250 mM EDTA, pH 10, when applied to frozen tissue, is an easy, inexpensive, and effective way to mitigate this degradation.

3. Explain why authors chose these 10 organisms as target species.

We modified lines 111-116 to better explain our choice of species. Our aim was to test the efficacy of EDTA and EtOH for improving the recovery of HMW DNA from a broad range of taxa. We sampled specimens of 16 species selected to represent a wide range of animal taxa. These species included members of 16 genera, 12 families, and three phyla (S1 Table).

Lines 111-116: In this investigation, we sampled a wide range of species, storage conditions, and tissues to reflect a diverse selection of materials from which researchers may wish to isolate high molecular weight DNA. We chose 16 species that represent a wide range of animal taxa, including members of 16 genera, 12 families, and three phyla (S1 Table).

4. Were any controls implemented to account for potential variability in tissue type (muscle vs. visceral mass)?

We controlled for tissue type in every statistical model employed in this investigation by only comparing tissues of the same type and from the same species. For example, preservative-treated dorsal muscle samples from black seabass were compared only to untreated dorsal muscle tissue from black seabass, never to other tissue types or tissues from other species.

Could tissue composition impact the efficacy of EDTA treatment?

We agree with the reviewer that tissue composition likely impacts the efficacy of EDTA treatment. To acknowledge this, we added the following text:

Lines 446-449: Finally, we note that tissues of different types and taxonomic origin may vary widely in physical, chemical, and biological properties, e.g., hardness, surface area to volume ratio, permeability, pH, chemical composition, enzymatic activity, etc., and that these properties can influence the performance of preservative treatments.

To account for tissue-specific differences, we only made comparisons among tissues of the same type. However, it is encouraging that we observed significant improvement in HMW DNA recovery (%HMW, nY, or both) in frozen tissues treated with EDTA compared to untreated tissues in nine of 10 species examined, as we now state in lines 404-405. This indicates that EDTA treatment is effective across multiple tissues and storage conditions.

Lines 404-405: Indeed, we observed significant improvement in %HMW, nY, or both in nine of the 10 species examined.

5. Is there variability in tissue degradation across species that could confound the interpretation of EDTA's effectiveness?

We agree with the reviewer that species-specific differences in tissue degradation likely impact the effectiveness of EDTA. This is addressed in the text added on lines 446-449 (see above). To account for species-specific differences, we only made statistical comparisons among tissues from the same species. Because we tested each of the 10 species independently, differences among species do not impact our conclusion that EDTA treatment improves HMW DNA recovery from the frozen tissues of these species.

Would standardized storage conditions for all species improve the reliability of cross-species comparisons?

Standardized storage conditions would indeed improve the reliability of cross-species comparisons, and this would be an interesting subject for a follow-up study. However, in this investigation we tested EDTA treatment on tissues of each species independently. Our aim was to determine if this treatment was effective across many species, tissues and storage conditions rather than to compare the relative effectiveness among species, tissues and storage conditions.

6. What mechanisms might explain the species-specific variations observed in DNA preservation? Expand on potential biological or chemical factors.

We added a paragraph, lines 446-454 to address potential physical, chemical, and biological factors that might influence DNA preservation.

Lines 446-454 Finally, we note that tissues of different types and taxonomic origin may vary widely in physical, chemical, and biological properties, e.g., hardness, surface area to volume ratio, permeability, pH, chemical composition, enzymatic activity, etc., and that these properties can influence the performance of preservative treatments. Nonetheless, in this investigation, EDTA improved the recovery of HMW DNA across a wide variety of marine animal species and tissues, suggesting the potential of this method for broader application. Further investigation is warranted to determine if EDTA treatment can improve DNA recovery from frozen tissues of other marine and non-marine organisms across the tree of life, thereby adding value to the enormous variety of samples held in frozen research collections worldwide.

7. How does this study inform protocols for non-marine or plant tissues? Discuss the generalizability of findings to other types of biological samples.

We also address this question in the new paragraph on lines 446-454 (see above).

