Protocol for CRISPR-mediated deletion of cis-regulatory element in murine Th17 cells for in vivo assessment of effector function

Summary

Studying the cis-regulatory elements (CREs) of genes in Th17 cells during autoimmune disease progression, such as experimental autoimmune encephalomyelitis (EAE), is often limited by the availability of gene-edited mice. Here, we present a protocol for CRISPR-mediated deletion of a CRE in murine Th17 cells for in vivo assessment of effector function in EAE. We describe steps for dual U6gRNA construction, preparation of retroviruses, viral delivery, and Th17 differentiation. We then detail procedures for in vivo functionality analysis.

For complete details on the use and execution of this protocol, please refer to Zhong et al.^1,2

Graphical abstract

Highlights

• •Steps for designing and cloning dual U6gRNA cassettes to delete a specific CRE
• •Instructions for optimized retrovirus production and transduction into CD4⁺ T cells
• •Guidance on Th17 differentiation and confirmation of CRE deletion in cultured T cells
• •Procedures for adoptive transfer of CRISPR-edited Th17 cells to assess in vivo function

Publisher’s note: Undertaking any experimental protocol requires adherence to local institutional guidelines for laboratory safety and ethics.

Studying the cis-regulatory elements (CREs) of genes in Th17 cells during autoimmune disease progression, such as experimental autoimmune encephalomyelitis (EAE), is often limited by the availability of gene-edited mice. Here, we present a protocol for CRISPR-mediated deletion of a CRE in murine Th17 cells for in vivo assessment of effector function in EAE. We describe steps for dual U6gRNA construction, preparation of retroviruses, viral delivery, and Th17 differentiation. We then detail procedures for in vivo functionality analysis.

Before you begin

This protocol outlines an efficient method for retroviral delivery of two single guide RNAs (sgRNAs) simultaneously into Th17 cells, specifically in the context of experimental autoimmune encephalomyelitis (EAE) and Th17 cell-mediated immune responses.^3,4 After transduction, the cells undergo an in vivo evaluation of gene functions through adoptive transfer into Rag1^−/− mice, which lack T cells. This approach is particularly valuable for studying cis-regulatory elements (CREs) of genes, as knockout mouse models targeting gene regulatory regions are far less common than those for coding sequences. While the protocol focuses primarily on CRE deletion with two sgRNAs, it can also be applied to the deletion of coding sequences using an individual sgRNA. Moreover, it enables gene screening without the need to purchase multiple knockout mouse strains. Additionally, the protocol can be adapted for gene overexpression, offering versatility for various experimental objectives.

Efficient delivery of CRISPR-Cas9 components to Th17 cells can be challenging. To overcome this, the protocol incorporates the use of CRISPR-Cas9 transgenic mice, enabling precise and effective gene editing. Alternatively, electroporation can be used for gene editing when Cas9-expressing mice are unavailable.^5,6,7 Electroporation can directly deliver a Cas9-containing CRISPR plasmid,⁵ Cas9 mRNA with sgRNA,⁶ or Cas9 protein with sgRNA⁷ into primary T cells. However, due to the sensitivity of primary T cells, electroporation parameters such as voltage and pulse conditions need to be carefully optimized to minimize cell death and enhance delivery efficiency. Notably, for gene overexpression, the use of Cas9-expressing mice is not required, simplifying the workflow for these experiments. Given that polyclonal or non-specific CD4⁺ T cells typically do not induce experimental autoimmune encephalomyelitis (EAE) in Rag1^−/− mice when activated in vitro before adoptive transfer, the use of 2D2 TCR transgenic (Tg^TCR2D2) mice is essential. These mice provide a targeted Th17 response, allowing for precise functional analysis of genes involved in multiple sclerosis-like disease.

The addition of certain cytokines, such as IL-2, IL-7, IL-15, and IL-21, has been shown to improve transduction efficiency^8,9; however, these extra cytokines may alter the Th17 phenotype.¹⁰ In this protocol, we use the Platinum-E (Plat-E) packaging cell line,¹¹ which expresses the gag-pol and env viral structural genes. This cell line is optimized to produce high-titer retrovirus, generally yielding higher titers than its derivative, HEK293T cells, allowing the delivery of maximal retroviral constructs without the need for concentration steps. With this method, high transduction efficiency can be achieved without adding extra cytokines, thereby preserving the Th17 phenotype.

Institutional permissions

Rag1^−/−, 2D2 TCR transgenic (Tg^TCR2D2), and CRISPR/Cas9-EGFP (Cas9) knock-in mice were purchased from the Jackson Laboratory. Tg^TCR2D2 and Cas9 mice were crossed to generate the Tg^TCR2D2/Cas9 strain. All the mice were bred at the C57BL/6J background and maintained in a pathogen-free animal facility at City of Hope. Both male and female mice aged 8-13 weeks were used for all experiments, while 6-12-week-old mice were used for breeding purposes. All animal experiments were conducted in accordance with protocols approved by the Institutional Animal Care and Use Committee at City of Hope. Researchers need to acquire permission from their institution prior to performing these experiments.

Mice breeding

Timing: 13–17 weeks

Proper breeding and expansion of the required mouse strains are critical to ensure their availability for experiments. Below are detailed steps and considerations for each strain.

• 1.
  Tg^TCR2D2/Cas9 mice: These mice are required for experiments involving Cas9-mediated gene deletion and adoptive transfer for in vivo analysis. Mice aged 8–12 weeks are used for isolating CD4⁺ T cells.

  • a.
    Generate this strain by crossing 6-12-week-old heterozygous Tg^TCR2D2 mice with homozygous Cas9 knock-in mice.
  • b.
    Collect tail samples for extracting genomic DNA and run PCR to confirm genotypes.

Note: The 2D2 TCR gene is maintained in a heterozygous state, and Cas9 can be either homozygous or heterozygous. Therefore, after crossing, the littermates can be directly used for experiments. Researchers can also breed mice to generate Cas9 transgene homozygous offspring.

Note: Use Tg^TCR2D2/Cas9 donor mice aged 8-12 weeks for T cell isolation, ensuring that, after a 4-day in vitro culture period, the donor cells originate from mice that would have met the 9–13-week age requirement for EAE induction in C57BL/6J background mice (see manufacturer’s instructions).

• 2.Rag1^−/− mice: Use these mice as recipients for the adoptive transfer of Th17 cells. Expand this strain and ensure the mice are 9–13 weeks old for successful EAE induction.

Preparation of packaging cells

Timing: 4 days

This section outlines the preparation and culture of Plat-E cells, which are essential for generating viral supernatants needed for sgRNA delivery.

• 3.
  Thaw retroviral packaging cells:

  • a.
    Quickly thaw a vial of Plat-E cells by placing it in a 37°C water bath.
  • b.
    Gently agitate the vial until only a small ice crystal remains to prevent thermal shock.
• 4.
  Remove cryoprotectant (DMSO):

  • a.
    Transfer the thawed cells to a 15 mL conical tube containing 4 mL of Plat-E recovery medium (DMEM supplemented with 10% FBS, 2 mM L-glutamine, 100 U/mL penicillin and 100 μg/mL streptomycin) which does not contain puromycin and blasticidin (refer to “materials and equipment” section).
  • b.
    Centrifuge the tube at 300 x g for 5 min at 20°C–25°C to pellet the cells.
  • c.
    Carefully aspirate the supernatant to remove DMSO and resuspend the pellet in fresh Plat-E recovery medium.
• 5.
  Seed and culture cells:

  • a.
    Seed the cells into a T25 flask or a suitable culture dish.
  • b.
    Incubate the cells at 37°C in a humidified incubator with 5% CO₂ until they reach 70%–90% confluence.

    Note: Do not change the medium during the initial recovery phase.

