FIG. 7.

Brain-preferred complex formation in the brain suppressor region of the ζ lens promoter. (a) Mouse brain nuclear extract but not N/N1003A lens cell nuclear extract protects a site (lower bar, BPE) between −411 and −401 in a DNase I footprinting assay. The upper bar indicates a nearby region which appears to be similarly protected in both brain and lens tissue. The amounts of added protein extract (micrograms) are indicated. (b) In EMSA, the BPE region forms specific complexes with mouse brain extract. Labelled synthetic double-stranded DNA for the −418 to −394 fragment (TAAAAGCTCTGTGTTTTTTCCACCG) containing the BPE core sequence (italics) was incubated with nuclear extract derived from mouse brain and lens-derived N/N1003A cells (labelled below the panel). Competitions with self (S) and nonself (N) (−478 to −454) unlabelled fragments are shown (labelled above the panel). The dash indicates no addition of either competitor or extract. The arrow indicates a sequence-specific complex formed in brain but not lens extract.