Reviewer #2: This study presents a comparative analysis of the effects of EDTA and ethanol on the preservation of high-molecular-weight (HMW) DNA in frozen tissues. The authors hypothesize that EDTA, known for its metal chelation properties, can reduce DNA degradation during the thawing process, which is a common step in DNA extraction that can lead to DNA damage. The study involved ten marine species, with tissues treated with EDTA at pH 10 or ethanol, and then analyzed for HMW DNA recovery. The results indicate that EDTA, particularly at pH 10, significantly improves the recovery of HMW DNA compared with that of ethanol and untreated tissues. These findings suggest that EDTA treatment can be a simple and effective method to increase DNA recovery from frozen tissues, which has implications for genetic and genomic research. Before this manuscript can be published, several questions need to be addressed:

1. Since EDTA is one of the primary active ingredients of DESS, why not compare it with DESS instead of choosing ethanol for comparison?

We have modified the text on lines 73-75 and 81-84 to explain why we focus specifically on EDTA and EtOH in this investigation.

In our previously published work (Sharpe et al. 2020), we compared EDTA to DESS and each of the components of DESS individually and in pairwise combinations. That investigation showed that EDTA is the sole active ingredient in DESS. Moreover, DESS never outperformed EDTA and, in some cases, performed more poorly. Therefore, we concluded that comparing EDTA, the sole active ingredient in DESS, to DESS would not be as informative as comparing to EtOH, which acts by different chemical mechanisms.

We modified lines 170-172 to clarify that one 25 mg subsample was removed from each 100 mg sample for DNA extraction. We chose 25 mg for DNA extraction because this is the optimal weight for the Qiagen DNEasy Blood and Tissue kit.

Lines 170-172: Subsequently, a 25 mg (avg. = 25.5 � 3.4 mg) subsample was removed from each 100 mg sample and transferred to the Qiagen DNeasy Blood and Tissue kit (Hilden, Germany) lysis solution for DNA extraction.

If only 25 mg is used for testing, would not it be better to directly immerse the 25 mg tissue into EDTA or ethanol for better protection of DNA? Please provide a detailed explanation.

We agree that a smaller (25 mg) piece of tissue would have a larger surface area to volume ratio and a shorter diffusion distance from its surface to its center, both of which might have made liquid preservation more effective. However, these same properties would also make the smaller samples thaw much more quickly, making it more likely that they might thaw accidentally before the preservative can be applied. The larger 100 mg samples are also easier to collect and handle. Since we aim to produce a practical method for most researchers, we decided that opting for 100 mg samples for treatment and 25 mg subsamples for DNA extraction was a reasonable tradeoff.

3. Regarding the above question, does the N=10 in Figure 1 refer to 10 marine fish or 10 marine invertebrate species, or is it 10 samples taken for testing?

We have modified Figure 1 and the associated figure legend to make the sampling scheme clearer.

Lines 140-145: Fig 1. Experimental Design. Three frozen tissue samples were collected from each of ten individuals of ten marine species (five marine fishes and five marine invertebrates) for a total of 300 samples. One sample from each individual was then thawed in EDTA (250 mM, pH 10) overnight at 4°C and the second was thawed in ethanol (95%) overnight at 4°C, after which DNA was extracted, analyzed, and compared to DNA extracted directly from the third frozen tissue sample, which did not receive liquid preservative treatment.

The S1 Table shows 10 fish, whereas the S2 Table shows 10 measurements for each treatment.

S1 Table describes the specimens used in this study, including 10 individuals of 10 species that were analyzed statistically, plus smaller numbers of individuals from six additional species.

S2 Table lists all measurements recorded for every sample analyzed in this study, including three samples for each of 10 individuals of 10 species that were analyzed statistically, plus smaller numbers of individuals from six additional species.

We have added the requested data to S2 Table.

Please supplement more detailed data on how to calculate the concentration of HMW DNA.

Lines 200-224: We rewrote this section of the methods to better explain how we calculated %HMW and nY.

We have added the requested data to S2 Table.

In addition, why are not Agilent's results provided in S2 Fig?

As stated in lines 359-362, we used gel electrophoresis in S2 Fig to reveal qualitatively similar trends for DNA extracts from tissues of six additional fish species. Because this is intended as a qualitative comparison, we chose not to present quantitative Tapestation data. However, we have added the Tapestation data to the revised S2 Table.