  • c.
    After recovery, subculture the cells every 3-4 days at 1:4 ratio, using Plat-E growth medium (DMEM supplemented with 10% FBS, 2 mM L-glutamine, 100 U/mL penicillin, 100 μg/mL streptomycin, 1x MEM non-essential amino acids, 10 mM HEPES, 1 mM sodium pyruvate, 1 μg/mL puromycin, and 10 μg/mL blasticidin) which contains selection antibiotics (refer to “materials and equipment” section).
• 6.Prepare cells for transfection.
  One day before transfection, seed 2 x 10⁶ Plat-E cells in 4 mL of Plat-E recovery medium in a 60 mm cell culture dish, ensuring they reach approximately 80% confluence the next day.

  Note: A 60 mm culture dish is generally sufficient for collecting 5 mL of viral supernatant when performing two rounds of collection and subsequently transducing cells in two wells of a 24-well plate. This amount is typically enough for sorting for adoptive transfer to several mice (10⁵ cells/mouse is sufficient; refer to Step 17e) and genomic DNA verification. For additional replicates or large-scale experiments, consider using larger culture dishes, such as a 100 mm plate, or additional plates to meet the volume requirements.

  CRITICAL: During transfection preparation, use Plat-E recovery medium that does not contain puromycin or blasticidin to prevent toxicity and optimize transfection efficiency.

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Armenian hamster monoclonal anti-mouse CD3ε (0.25 μg/mL)	BioLegend	Cat# 100359, RRID:AB_2616673
Rat monoclonal anti-mouse CD45 (1:200)	BioLegend	Cat# 100548, RRID:AB_2563054
Rat monoclonal anti-mouse CD4 (1:200)	BioLegend	Cat# 100548, RRID:AB_2563054
Syrian hamster monoclonal anti-mouse CD28 (1 μg/mL)	Biolegend	Cat# 102121, RRID:AB_2810330
Ultra-LEAF Purified anti-mouse IL-4 (2 μg/mL)	BioLegend	Cat# 504135, RRID:AB_2750404
Ultra-LEAF Purified anti-mouse IFN-γ (2 μg/mL)	BioLegend	Cat# 505710, RRID:AB_2832806
Mouse monoclonal anti-mouse RORγt (1:100)	BD Biosciences	Cat# 562607, RRID:AB_11153137
Rabbit anti-hamster IgG (H&L) (0.1 mg/mL)	MP Biomedicals	Cat# 0855398
Rat monoclonal anti-mouse IL-17A (1:100)	Thermo Fisher Scientific	Cat# 25-7177-82, RRID:AB_10732356
Bacterial and virus strains
Stbl3 Escherichia coli (E. coli)	Thermo Fisher Scientific	Cat# C737303
Chemicals, peptides, and recombinant proteins
BioT	Bioland Scientific	Cat# B01-03
GolgiStop protein transport inhibitor	BD Biosciences	Cat# BDB554724
MojoSort Buffer (5X)	BioLegend	Cat# 480017
Dulbecco’s modified Eagle’s medium	Corning	Cat# 15-013-CV
Fetal bovine serum (FBS)	Corning	Cat# 35-011-CV
HEPES	Corning	Cat# 25-060-CI
RPMI 1640 medium	Corning	Cat# 15-040-CV
Percoll PLUS density gradient media	Cytiva	Cat# 17544501
Basticidin	InvivoGen	Cat# ant-bl-1
Mouse IL-6	Miltenyi Biotec	Cat# 130-096-685
Human/Mouse TGF-β1	Miltenyi Biotec	Cat# 130-095-066
BamHI-HF	New England Biolabs	Cat# R3136S
BbsI-HF	New England Biolabs	Cat# R3539L
EcoRI-HF	New England Biolabs	Cat# R3101S
XhoI	New England Biolabs	Cat# R0146L
T4 DNA ligase	New England Biolabs	Cat# M0202S
T4 DNA ligase buffer	New England Biolabs	Cat# B0202S
MEM non-essential amino acids solution (NEAA)	Thermo Fisher Scientific	Cat# 11140050
β-Mercaptoethanol	Thermo Fisher Scientific	Cat# 21985023
Penicillin-Streptomycin-Glutamine	Thermo Fisher Scientific	Cat# 10378016
Puromycin	Thermo Fisher Scientific	Cat# A1113803
T4 Polynucleotide Kinase (PNK)	Thermo Fisher Scientific	Cat# EK0031
Sodium pyruvate (100 mM)	Thermo Fisher Scientific	Cat# 11360070
Gibco Bacto Yeast Extract	Thermo Fisher Scientific	Cat# 212750
Gibco Bacto Tryptone	Thermo Fisher Scientific	Cat# 211705
Ionomycin calcium salt	Sigma-Aldrich	Cat# I0634
Phorbol-12-myristate-13 acetate (PMA)	Sigma-Aldrich	Cat# P8139
Sodium chloride	Sigma-Aldrich	Cat# S7653-1KG
Polybrene infection/transfection reagent	Sigma-Aldrich	Cat# TR-1003-G
Red blood cell lysing buffer	Sigma-Aldrich	Cat# R7757
Critical commercial assays
MojoSort Mouse CD4 Naïve T Cell Isolation Kit	BioLegend	Cat# 480040
MOG35-55/CFA Emulsion PTX	Hooke Laboratories	Cat# EK-2110
BD Pharmingen Transcription-Factor Buffer Set	Thermo Fisher Scientific	Cat# BDB562574
BD Cytofix/Cytoperm Fixation/Permeabilization Kit	Thermo Fisher Scientific	Cat# BDB554714
LIVE/DEAD Fixable Near-IR Dead Cell	Thermo Fisher Scientific	Cat# L34976
Phusion Plus PCR Master Mix	Thermo Fisher Scientific	Cat# F631S
QIAquick Gel Extraction Kit	QIAGEN	Cat# 28704
QIAprep Spin Miniprep Kit	QIAGEN	Cat# 27106
HiSpeed Plasmid Midi Kit	QIAGEN	Cat# 12643
Experimental models: Cell lines
Platinum-E (Plat-E): human species	Cell Biolabs	RRID:CVCL_B488
Experimental models: Organisms/strains
Rag1−/− mice: C57BL/6J background, age 9–13 weeks, either gender	The Jackson Laboratory	RRID:IMSR_JAX:002216
TgTCR2D2 mice: C57BL/6J background, age 6–12 weeks, either gender	The Jackson Laboratory	RRID:IMSR_JAX:006912
CRISPR/Cas9-EGFP mice: C57BL/6J background, age 6–12 weeks, either gender	The Jackson Laboratory	RRID:IMSR_JAX:028555
TgTCR2D2/Cas9 mice: C57BL/6J background, age 8–12 weeks, either gender	This paper	N/A
Oligonucleotides
Cloning primers are in Table 1	N/A	N/A
Recombinant DNA
MIGR1	Dr. Warren S. Pear	RRID:Addgene_27490
pMSCV-U6gRNA	Dr. Sarah Teichmann	RRID:Addgene_102796
MIGR1-U6gRNA1-Filler-v1	This paper	RRID:Addgene_237399
MIGR1-U6gRNA1-Filler-v2	This paper	RRID:Addgene_237400
MIGR1-U6gRNA2-Filler	This paper	RRID:Addgene_237401
MIGR1-NonT+NonT	This paper	N/A
MIGR1-sgRORγt+NonT	This paper	N/A
MIGR1-NonT+sgRORγt	This paper	N/A
Software and algorithms
FlowJo	FlowJo	Version 10.8.1; RRID:SCR_008520; https://www.flowjo.com/

Table 1.