Although the average value for %HMW is higher for EtOH than for fresh tissue of H. americanus in Figure 2, the difference is not statistically significant, as denoted by the same letters above the error bars. To clarify, we have changed the wording from “the same as” to “not significantly different from.”

Line 310-313: For four of the five invertebrate species (Amphioctopus sp., H. americanus, M. gigas, and P. vannamei), %HMW values of DNA extracts from EtOH-thawed tissues were not significantly different or significantly lower than those from frozen tissues.

We used “12 to 24” hours as a generous estimate for “overnight.” We have changed all instances of “for 12 to 24 hours” to “overnight.” Overnight incubations are common in preservative studies as they typically provide more than enough time for preservative penetration and so, for practical purposes, are considered to be of the same length. Although we did not evaluate incubation time as a variable in this investigation, we plan to do so in a future investigation to determine a “minimum recommended” incubation time for this procedure.

8. Lines 147--151: Tissue samples were collected from different tissue parts of different species, such as the musculature posterior to

Attachment

Submitted filename: Response to reviewers_PONE-D-24-43598.3.docx

pone.0321872.s008.docx^{(32.1KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0321872.r004

Decision Letter 1

Shailender Kumar Verma

12 Mar 2025

Perish the thawed? EDTA reduces DNA degradation during extraction from frozen tissue.

PONE-D-24-43598R1

Dear Dr. Distel,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice will be generated when your article is formally accepted. Please note, if your institution has a publishing partnership with PLOS and your article meets the relevant criteria, all or part of your publication costs will be covered. Please make sure your user information is up-to-date by logging into Editorial Manager at Editorial Manager® and clicking the ‘Update My Information' link at the top of the page. If you have any questions relating to publication charges, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Shailender Kumar Verma, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Reviewer #1: Authors have provided enough answers for my questions. I think that this manuscript could be accepted.

Reviewer #2: The authors have provided a detailed response to my comments, addressing each concern with clarity and justification. Their revisions to the manuscript are substantial and have significantly improved the overall quality and clarity of the research presented.

In their response, the authors have effectively addressed the concerns. For instance, they have provided a clear explanation for their choice of EDTA and ethanol (EtOH) as the focus of their study, emphasizing the practicality and relevance of these preservatives in the context of DNA preservation. They have also clarified the experimental design, particularly the use of 100 mg tissue samples for treatment and 25 mg subsamples for DNA extraction, which is a reasonable trade-off between practicality and effectiveness.

Overall, the revisions made to the manuscript have addressed the key issues, and the research presented is now more robust and clearly communicated. The study provides valuable insights into the use of EDTA as a preservative for improving HMW DNA recovery from frozen tissues, which has significant implications for genetic and genomic research.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean? ). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy .

Reviewer #1: No

Reviewer #2: Yes: Kaiyu Qian

**********

PLoS One. doi: 10.1371/journal.pone.0321872.r005

Acceptance letter

Shailender Kumar Verma

PONE-D-24-43598R1

PLOS ONE

Dear Dr. Distel,

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now being handed over to our production team.

At this stage, our production department will prepare your paper for publication. This includes ensuring the following:

* All references, tables, and figures are properly cited

* All relevant supporting information is included in the manuscript submission,

* There are no issues that prevent the paper from being properly typeset

If revisions are needed, the production department will contact you directly to resolve them. If no revisions are needed, you will receive an email when the publication date has been set. At this time, we do not offer pre-publication proofs to authors during production of the accepted work. Please keep in mind that we are working through a large volume of accepted articles, so please give us a few weeks to review your paper and let you know the next and final steps.

Lastly, if your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

If we can help with anything else, please email us at customercare@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Shailender Kumar Verma

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. Visualization of DNA extracts by gel electrophoresis for 10 marine species.

(PDF)

pone.0321872.s001.pdf^{(5.1MB, pdf)}

S2 Fig. Qualitative visualization of DNA extracts from six additional fish species by gel electrophoresis.

(PDF)

pone.0321872.s002.pdf^{(1.3MB, pdf)}

S3 Fig. Raw gel images for S1 Fig.

DNA was extracted from frozen tissue samples collected from each of 10 individuals of 10 marine species (five marine fishes and five marine invertebrates) that were thawed in EDTA (250 mM, pH 10; lanes 21–30) or ethanol (95%; lanes 11–20) overnight at 4°C or extracted directly from frozen tissues without subsequent liquid preservative treatment (lanes 1–10). Lanes marked with an L contain either 0.33 or 0.66 μL of Quick Load Purple 1 kb Plus DNA Ladder (100 μg/mL; New England Biolabs; Ipswich, MA), except for Centropristis striata, for which lanes marked with an L contain 1 μL of Quick Load Purple 1 kb Plus DNA Ladder. Specimens are presented in the same order across all treatments. Dashes indicate empty lanes.

(PDF)

pone.0321872.s003.pdf^{(2.7MB, pdf)}

S4 Fig. Raw gel images for S2 Fig.

(PDF)

pone.0321872.s004.pdf^{(391.4KB, pdf)}

S1 Table. Specimen information.

(PDF)

pone.0321872.s005.pdf^{(71.6KB, pdf)}

S2 Table. Supporting data.

(PDF)

pone.0321872.s006.pdf^{(153.1KB, pdf)}

Attachment

Submitted filename: Response to reviewers_PONE-D-24-43598.3.docx

pone.0321872.s008.docx^{(32.1KB, docx)}

Data Availability Statement

All relevant data are within the manuscript and its Supporting Information files except sequence data, which are deposited to NCBI Nucleotide Database under the accession numbers listed in S1 Table.

[pone.0321872.ref001] 1.Blom MPK. Opportunities and challenges for high-quality biodiversity tissue archives in the age of long-read sequencing. Mol Ecol. 2021;30(23):5935–48. doi: 10.1111/mec.15909 [DOI] [PubMed] [Google Scholar]

[pone.0321872.ref002] 2.Card D, Shapiro B, Giribet G, Moritz C, Edwards S. Museum genomics. Annu Rev Genet. 2021;55:633–59. [DOI] [PubMed] [Google Scholar]

[pone.0321872.ref003] 3.Minich JJ, Moore ML, Allsing NA, Aylward A, Murray ER, Tran L, et al. Generating high-quality plant and fish reference genomes from field-collected specimens by optimizing preservation. Commun Biol. 2023;6(1):1246. doi: 10.1038/s42003-023-05615-2 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0321872.ref004] 4.Phillips CD, Dunnum JL, Dowler RC, Bradley LC, Garner HJ, MacDonald KA, et al. Curatorial guidelines and standards of the American Society of Mammalogists for collections of genetic resources. J Mammalogy. 2019;100(5):1690–4. doi: 10.1093/jmammal/gyz111 [DOI] [Google Scholar]

[pone.0321872.ref005] 5.Zimkus BM, Ford LS. Best practices for genetic resources associated with natural history collections: Recommendations for practical implementation. Collection Forum. 2014;28(1–2):77–112. doi: 10.14351/0831-0005-28.1.77 [DOI] [Google Scholar]

[pone.0321872.ref006] 6.Jackson JA, Laikre L, Baker CS, Kendall KC. Guidelines for collecting and maintaining archives for genetic monitoring. Conservation Genet Resour. 2011;4(2):527–36. doi: 10.1007/s12686-011-9545-x [DOI] [Google Scholar]

[pone.0321872.ref007] 7.Zimkus BM, Ford LS, editors. Genetic resource collections associated with natural history museums: A survey and analysis to establish a benchmark of standards. DNA Banking for the 21st Century: Proceedings of the US Workshop on DNA Banking; 2014 2014-01: The William L. Bowen Center at the Missouri Botanical Garden. [Google Scholar]

[pone.0321872.ref008] 8.Nagy ZT. A hands-on overview of tissue preservation methods for molecular genetic analyses. Org Divers Evol. 2010;10(1):91–105. doi: 10.1007/s13127-010-0012-4 [DOI] [Google Scholar]