List of PCR primer sequences

Name	Forward primer	Reverse primer
U6gRNA1	AGATCTCTCGAGGAGGGCCTATTTCCCATGA	CTCGAATTCACATACGCGCTGTGCAAAAA AAGCACCGACTCGGTGCCA
U6gRNA2	GATCTGAATTCGAGGGCCTATTTCCCATGA	ATTGGATCCAAAAAAAGCACCGAC TCGGTGCCA
PGK promoter	TGTGAATTCGGTGGATCCAATTCTACCGGGTAGG GGAGGCGCTTTTCCCAA	AGAAGAAGACTAGAACCGGTCCGA AAGGCCCGGAGATGAGGAAG
TagBFP	AGAAGAAGACCGGTTCTAGAGCGC TGCCACCATGAGCGAGCTGATTAAGGAG	TTGATATTAATTAATTCAGCGGCCGCTCA ATTAAGCTTGTGCCCCA
NonT	CACCGAAACTCGCCCGCGTCATAT	AAACATATGACGCGGGCGAGTTTC
RORγt	CACCGCGGGGTTATCACCTGTGAG	AAACCTCACAGGTGATAACCCCGC

Materials and equipment

Plat-E recovery medium

Reagent	Final concentration	Amount
FBS	10% (v/v)	50 mL
Penicillin-Streptomycin-Glutamine	1% (v/v)	5 mL
DMEM medium	N/A	445 mL
Total	N/A	500 mL

Note: Store at 4°C for up to 1 month.

Plat-E growth medium

Reagent	Final concentration	Amount
FBS	10% (v/v)	50 mL
Penicillin-Streptomycin-Glutamine	1% (v/v)	5 mL
MEM-NEAA	1% (v/v)	5 mL
Sodium pyruvate	1% (v/v)	5 mL
HEPES	1% (v/v)	5 mL
Puromycin	1 μg/mL	50 μL
Blasticidin	10 μg/mL	0.5 mL
DMEM medium	N/A	425 mL
Total	N/A	500 mL

Note: Store at 4°C for up to 1 month.

Master mix for phosphorylation and annealing reaction

Reagent	Final concentration	Amount (μL)
gRNA Forward (100 μM)	10 μM	1
gRNA Reverse (100 μM)	10 μM	1
T4 Ligation Buffer (10 x)	1 x	1
T4 PNK	N/A	0.5
Sterile water	N/A	6.5
Total	N/A	10

Note: Place on ice during preparation and use immediately.

Cycling conditions for phosphorylation and annealing reaction

Temperature	Time
37°C	30 min
95°C	5 min
25°C	Ramp down at 5°C/min

LB medium

Reagent	Amount
Tryptone	10 g
Yeast extract	5 g
NaCl	10 g
ddH2O	1000 mL
Total	1000 mL

Note: Store at 4°C for up to 6 months after autoclave.

T cell culture medium

Reagent	Final concentration	Amount
FBS	10% (v/v)	50 mL
Penicillin-Streptomycin-Glutamine	1% (v/v)	5 mL
1000 x BME	1 x	5 mL
RPMI 1640 medium	N/A	425 mL
Total	N/A	500 mL

Note: Store at 4°C for up to 1 month.

Th17 differentiation medium

Reagent	Final concentration	Amount
Anti-IFNγ	2 μg/mL	2 μg
Anti-IL-4	2 μg/mL	2 μg
IL-6	20 μg/mL	20 μg
TGF-β	2 μg/mL	2 μg
T cell culture medium	N/A	1 mL
Total	N/A	1 mL

Note: Prepare at 20°C–25°C before the experiment and use it immediately.

100% Percoll (Isotonic Percoll)

Reagent	Final concentration	Amount
10 x PBS	1 x	0.5 mL
Percoll	100% (v/v)	4.5 mL
Total	N/A	5 mL

Note: Prepare at 20°C–25°C and use immediately.

70% Percoll

Reagent	Final concentration	Amount
1x PBS	1 x	1.2 mL
100% Percoll	70% (v/v)	2.8 mL
Total	N/A	5 mL

Note: Prepare at 20°C–25°C and use immediately.

30% Percoll

Reagent	Final concentration	Amount
1 x PBS	1 x	3.5 mL
100% Percoll	30% (v/v)	1.5 mL
Total	N/A	5 mL

Note: Prepare at 20°C–25°C and use immediately.

Step-by-step method details

Plasmid construction and preparation

Timing: 10 days

This step involves designing and cloning two U6gRNA cassettes, each containing the U6 promoter, gRNA, gRNA scaffold, and short poly(T) sequence, into a suitable vector for targeting and deleting a specific CRE of interest. The process includes selecting efficient sgRNAs flanking the CRE, cloning them into a dual-sgRNA expression plasmid, and validating the construct through sequencing. High-quality plasmid DNA is prepared to ensure successful transfection and precise genomic editing, which are critical for downstream functional studies of gene regulation.

• 1.
  Design guide RNAs (gRNAs):

  • a.
    Prior to the plasmid construction, design two gRNAs spanning the cis-regulatory element (CRE) region of the target gene (e.g., the Runx1 intronic RORγt binding site¹) using the CRISPOR online tool (https://crispor.gi.ucsc.edu/).

    Note: Ensure to select gRNA sequences with a high specificity score, high predicted efficiency, and minimal off-target potential.

    CRITICAL: It is recommended to choose gRNAs targeting opposite strands to facilitate efficient double-strand breaks. Deletions within a narrow range of less than 200 bp are generally more efficient when utilizing non-homologous end joining (NHEJ) repair.

    Alternatives: For gRNA design, other online tools including Benchling (https://www.benchling.com/) can also be used.

  • b.
    Add 4 bp overhangs to the 5′ ends of each primer sequence: “CACC” to the forward primer and “AAAC” to the reverse primer. If the first nucleotide of your gRNA is not G, add an additional G at the 5′ end of the forward primer (immediately downstream of CACC). For the reverse primer, include a complementary C at the 3′ end (Figures 1A–1C).⁵

    Note: The overhangs are designed based on the pMSCV-U6gRNA vector (Addgene #102796) with an additional change to one of the cleavage sites, which was introduced to facilitate the sharing of annealed sgRNA duplex between different vectors in our group.

    CRITICAL: Ensure that overhangs are appropriately adjusted to match the sticky ends of chosen vector.

• 2.
  Design primers for dual U6gRNA vector:

  • a.
    Design primers for amplifying the PGK promoter and BFP to generate the MIGR1-PGK-BFP vector, replacing the IRES-EGFP sequence of MIGR1 (Addgene #27490).

    Note: The PGK promoter and BFP fragments were ligated using a Golden Gate assembly reaction and PCR amplified for subsequent digestion and ligation, with the removal of the puromycin resistance (PuroR) protein coding sequence. When using the original pMSCV-U6gRNA (Addgene #102796) as the backbone, additional cloning of the PGK-BFP cassette is unnecessary.

  • b.
    Design primers for PCR amplification of the U6gRNA cassette, which contains the U6 promoter, gRNA, gRNA scaffold, and short poly(T) sequence, for later use in dual-U6gRNA system. All primers are listed in Table 1.

    CRITICAL: Ensure that restriction sites are appropriately adjusted to match the chosen vector.

• 3.
  Single sgRNA vector construction:

  • a.
    Digest the pMSCV-U6gRNA vector (with a modified cleavage site in this study) with BbsI restriction enzyme.
  • b.
    Perform gel purification using QIAquick Gel Extraction Kit (QIAGEN) to isolate the linearized DNA fragment (see manufacturer’s instruction).

    Alternatives: Researchers may also use other similar kits, such as the Monarch Spin DNA Gel Extraction Kit (New England Biolabs).

    Pause point: The purified DNA fragment can be stored at −80°C for up to 6 months.

  • c.
    Prepare a 100 μM primer stock by dissolving each primer in DEPC-treated water.
  • d.
    Assembly the master mix for the phosphorylation and annealing reaction in a total volume of 10 μL (refer to “materials and equipment” section).
  • e.
    Perform phosphorylation and annealing using a thermocycler, following the cycling conditions (refer to “materials and equipment” section).
  • f.
    Dilute annealed duplex at 1:200 ratio and ligate it into 50 ng of the digested pMSCV-U6gRNA vector using T4 DNA ligase (New England Biolabs).

    Note: For a plasmid fragment of approximately 8 kb in size (7.5 kb for pMSCV-U6gRNA), the molar ratio of 1 μL of the diluted primer duplex to 50 ng of the plasmid DNA is about 5:1. This ratio is generally recommended for efficient insertion of short sequences.

    Alternatives: Fast ligation kits, such as the Quick Ligation Kit (New England Biolabs) and the Rapid DNA Ligation Kit (Thermo Fisher Scientific), are available for highly efficient ligation.

  • g.
    Transform 5 μL of the ligation reaction into 50 μL Stbl3 E. coli competent cells (Thermo Fisher Scientific) using the heat-shock method.

    Note: Stbl3 E. coli. has reduced homologous recombination, which helps minimize rearrangement of long terminal repeats (LTRs) in viral construct.

    Alternatives: Using other recombination-deficient strains such as NEB Stable E. coli is also acceptable.

  • h.
    Immediately place the transformed E. coli on ice for 2 min.
  • i.
    Add 1 mL of Luria-Bertani (LB) medium (refer to “materials and equipment” section) without antibiotics to the tube and shake for 1 h at 37°C.
  • j.
    Centrifuge the cells to pellet, discard 900 μL LB medium, and resuspend the pellet in the remaining 150 μL of LB medium. Plate 50 μL of the transformed cells onto ampicillin-containing agar plates and incubate at 37°C for 18 h.
  • k.
    Pick several random colonies using a 200 μL pipette tip and resuspend each colony in 10 μL sterile water in separate PCR tubes.

    Note: Four colonies are generally sufficient, as the insertion rate for short sequences is quite high. However, more colonies may be considered if the insertion rate is low or for inexperienced researchers.

    CRITICAL: Ensure that the colonies are selected from different areas of the plate and that there are no satellite colonies nearby.

  • l.
    Use 1 μL of the E. coli suspension as the DNA template in PCR to confirm positive insertion.

    Note: For PCR, use the LXSN forward primer (listed in Table 1) and the gRNA reverse primer, with the pMSCV-U6gRNA empty vector as a negative control DNA template (Figure 2).

  • m.
    Select 1-2 positive colonies and culture them in 5 mL of LB medium containing 100 μg/mL ampicillin. Incubate at 37°C with shaking at 250 rpm for 18 h.
  • n.
    Perform a mini prep using QIAprep Spin Miniprep Kit (QIAGEN) to isolate plasmid DNA (see manufacturer’s instructions).

    Alternatives: Other mini prep kits are also available, such as GeneJET Plasmid Miniprep Kit (Thermo Fisher Scientific).

  • o.
    Send the isolated DNA for Sanger sequencing to verify the sequence.

    Pause point: Single sgRNA vectors can be stored at −20°C for long-term storage.

    Note: For individual sgRNA cloning, researchers can refer to the protocol from Zhang group.⁵

• 4.
  Double sgRNA vector construction:

  • a.
    PCR each U6gRNA cassettes for gRNA1 and gRNA2 using corresponding primers listed in Table 1.
  • b.
    Purify PCR products using the QIAquick Gel Extraction Kit (QIAGEN).

    Pause point: Purified PCR products can be stored at −20°C for up to 1 month.

  • c.
    Digest U6gRNA1 with XhoI and EcoRI, U6gRNA2 with EcoRI and BamHI, MIGR1-PGK-BFP backbone vector with XhoI and BamHI.
  • d.
    Purify each digested DNA fragment using QIAquick Gel Extraction Kit (QIAGEN).
  • e.
    Ligate two U6gRNA cassettes into the MGR1-PGK-BFP vector in a 10 μL ligation reaction at a 3:3:1 molar ratio of insert to backbone.
  • f.
    Transform 5 μL of the ligation reaction into 50 μL Stbl3 E. coli competent cells using the heat-shock method.
  • g.
    Place the tube containing transformed E. coli on ice for 2 min.
  • h.
    Shake for 1 h at 37°C in 1 mL of the LB medium without antibiotics.
  • i.
    Centrifuge the cells to pellet, discard 1 mL LB medium, and resuspend the pellet in the remaining 50 μL of LB medium.
  • j.
    Plate 50 μL of the transformed cells onto an agar plate containing ampicillin and incubate at 37°C for 18 h.

    Note: Simultaneous insertion of two fragments may reduce the frequency of successful insertions but save time. To ensure enough colonies with positive selection, adjust the amount of transformed Stbl3 E. coli plated on antibiotic-containing agar plates.

  • k.
    Pick four colonies and dissolve in 10 μL sterile water in separate PCR tubes.
  • l.
    Perform PCR with the LXSN forward primer and each gRNA reverse primer in separate reactions to confirm positive insertion, using the MIGR1-PGK-BFP empty vector as the negative control DNA template.
  • m.
    Select 1-2 positive colonies and culture them in 5 mL of LB medium supplemented with 100 μg/mL ampicillin. Incubate in a shaker at 37°C for 18 h.
  • n.
    Extract plasmid DNA using the QIAprep Spin Miniprep Kit (QIAGENE).
  • o.
    Send an aliquot for Sanger sequencing to verify the sequences.

    Note: A single Sanger sequencing reaction is sufficient to verify both gRNA sequences in the same plasmid, provided that the LXSN forward primer is used, and the plasmid purity is sufficiently high.

    Pause point: Dual sgRNA vectors can be stored at −20°C for long-term storage.

    Alternatives: We have generated two distinct vectors, MIGR1-U6gRNA1-Filler-v1 and MIGR1-U6gRNA1-Filler-v2 (Addgene 237399 and 237400), each containing a single U6gRNA cassette (without gRNA) with different restriction sites flanking the U6gRNA cassettes. This design facilitates the construction of a double sgRNA vector by enabling the direct transfer of the U6gRNA cassette (containing the inserted gRNA) from one vector to the other through restriction digestion and ligation, eliminating the need for PCR. This method is particularly convenient when targeting multiple CRE sites or genes. We also deposited a vector with two U6gRNA cassettes (without sgRNA), MIGR1-U6gRNA2-Filler (Addgene 237401), for those who prefer to sequentially clone two gRNAs into the plasmid.

• 5.
  Midi preparation:

  • a.
    Select a colony with a verified sequence and culture in a flask containing 100 mL of LB medium supplemented with 100 μg/mL ampicillin at 37°C with shaking.

    Note: To improve plasmid yield, a higher ampicillin concentration (150 μg/mL) can be used to increase selection pressure.

  • b.
    Perform plasmid preparation using the HiSpeed Plasmid Midi Kit (QIAGEN) after verifying the sequence accuracy of the construct sequence (see manufacturer’s instructions).
  • c.
    Measure the absorbance of plasmid DNA samples at 260 nm and 280 nm using a spectrophotometer (NanoDrop One, Thermo Fisher Scientific). An A260/A280 ratio between 1.8 and 2.0 indicates high purity with minimal protein or RNA contamination. Additionally, run a small aliquot on an agarose gel to verify that the plasmid has the correct size and to ensure its integrity.

    Pause point: Dual sgRNA vectors can be stored at −20°C for long-term storage.

Figure 1.