[pone.0321872.ref009] 9.Oosting T, Hilario E, Wellenreuther M, Ritchie PA. DNA degradation in fish: Practical solutions and guidelines to improve DNA preservation for genomic research. Ecol Evol. 2020;10(16):8643–51. doi: 10.1002/ece3.6558 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0321872.ref010] 10.Dahn HA, Mountcastle J, Balacco J, Winkler S, Bista I, Schmitt AD, et al. Benchmarking ultra-high molecular weight DNA preservation methods for long-read and long-range sequencing. Gigascience. 2022;11:giac068. doi: 10.1093/gigascience/giac068 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0321872.ref011] 11.Hanner R, Corthals A, Dessauer HC. Salvage of genetically valuable tissues following a freezer failure. Mol Phylogenet Evol. 2005;34(2):452–5. doi: 10.1016/j.ympev.2004.10.008 [DOI] [PubMed] [Google Scholar]

[pone.0321872.ref012] 12.Wang TY, Wang L, Zhang JH, Dong WH. A simplified universal genomic DNA extraction protocol suitable for PCR. Genet Mol Res. 2011;10(1):519–25. doi: 10.4238/vol10-1gmr1055 [DOI] [PubMed] [Google Scholar]

[pone.0321872.ref013] 13.Athanasio CG, Chipman JK, Viant MR, Mirbahai L. Optimisation of DNA extraction from the crustacean Daphnia. PeerJ. 2016;4:e2004. doi: 10.7717/peerj.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0321872.ref014] 14.Fan H, Gulley ML. DNA extraction from fresh or frozen tissues. In: Killeen AA, editor. Mol Pathol Protoc. Totowa, NJ: Humana Press; 2001. p. 5–10. [DOI] [PubMed] [Google Scholar]

[pone.0321872.ref015] 15.Dessauer H, Cole C, Hafner M. Collection and storage of tissues. Mol Syst. 1996:29–47. [Google Scholar]

[pone.0321872.ref016] 16.Kilpatrick CW. Noncryogenic preservation of mammalian tissues for DNA extraction: an assessment of storage methods. Biochem Genet. 2002;40(1–2):53–62. doi: 10.1023/a:1014541222816 [DOI] [PubMed] [Google Scholar]

[pone.0321872.ref017] 17.DeSanctis ML, Soranno EA, Messner E, Wang Z, Turner EM, Falco R, et al. Greater than pH 8: The pH dependence of EDTA as a preservative of high molecular weight DNA in biological samples. PLoS One. 2023;18(1):e0280807. doi: 10.1371/journal.pone.0280807 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0321872.ref018] 18.Sharpe A, Barrios S, Gayer S, Allan-Perkins E, Stein D, Appiah-Madson HJ, et al. DESS deconstructed: Is EDTA solely responsible for protection of high molecular weight DNA in this common tissue preservative? PLoS One. 2020;15(8):e0237356. doi: 10.1371/journal.pone.0237356 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0321872.ref019] 19.Seutin G, White BN, Boag PT. Preservation of avian blood and tissue samples for DNA analyses. Can J Zool. 1991;69(1):82–90. doi: 10.1139/z91-013 [DOI] [Google Scholar]

[pone.0321872.ref020] 20.Carvalhais LC, Dennis PG, Poudel A, Birt HWG, Bhuiyan SA, Card SD, et al. Simple solution to preserve plant samples for microbiome analyses. Mol Ecol Resour. 2022;22(3):1055–64. doi: 10.1111/1755-0998.13538 [DOI] [PubMed] [Google Scholar]

[pone.0321872.ref021] 21.Dawson MN, Raskoff KA, Jacobs DK. Field preservation of marine invertebrate tissue for DNA analyses. Mol Mar Biol Biotechnol. 1998;7(2):145–52. [PubMed] [Google Scholar]

[pone.0321872.ref022] 22.Gaither MR, Szabó Z, Crepeau MW, Bird CE, Toonen RJ. Preservation of corals in salt-saturated DMSO buffer is superior to ethanol for PCR experiments. Coral Reefs. 2010;30(2):329–33. doi: 10.1007/s00338-010-0687-1 [DOI] [Google Scholar]