Primer design strategy

(A) Digestion sites for the BbsI restriction enzyme used in cloning. Gray shading represents the recognition sites and folded line indicates the digestion sites.

(B) Primer design for a gRNA sequence with first nucleotide as G.

(C) Primer design for a gRNA sequence where the first nucleotide is not G.

Figure 2.

Validation of DNA sequence insertion for gRNA

(A) PCR validation of gRNA1 and gRNA2 insertions using 1 μL suspensions of E. coli colonies. The gel image shows successful amplification of the target sequences, with pMSCV-U6gRNA empty vector as negative control.

Preparation of retrovirus supernatant

Timing: 5 days

This step involves generating viral supernatants for sgRNA delivery through transduction, without the need for concentration to increase virus titers.

Note: Fresh viral supernatants provide optimal transduction efficiency without the need for additional transduction helpers. Therefore, this step should be planned in conjunction with T cell isolation and viral transduction to allow direct transduction immediately after two rounds of viral collection.

Cell culture on day 0

Prepare Plat-E packaging cells for transfection (refer to “preparation of packaging cells” section).

Transfection on day 1

• 6.Check Plat-E cell confluence:
  Ensure that Plat-E cells in a 60 mm culture dish are at ∼80% confluence for maximum transfection efficiency and viral production.

  Optional: On the day of transfection, before preparing the transfection mixture, replace the medium with fresh Plat-E recovery medium to improve transfection efficiency.

• 7.
  Prepare DNA and transfection reagent mixture:

  • a.
    Label two 1.5 mL Eppendorf tubes. Add 150 μL of DMEM (without serum or antibiotics) to each tube.

    Alternatives: Other serum-free medium can be used (e.g., PBS, DPBS).

  • b.
    Add 10 μg of plasmid DNA to one tube and 15 μL of BioT transfection reagent to the other (a 1 μg DNA to 1.5 μL BioT ratio), then mix each tube gently before proceeding.
  • c.
    Transfer the DNA-containing medium dropwise into the tube with the BioT reagent, mix by pipetting, spin briefly, and incubate at 20°C–25°C for 5 min.

    Note: Please also refer to the manufacturer's instructions on BioT-mediated transfection.

    CRITICAL: Do not use serum or antibiotics in the transfection medium. Avoid using Opti-MEM with BioT reagent.

• 8.
  Transfect Plat-E cells:

  • a.
    Slowly add the 300 μL DNA/BioT mixture dropwise onto the Plat-E cells with either unchanged or freshly changed Plat-E recovery medium, ensuring even distribution.
  • b.
    Gently shake the plate to spread the mixture.
  • c.
    Return the plate to the humidified incubator with 5% CO₂ at 37°C.

Note: Do not disturb the cells for 16–24 h post-transfection to maximize transfection efficiency.

Medium change on day 2 and viral supernatant collection on day 3 and 4

• 9.
  Change medium and collect viral supernatants:

  • a.
    At 18 h post-transfection (Day 2), replace the medium with 2.5 mL fresh Plat-E recovery medium.
  • b.
    Collect the viral supernatant on Day 3 and Day 4, and pool them together. Filter the supernatant through a 0.45 μm PVDF membrane filter.

Note: A brief spin-down can be performed to remove cells and debris instead of filtration, which may improve transduction efficiency, as filtration may reduce the titer to some extent. However, consider the potential impact on Th17 differentiation and the risk of contaminating mouse Th17 cells with human components.

CRITICAL: Use fresh viral supernatant for optimal transduction efficiency and avoid freeze-thaw cycles whenever possible.

Pause point: Viral supernatant can be stored at 4°C for up to 1–2 days. For longer storage, freeze the supernatant at −80°C to maintain viral titer and integrity.

T cell isolation, activation, viral transduction, and differentiation (retroviral delivery of sgRNAs)

Timing: 4 days

This step enables the efficient introduction of retroviral constructs into activated CD4⁺ T cells for downstream functional assays.

Note: As this protocol aims to ensure high transduction efficiency by preventing virus freezing, which reduces viral titer, this step should be planned as part of the continuous process for retrovirus preparation. Plan the T cell isolation alongside the preparatory steps.

Plate coating on day 2

• 10.Precoat wells for activation:
  Coat a 24-well plate with 300 μL of rabbit anti-hamster IgG whole molecule (0.1 mg/mL) in PBS. Incubate at 4°C for 18–24 h; this method allows you to reuse the antibody 1–2 times.

  Alternatives: You can coat the plate on day 3, the same day as T cell isolation, and incubate the plate at 37°C for at least 4 h.

T cell isolation and activation on day 3

• 11.
  Prepare single-cell suspension of splenocytes:

  • a.
    Euthanize a Tg^TCR2D2/Cas9 mouse and collect its spleen.
  • b.
    Prepare a single-cell suspension by grinding the spleen with a syringe plunger.
  • c.
    Filter the cell suspension through a 40 μm cell strainer to remove clumps.
  • d.
    Centrifuge the cells at 500 x g for 5 min at 4°C.
  • e.
    Aspirate the supernatant and resuspend the cell pellet in 1 mL of Red Blood Cell Lysing Buffer (Sigma-Aldrich). Incubate on ice for 2 min to ensure complete erythrocyte removal.
  • f.
    Centrifuge the cells at 500 x g for 5 min at 4°C.

    Note: The cell pellet should appear white; if residual red color remains, repeat the lysis step.

  • g.
    Resuspend cell pellet in 1 mL of 1 x MojoSort buffer (BioLegend).

    Alternatives: Other similar suspension buffer solutions, such as RoboSep buffer (STEMCELL Technologies), are acceptable.

• 12.Isolate naive CD4⁺ T cells:
  Perform negative selection using the MojoSort Mouse CD4 Naïve T Cell Isolation Kit (BioLegend). Researcher can refer to the manufacturer’s protocol for detailed instructions and additional guidance.

  • a.
    Prepare a single-cell suspension at 1 x 10⁷ cells/100 μL MojoSort buffer.

    Note: The total number of splenocytes should be about seven times (or more) the required number of CD4⁺ T cells for isolation.

  • b.
    For 1x 10⁷ splenocytes, add 10 μL of the biotinylated antibody cocktail and incubate for 15 min at 4°C on a rotator.

    Note: Scale up the volume of the cell suspension and antibody cocktail according to the requirements of your experiment.

  • c.
    Briefly vortex the streptavidin nanobeads (3-5 touches), then add 10 μL to the cell suspension and antibody mixture. Incubate for an additional 15 min at 4°C on a rotator.

    Note: Scale up the volume of the nanobeads to match the volume of the antibody cocktail.

  • d.
    Transfer the cell suspension to a 5 mL round-bottom tube, then add and mix with 2.5 mL of MojoSort buffer.

    Note: Use 1 mL from the 2.5 mL buffer to wash the tube before adding it to the 5 mL round-bottom tube to maximize cell collection.

  • e.
    Place the tube in the MojoSort magnet separator and incubate at 20°C–25°C for 5 min.

    Alternatives: Some brands of magnets, such as the EasySep magnet (STEMCELL Technologies), can also be used for separation, but not all may be compatible.

  • f.
    Pour the liquid into a new 15 mL conical tube to collect the CD4⁺ T cells.

    CRITICAL: As this kit uses a negative selection process, do not discard the liquid portion that contains CD4⁺ T cells.

  • g.
    Add additional 3 mL MojoSort buffer to the tube containing nanobeads and residual solution. Mix the nanobeads by pipetting and repeat the separation.
  • h.
    Pour the liquid into the 15 mL conical tube from the first separation containing the CD4⁺ T cells.

    Optional: Perform a second separation for each collection of the liquid portion to enhance purity, as some nanobeads may remain in the liquid portion.

• 13.
  Activate CD4⁺ T cells:

  • a.
    Suspend cells at a density of 4 x 10⁵ cells/mL in T cell culture medium (refer to “materials and equipment” section) and incubate at 4°C for 1 h.

    Note: Incubating at 4°C for 1 h allows CD4⁺ T cells to equilibrate to a resting state, ensuring a consistent state before further handling or assays.

  • b.
    Add 0.25 μg/mL anti-CD3 and 1 μg/mL anti-CD28 to the cell suspension.
  • c.
    Wash off excess coating secondary antibody in the 24-well plate and immediately transfer 1 mL of the cell suspension to each well.

    Optional: Collect rabbit anti-hamster IgG for reuse.

    CRITICAL: To prevent the antibody-coated surface from drying out, handle only a few wells at a time (e.g., 4–6 wells per session).

  • d.
    Incubate at 37°C with 5% CO₂ for 18 h in an incubator.

Viral transduction on day 4

• 14.Prepare viral supernatant for transduction:
  Add 10 μg/mL polybrene and 50 μM β-mercaptoethanol to the viral supernatant collected in Step 9b.

  Note: The addition of β-mercaptoethanol, a required reducing agent for T cell culture, may improve the survival of primary T cells during viral transduction.^12,13

• 15.
  Infect activated CD4⁺ T cells:

  • a.
    Gently collect 1 mL of T cell activation medium from the 24-well plate containing CD4⁺ T cells after activation and store it for later use in Th17 differentiation.
  • b.
    Slowly add 2 mL of the prepared viral supernatant to each well without disturbing the cells.
  • c.
    Centrifuge the plate at 1200 x g for 2 h at 30°C.
  • d.
    Return the 24-well plate to the incubator with 5% CO₂ and incubate at 37°C for an additional 3 h.

CRITICAL: Avoid prolonged incubation (>12 h) to prevent apoptosis.

• 16.
  Post-transduction Th17 differentiation:

  • a.
    Gently remove the viral supernatant and add 1 mL of Th17 differentiation medium (refer to “materials and equipment” section) without disturbing cells.

    Note: Prepare the Th17 differentiation medium using the previously saved activation medium (see Step 15a) as it contains minimal yet sufficient IL-2 from activation, which does not affect Th17 differentiation.

  • b.
    After 2 days of differentiation, when the medium becomes light yellow, add 1 mL of freshly prepared Th17 differentiation medium.

    CRITICAL: Avoid keeping cells in yellow medium for longer than 1 day, as this can lead to cell apoptosis and reduce IL-17A production.

    CRITICAL: Do not disturb the cells with pipetting and centrifugation to completely change for fresh medium as it may reduce Th17 differentiation and IL-17A production.

  • c.
    Maintain the cells in differentiation condition for a total of 3 days.
  • d.
    Verify the success of viral transduction by examining BFP expression under a microscope two days after transduction. The accurate percentage of transduced cells can be quantified by flow cytometry.

Analysis of CRE functions in Th17 cells in vivo

Timing: variable

This step involves transferring transduced Th17 cells into immunodeficient mice to assess their functionality in vivo. Additionally, lymphocytes are isolated from the CNS to analyze infiltration and cytokine production.

• 17.
  Cell sorting and injection:

  • a.
    Stain the cells with a live/dead dye and CD4 antibody.
  • b.
    Centrifuge the cells and resuspend them in MojoSort buffer.
  • c.
    Sort the live CD4⁺GFP^highBFP⁺ populations.

    Note: Ensure the use of GFP^high cells for efficient deletion, as GFP^low populations have low Cas9 expression.

    CRITICAL: Sorting ensures efficient gene deletion and avoids false-negative results.

  • d.
    Extract genomic DNA from a fraction of the cells and assess gene deletion by performing PCR on the target region.

    Note: When establishing the dual sgRNA system for the first time, it is recommended to validate functionality separately by measuring the expression of a protein (e.g., RORγt) using a validated sgRNA targeting the coding sequence. Based on our experience, a minimum of three days is required for effective protein depletion.

  • e.
    Suspend 1 x 10⁵ cells in 200 μL PBS and inject intraperitoneally into 9-13-week-old Rag1^−/− mice.

    Note: Validating CRE deletion prior to studies in vivo is critical. If same-day measurement of gene deletion is impossible, we suggest conducting a preliminary study separately.

    Note: It is not recommended to use BFP-negative populations as a negative control for BFP-positive populations within the same sample, as reporter-negative cells may still express sgRNAs despite lacking detectable BFP expressions. Therefore, for accurate analysis, it is always advisable to compare non-targeting (NonT) controls with sgRNA groups using BFP-positive cells.

    Note: Allow mice to acclimate for 7 days after adoptive transfer to facilitate in vivo amplification of cells. A shorter acclimation period (less than 4 days) may result in failure of EAE induction.

    Pause point: The Rag1^−/− recipient mice can be maintained for up to 7 days, or potentially longer, before EAE induction, depending on researchers' requirements.

• 18.
  Immunization:

  • a.
    Inject Rag1^−/− recipient mice with 200 μg of MOG_35-55/CFA emulsion (Hooke Laboratories) at two dorsal sites.
  • b.
    Administer 20 ng of pertussis toxin (PTX) intraperitoneally 4 h later.

    Note: PTX dosing can be adjusted to modulate disease progression, optimizing the differentiation for studies.

  • c.
    Inject an additional 20 ng of PTX intraperitoneally 24 h after the first dose.
• 19.
  Evaluate disease progression:

  • a.
    Monitor mice daily for EAE symptoms, scoring disease severity according to established guidelines (see manufacturer’s instructions).
  • b.
    Graph the disease score curve to evaluate the difference in Th17 effector function between the NonT control and CRE deletion.
• 20.Tissue collection and cell preparation:
  This step should be performed continuously, including gradient centrifugation and flow cytometric analysis. It is recommended to start the experiment early in the day.

  • a.
    Euthanize mice when one or more mice show a disease score > 4.
  • b.
    Collect brain and spinal cord tissues.
  • c.
    Prepare single-cell suspensions by grinding tissues in 5 mL of RPMI 1640 medium through a 70 μm strainer using a 3 mL syringe plunger on a 60 mm culture dish.

    Alternatives: To expedite single cell preparation, researchers can first use a 100 μm cell strainer and perform a secondary filtration using 70 μm cell strainer.

  • d.
    Periodically transfer the cell suspension to a 50 mL conical tube, add an additional 5 mL of fresh medium, and repeat the grinding 6–8 times until all tissue becomes a suspension.
  • e.
    Centrifuge the cells at 500 x g for 7 min at 4°C.
• 21.Gradient centrifugation:
  This step continues from tissue collection and cell preparation and proceeds to flow cytometric analysis.

  • a.
    Prepare isotonic Percoll (100% Percoll) and use it to prepare 70% and 30% Percoll for lymphocyte isolation.
  • b.
    Place 4 mL of 70% Percoll at the bottom of a 15 mL conical tube.
  • c.
    Aspirate the supernatant, resuspend the cell pellet in 5 mL of 30% Percoll, and slowly layer the cell suspension onto the top of 70% Percoll in the 15 mL conical tube.

    CRITICAL: The layering process must be done very slowly to avoid mixing the 70% Percoll with the cell suspension in 30% Percoll.

  • d.
    Centrifuge the samples at 1200 x g for 20 min at 20°C–25°C without brake.
  • e.
    Collect mononuclear cells from the interface.
• 22.Flow cytometry analysis:
  Unless researchers have a reliable protocol for cell fixation, accurate analyses such as cell counting should continue from tissue collection and gradient centrifugation.