[pone.0321872.ref023] 23.Gordeeva NV, Kobyliansky SG, Evseenko SA. A method for fixation of fish larvae for morphological and genetic studies. J Ichthyol. 2019;59(5):818–22. doi: 10.1134/s0032945219050035 [DOI] [Google Scholar]

[pone.0321872.ref024] 24.Lee KM, Adams M, Klassen JL. Evaluation of DESS as a storage medium for microbial community analysis. PeerJ. 2019;7:e6414. doi: 10.7717/peerj.6414 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0321872.ref025] 25.Michaud CL, Foran DR. Simplified field preservation of tissues for subsequent DNA analyses. J Forensic Sci. 2011;56(4):846–52. doi: 10.1111/j.1556-4029.2011.01771.x [DOI] [PubMed] [Google Scholar]

[pone.0321872.ref026] 26.Mulcahy DG, Macdonald KS 3rd, Brady SG, Meyer C, Barker KB, Coddington J. Greater than X kb: a quantitative assessment of preservation conditions on genomic DNA quality, and a proposed standard for genome-quality DNA. PeerJ. 2016;4:e2528. doi: 10.7717/peerj.2528 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0321872.ref027] 27.Tatangelo V, Franzetti A, Gandolfi I, Bestetti G, Ambrosini R. Effect of preservation method on the assessment of bacterial community structure in soil and water samples. FEMS Microbiol Lett. 2014;356(1):32–8. doi: 10.1111/1574-6968.12475 [DOI] [PubMed] [Google Scholar]

[pone.0321872.ref028] 28.Kolarevic A, Yancheva D, Kocic G, Smelcerovic A. Deoxyribonuclease inhibitors. Eur J Med Chem. 2014;88:101–11. doi: 10.1016/j.ejmech.2014.07.040 [DOI] [PubMed] [Google Scholar]

[pone.0321872.ref029] 29.Guéroult M, Picot D, Abi-Ghanem J, Hartmann B, Baaden M. How cations can assist DNase I in DNA binding and hydrolysis. PLoS Comput Biol. 2010;6(11):e1001000. doi: 10.1371/journal.pcbi.1001000 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0321872.ref030] 30.Falco R, Appiah-Madson HJ, Distel DL. The Ocean Genome Legacy: a genomic resource repository for marine life. Biopreserv Biobank. 2022;20(1):104–6. doi: 10.1089/bio.2021.0148 [DOI] [PubMed] [Google Scholar]

[pone.0321872.ref031] 31.Cicero C, Koo MS, Braker E, Abbott J, Bloom D, Campbell M, et al. Arctos: Community-driven innovations for managing natural and cultural history collections. PLoS One. 2024;19(5):e0296478. doi: 10.1371/journal.pone.0296478 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0321872.ref032] 32.Wahltinez SJ, Stacy NI, Hadfield CA, Harms CA, Lewbart GA, Newton AL, et al. Perspective: Opportunities for advancing aquatic invertebrate welfare. Front Vet Sci. 2022;9:973376. doi: 10.3389/fvets.2022.973376 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0321872.ref033] 33.Conte F, Voslarova E, Vecerek V, Elwood R, Coluccio P, Pugliese M. Humane slaughter of edible decapod crustaceans. Animals. 2021;11(4). [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0321872.ref034] 34.RStudio Team. RStudio: Integrated development for R. Boston, MA: RStudio, PBC; 2020. [Google Scholar]

[pone.0321872.ref035] 35.R Core Team. R: A language and environment for statistical computing. Vienna, Austria: R Foundation for Statistical Computing; 2021. [Google Scholar]

[pone.0321872.ref036] 36.Wickham H, Averick M, Bryan J, Chang W, McGowan L, François R, et al. Welcome to the tidyverse. JOSS. 2019;4(43):1686. doi: 10.21105/joss.01686 [DOI] [Google Scholar]

[pone.0321872.ref037] 37.Dinno A. conover.test: conover-iman test of multiple comparisons using rank sums. 2024.

[pone.0321872.ref038] 38.Graves S, Piepho H-P, Selzer L, Dorai-Raj S. multcompview: visualizations of paired comparisons. 2024.