  • a.
    Cell number measurement:

    • i.
      Aliquot 1/5 of the cell suspension for cell number measurement.
    • ii.
      Add 1 x 10⁵ counting cells or beads (e.g., GFP-expressing MC38 counting cells) to this aliquot.

      Note: Adding counting cells prior to surface marker staining helps minimize errors caused by cell loss during staining and washing steps. We also recommend preparing counting cells in a larger volume (e.g., 0.5–1 mL per sample) of medium, as smaller volumes (e.g., <0.1 mL) are more prone to generating errors.

      CRITICAL: To improve accuracy, thoroughly mix the counting cells or beads before adding them to the cell aliquot.

    • iii.
      Centrifuge the cell mixture at 500 x g for 5 min.
    • iv.
      Stain the cells with a live/dead dye and antibodies against required surface markers (e.g., CD45 and CD4).
    • v.
      Measure cell percentages by flow cytometric analysis using the BD LSRFortessa flow cytometer.
    • vi.
      Calculate the number of infiltrated CD4⁺ T cells (refer to the “expected outcomes” section below).
  • b.
    Cell stimulation:
    Stimulate a faction of the cells with ionomycin (750 ng/mL) and PMA (50 ng/mL) in the presence of Golgi inhibitor (e.g., GolgiStop and/or GolgiPlug) at 37°C for at least 3 h.
  • c.
    Stain cells with a live/dead dye and antibodies against the required surface markers (e.g., CD45 and CD4) in 100 μL of Mojort buffer.
  • d.
    For analysis intracellular proteins (e.g., RORγt and IL-17A), perform fixation after washing and pelleting the cells using Fix/Perm buffer included in the BD Pharmingen Transcription-Factor Buffer Set (BD Bioscience) or BD Cytofix/Cytoperm Fixation/Permeabilization Kit (BD Bioscience).

    Note: For separate analysis of transcription factors (TFs) and cytokines, use their appropriate buffers. For simultaneous analysis, use TF Fix/Perm buffer.

    Alternatives: An equivalent kit can be used for TFs or cytokines, such as the eBioscience Foxp3/Transcription Factor Staining Buffer Set (Thermo Fisher Scientific) or the eBioscience Intracellular Fixation & Permeabilization Buffer Set (Thermo Fisher Scientific).

  • e.
    Wash the cells with the Perm/Wash buffer supplied in the appropriate kit.

    CRITICAL: Avoid using PBS to wash the samples at this step, as the permeabilization from this kit is reversible.

  • f.
    Staining TFs (e.g., RORγt) or cytokines (e.g., IL-17A) with 1 μL of antibodies diluted in 100 μL of Perm/Wash buffer.
  • g.
    Perform flow cytometric analysis to determine lymphocyte populations and cytokine production using the BD LSRFortessa flow cytometer.
  • h.
    Data analysis:

    • i.
      With a known number of counting cells (e.g., 2 x 10⁵ of counting cells), calculate the total number of lymphocytes based on their relative percentages.
    • ii.
      Calculate the percentage of CD4⁺ T cells positive for RORγt or IL-17A enriched from the CNS of Rag1^−/− recipient mice.

Expected outcomes

Plate-bound CD3/CD28 antibodies typically lead to slower activation and are therefore not recommended for use in viral transduction. In contrast, secondary antibody-clustered CD4⁺ T cell activation using anti-CD3/CD28 antibodies induces strong activation, which is essential for efficient viral transduction. Using the original pMSCV-U6gRNA vector with a single gRNA typically achieves 30-50% transduction efficiency with this approach (Figure 3A, left panel). However, when an additional U6 promoter is inserted for dual sgRNA expression, the percentage of BFP-positive populations driven by the last PGK promoter is typically reduced to approximately 20%, (Figure 3B, left panel). This reduction in transcriptional efficiency is a common limitation when multiple promoters are used in tandem. To mitigate this issue, optimization can be achieved by exploring the use of stronger promoters, experimenting with different promoter combinations, and fine-tuning promoter strength through specific sequence modifications.

Figure 3.

Viral transduction efficiency

(A) Representative flow cytometry plots showing high (left) and low (right) transduction efficiency for MSCV-U6gRNA vectors containing a single gRNA.

(B) Representative flow cytometry plots showing high (left) and low (right) transduction efficiency for MIGR1-U6gRNA vectors containing two gRNAs.

This dual sgRNA system incorporates two U6 promoters and a PGK promoter-driven transcription. To validate its functionality, we constructed the following vector configurations: a non-targeting (NonT) gRNA in both cassettes, a RORγt gRNA in the first cassette with a NonT gRNA in the second, and a NonT gRNA in the first cassette with a RORγt gRNA in the second. We confirmed that the presence of RORγt gRNA in either cassette led to diminished RORγt protein expression, indicating efficient RORγt gene deletion in Th17 (Figure 4A). Since RORγt is the master transcription factor of IL-17A, we measured the IL-17A expression and observed similar reduction (Figure 4B). These results demonstrated that both U6gRNA cassettes function effectively in our dual sgRNA system. For those constructing the vector for the first time, it is essential to validate the dual sgRNA system’s functionality by testing it on a proper target protein, even if it is not related to Th17 studies. Next, validate the CRE deletion using genomic DNA from sorted Th17 cells. If the deletion is insufficient, adjust the targeting sites accordingly.

Figure 4.

Validation of the functionality of the dual sgRNA system

(A) CD4⁺ T cells are transduced with MIGR1-U6gRNA2 vectors containing: NonT gRNAs in both cassettes (left), a RORγt gRNA in the first cassette and the NonT gRNA in the second (middle), and the NonT gRNA in the first cassette and the RORγt gRNA in the second (right). Cells were polarized under Th17 differentiation for three days post-transduction. Representative flow cytometry plots show RORγt expression under each condition.

(B) Flow cytometry analysis of IL-17A production in Th17 cells listed in (A), which were stimulated with PMA and ionomycin in the presence of GolgiStop for 4 h.

When 1 x 10⁵ cells are adoptively transferred, EAE symptoms typically manifest in Rag1^−/− recipient mice 8-9 days post-immunization with 200 μg MOG35-55 and 20 ng of PTX. As the 2D2 TCR-expressing Th17 cells are adoptively transferred, EAE induction in recipient mice will lead to a progressively worsening disease without recovery, unlike in wild-type mice. In Rag1^−/− recipients, which lack endogenous T cells, the transferred antigen-specific Th17 cells drive severe and sustained EAE. This contrasts with wild-type mice, where EAE is induced by a polyclonal CD4⁺ T cell response, often show partial recovery after reaching peak disease, as indicated by a reduction in EAE scores. The number of infiltrating CD4⁺ T cells in the CNS of Rag1^−/− recipient mice is typically around several x 10⁵ cells. With a known number of counting cells (e.g., 2 x 10⁵ of counting cells), 1/5 volume of cell suspension is used to determine the cell number (refer to Step 22a), calculate the total number of lymphocytes based on the relative percentages of CD45⁺ cells and counting cells:

$$\text{Total}\text{Lymphocytes}=(\%\text{of}\text{CD}{45}^{+}\text{cells}/\%\text{of}\text{counting}\text{cells})\mathrm{x}\text{Number}\text{of}\text{counting}\text{cells}\mathrm{x}5$$

$$\text{CD}{4}^{+}\mathrm{T}\text{cells}=\text{Total}\text{Lymphocytes}\mathrm{x}\%\text{of}\text{CD}{4}^{+}\mathrm{T}\text{cells}\text{among}\text{CD}{45}^{+}\text{cells}$$

Limitations

While this protocol is highly reproducible for gene knockout, it requires the use of Cas9-expressing mice to achieve efficient sgRNA delivery. This requirement arises from the limited 8-10 kb capacity of viral vectors, which is typically allocated to vector backbone elements (e.g., long terminal repeats and ψ packaging signal), regulatory sequence, transgene and polyadenylation signal. Including the Cas9 coding sequence within the vector often pushes it to its maximal capacity, leading to significantly lower transduction rates and making it challenging to generate sufficient cells for evaluation. This limitation may pose difficulties for labs that do not have access to this specific mouse strain.

Troubleshooting

Problem 1: No insertion of gRNA

For “Single sgRNA vector construction”, insertion of the gRNA duplex is typically straightforward and highly efficient (Figure 2). However, there are rare cases where no insertion occurs, despite following the standard cloning procedure.

Potential solution

• •When using alternative vectors, ensure that the sticky ends from the annealed primers match the sticky ends of the vector to ensure correct ligation.
• •Optimize primer design to avoid the formation of secondary structures.
• •Use high-efficiency ligation kits (e.g., NEB Quick Ligation Kit, Thermo Fisher Scientific Rapid DNA Ligation Kit) or alternative fast ligases.
• •Avoid using old T4 DNA ligase buffer, as it may have degraded from ATP. Minimize freeze/thaw cycles by aliquoting the buffer into smaller volumes to maintain its effectiveness.
• •Adjust the digestion time for backbone vector to an appropriate period (1-2 h). Both overly short and long incubation times can lead to inefficient digestion or over-digestion, hindering successful ligation. The optimal digestion time can be determined by comparing the linearized plasmid with the circular plasmid as a negative control through gel electrophoresis. In this comparison, the linearized plasmid will appear at the expected size, migrating according to its full length, while the circular plasmid will migrate faster due to its supercoiled nature, appearing smaller on the gel despite being larger in actual size. For researchers using our plasmids deposited to Addgene, successful digestion can be easily visualized using a Gel Doc system after digestion. This is because we have added an approximate 600 bp filler sequence between U6 promoter and gRNA scaffold, allowing digestion efficiency to be judged by checking this digested band.
• •Confirm that the enzymes used (e.g., restriction enzymes and T4 DNA ligase) are freshly prepared and their activities are optimal. Proper enzyme storage and activity checks before use can help ensure consistent and successful results.

Problem 2: Low survival of Th17 cells

A successful Th17 differentiation, indicated by a high survival rate of over 80%, represents a good outcome (Figure 5, left). However, in some cases, the cells exhibit a low survival rate (Figure 5, right).

Figure 5.

Survival of Th17 cells

(A) Representative flow cytometry plots showing high (left) and low (right) survival of Th17 cells polarized for three days.

Potential solution

• •Avoid extending viral transduction beyond 12 h when using polybrene.
• •Perform a dose-dependent experiment to determine whether the cell death is caused by high titer virus. If so, optimize the viral titer to the lowest level that still provides adequate transduction efficiency without causing significant cell death.
• •When using alternative packaging cell lines other than Plat-E, optimize the incubation time with viral supernatant ensure high transduction without causing excessive cell death.
• •Avoid keeping cells to remain in yellow medium for more than 24 h. Two days after adding Th17 differentiation cytokines when the medium become slightly yellow, add an additional 1 mL of differentiation medium to each well.

Problem 3: Low retroviral transduction efficiency

When using the vector with a single U6gRNA cassette, we generally achieve over 30% viral transduction in primary CD4⁺ T cells even without additional transduction enhancers (Figure 3A, left panel). When using the vector with two U6gRNA cassettes, we generally achieve an approximate 20% viral transduction (Figure 3B, left panel). However, in some cases, the cells exhibit poor or failed transduction (Figures 3A and 3B, right panels).

Potential solution

• •Use freshly thawed Plat-E packaging cells with minimal subculturing, ensuring that the cells are cultured at a density below 80% during maintenance.
• •Ensure reagents are in good condition, such as plasmid DNA with high purity, integrity and concentration, and that transfection reagent is not expired.
• •Use DMEM medium without selection antibiotics and serum for making transfection reagent mixture.
• •Avoid using viral supernatants for downstream applications when BFP is poorly expressed in the packaging cells (less than 70%), as this indicates low transfection efficiency or failure.
• •Avoid shortening the incubation time for activated CD4⁺ T cells with retroviral superannuants as the minimum is 5 h, including 2 h for centrifugation. Extended incubation times (but less than 12 h) can enhance viral production.
• •Ensure strong activation of CD4⁺ T cells, as retroviral transduction requires strong activation. Coating plates with anti-CD3/CD28 antibodies alone may not provide sufficient activation for transduction. We have verified two sources of secondary antibodies, but researchers should test other antibodies independently. Using Dynabeads T-activator CD3/CD28 is an alternative but relatively expensive approach for optimal activation.

Problem 4: Low recovery of cells from the CNS

Using Tg^TCR2D2 Th17 cells, we can recover approximately 3 x 10⁵ cells CD4⁺ T cells from the CNS of Rag1^−/− mice (see “Tissue collection and cell preparation” and “Gradient centrifugation” sections).^1,2 In cases where the number of recovered cells is low, this suggests that the procedures for isolating cells from the CNS may need optimization.

Potential solution

• •Shorten the sorting period for adoptive transfer: Consider increasing the flow rate or concentration of the cell suspension during sorting to minimize the time cells are exposed to stress, thereby improving their survival.
• •Avoid immunizing the Rag1^−/− recipient mice immediately after adoptive transfer of Th17 cells: Instead, immunization should be done about 7 days post-adoptive transfer. This delay allows the transferred cells to properly engraft and proliferate, leading to more accurate assessment and better recovery rates.
• •Ensure successful EAE induction if using self-made EAE kit: Confirm that the EAE model is inducing a severe disease phenotype. In Rag1^−/− mice that received 2D2-expressing Th17 cells, the disease should progress significantly and not resolve, as it may in wild-type mice.
• •Ensure Percoll gradient is prepared correctly: Add the Percoll solution carefully, as a rapid addition may interfere with the proper formation of gradient.

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Zuoming Sun (zsun@coh.org).

Technical contact

Technical questions about performing this protocol should be directed to and will be fulfilled by Xiancai Zhong (xizhong@coh.org).

Materials availability

Parent plasmids generated in this study, excluding those containing specific gRNAs, have been deposited to Addgene (plasmid IDs: 237399, 237400, and 237401) and are available at https://www.addgene.org/. Other plasmids used in this study will be provided by Dr. Zuoming Sun pending scientific review and a submission of material transfer agreement to mta@coh.org.

Data and code availability

This study did not generate/analyze datasets and does not report original code.

Acknowledgments

We thank Dr. Sarah Teichmann (Wellcome Sanger Institute, UK) for providing the pMSCV-U6sgRNA and Dr. Warren S. Pear (University of Pennsylvania) for providing the MIGR1 retroviral vectors. We also thank the following City of Hope core services: Animal Resource Center and Flow Cytometry Core. This work was supported by grants from the National Institutes of Health (NIH) (R01-AI109644 and R21-AI163256), institutional pilot funding, the Jackie and Bruce Barrow Cancer Research Scholars’ Program, the Caltech-CoH Biomedical Initiative, and the AR-DMRI 2024 Innovative Award. Research reported in this publication included work performed in the animal, genomic, and flow cytometry cores supported under NIH grant P30CA033572. The content in this manuscript is solely the responsibility of the authors and does not necessarily represent the official views of the NIH.

Author contributions

X.Z.: conceptualization, resources, investigation, visualization, writing – original draft, and writing – review and editing. H.W.: resources, investigation, visualization, and methodology. G.W.: resources, visualization, and methodology. Z.S.: conceptualization, supervision, funding acquisition, methodology, writing – original draft, and writing – review and editing.

Declaration of interests

The authors declare no competing interests.