[pone.0321872.ref039] 39.Wilke CO. cowplot: Streamlined plot theme and plot annotations for ‘ggplot2’. 2024.

[pone.0321872.ref040] 40.Wickham H. stringr: Simple, consistent wrappers for common string operations. 2023.

[pone.0321872.ref041] 41.Kassambara A. rstatix: Pipe-friendly framework for basic statistical tests. 2023.

[pone.0321872.ref042] 42.Hebert PDN, Ratnasingham S, deWaard JR. Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proc Biol Sci. 2003;270 Suppl 1(Suppl 1):S96-9. doi: 10.1098/rsbl.2003.0025 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0321872.ref043] 43.Handy SM, Deeds JR, Ivanova NV, Hebert PDN, Hanner RH, Ormos A, et al. A single-laboratory validated method for the generation of DNA barcodes for the identification of fish for regulatory compliance. J AOAC Int. 2011;94(1):201–10. doi: 10.1093/jaoac/94.1.201 [DOI] [PubMed] [Google Scholar]

[pone.0321872.ref044] 44.Foottit RG, Maw HEL, Havill NP, Ahern RG, Montgomery ME. DNA barcodes to identify species and explore diversity in the Adelgidae (Insecta: Hemiptera: Aphidoidea). Mol Ecol Resour. 2009;9 Suppl s1:188–95. doi: 10.1111/j.1755-0998.2009.02644.x [DOI] [PubMed] [Google Scholar]

[pone.0321872.ref045] 45.Sayers EW, Bolton EE, Brister JR, Canese K, Chan J, Comeau DC, et al. Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 2022;50(D1):D20–6. doi: 10.1093/nar/gkab1112 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0321872.ref046] 46.Corthals A, Desalle R. An application of tissue and DNA banking for genomics and conservation: the Ambrose Monell Cryo-Collection (AMCC). Syst Biol. 2005;54(5):819–23. doi: 10.1080/10635150590950353 [DOI] [PubMed] [Google Scholar]

[pone.0321872.ref047] 47.Kelly R, Albert M, de Ladurantaye M, Moore M, Dokun O, Bartlett JMS. RNA and DNA integrity remain stable in frozen tissue after long-term storage at cryogenic temperatures: a report from the Ontario Tumour Bank. Biopreserv Biobank. 2019;17(4):282–7. doi: 10.1089/bio.2018.0095 [DOI] [PubMed] [Google Scholar]

[pone.0321872.ref048] 48.Soniat TJ, Sihaloho HF, Stevens RD, Little TD, Phillips CD, Bradley RD. Temporal-dependent effects of DNA degradation on frozen tissues archived at −80°C. J Mammalogy. 2021;102(2):375–83. doi: 10.1093/jmammal/gyab009 [DOI] [Google Scholar]

PERMALINK

Perish the thawed? EDTA reduces DNA degradation during extraction from frozen tissue

Ella Messner

Lev Becker

Mia L DeSanctis

Elizabeth A Soranno

Ryan Pianka

Caileigh Pierce

Molly Johnson

Rosalia Falco Poulin

Hannah J Appiah-Madson

Daniel L Distel

Roles

Abstract

Introduction

Materials and methods

Ethics statement

Specimen selection, storage, and sampling

Fig 1. Experimental Design.

Tissue handling and DNA extraction

DNA analysis

PCR amplification and DNA sequencing

Results

Fig 2. Percentage of high molecular weight DNA.

Fig 3. Normalized yield of high molecular weight DNA.

Table 1. The effect of preservative treatments on average percentages of high molecular weight DNA (%HMW) and average yields of high molecular weight DNA normalized by tissue weight (nY) for DNA extracts from frozen tissues of 10 specimens of each of 10 marine species.

Effect of treatments on %HMW

Effect of treatments on nY

Qualitative DNA analyses

PCR amplification and DNA sequencing

Discussion

Supporting information

Acknowledgments

Data Availability

Funding Statement

References

Author response to Decision Letter 0

Decision Letter 0

Shailender Kumar Verma

Roles

Author response to Decision Letter 1

Decision Letter 1

Shailender Kumar Verma

Roles

Acceptance letter

Shailender Kumar Verma

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases