Skip to main content
NCBI home page
Wiley Open Access Collection logoLink to Wiley Open Access Collection
. 2025 Jun 9;117(6):e70015. doi: 10.1111/boc.70015

An Auxin Inducible Degradation System to Study Mklp2 Functions in MDCK Epithelial Cells

Morgane Rodriguez 1, Valérie Simon 1, Bénédicte Delaval 1,✉, Benjamin Vitre 1,✉
PMCID: PMC12149487  PMID: 40490973

ABSTRACT

The auxin inducible degradation (AID) system, which allows for rapid and inducible degradation of a protein of interest, is an efficient technology to study protein function in cells. This system proves particularly useful to study cellular motors that can be involved in different mechanisms depending on the cell cycle stage. Mitotic kinesin‐like protein 2 (Mklp2) is a member of the kinesin‐6 family involved in intracellular trafficking both in interphase and mitosis. In mitosis, at anaphase onset, it relocates the chromosomal passenger complex (CPC), from the chromatin to the spindle midzone and equatorial cortex. Inhibition or knockdown of Mklp2 therefore leads to CPC re‐localization defects and cytokinesis failure. Existing tools used to study Mklp2 functions in cells, including antibodies, siRNA, and small molecule inhibitors, allowed the identification of the general function of Mklp2 in mitosis. However, these tools induce different intermediate phenotypes during the course of mitosis, highlighting the need for an alternative Mklp2 perturbation approach. We report here a new tool to study the discrete localization of endogenous Mklp2 at different stages of the cell cycle combined with an AID tag that allows the study of the kinesin with high specificity, high efficiency, and high temporal resolution in MDCK (Madin‐Darby canine kidney) epithelial cells. We show that upon auxin treatment, the acute and rapid degradation of Mklp2 results in delayed re‐localization of CPC component Aurora‐B to the spindle midzone during anaphase, cytokinesis failure, and cell binucleation. We validate the specificity of the system by rescuing Mklp2 expression and reversing the phenotypes. Overall, this new tool facilitates the study of endogenous Mklp2 localization and function at specific stages of the cell cycle and offers a highly specific method for exploring its roles in a nontransformed mammalian model cell line widely used to study epithelial organization and dynamics.

This manuscript details the generation of an MDCK cell line in which the kinesin Mklp2 (KIF20A) is targeted at the endogenous level with an auxin inducible degradation (AID) tag and a GFP tag. This new tool facilitates the study of Mklp2 endogenous localization and constitutes a highly specific system for exploring Mklp2 functions at different stages of the cell cycle in a non‐transformed mammalian model cell line widely used to study epithelial organization and dynamics.

graphic file with name BOC-117-e70015-g001.jpg

1. Introduction

A large array of experimental approaches can be used to achieve protein depletion. They can be based on transient targeting of gene products with RNA interference approaches or permanent depletion by targeting the genes themselves with gene editing tools such as CRISPR/Cas9 (Giandomenico and Schuman 2023). Other systems, such as Cre/lox and Frt/Flp systems, can confer spatiotemporal regulation (Driesschaert et al. 2021); however, since these systems target genes or gene products, there is always a delay between gene perturbation induction and the phenotype occurrence, which will depend on protein stability. To achieve fast and acute phenotypes, inducible protein degradation systems have been developed (Prozzillo et al. 2020). The auxin inducible degradation (AID) system, which is derived from a ligand induced degradation system found in plants, has been adapted for protein degradation in mammalian cells, allowing for the rapid degradation of AID‐tagged protein of interest by the proteasome in the presence of the plant hormone auxin (Nishimura et al. 2009; Holland et al. 2012; Yesbolatova et al. 2020). This system is particularly interesting to study proteins that contribute to different functions throughout the cell cycle, such as molecular motors. Indeed, this system was successfully used to dissect the function of dynein at a specific stage of meiosis without perturbing prior function of the motor in C. elegans oocytes (Cavin‐Meza et al. 2022).

Here we report the implementation of an AID tag coupled to an EGFP tag to the kinesin Mklp2 at the endogenous level to facilitate its study in mammalian epithelial cells. Mitotic kinesin‐like protein 2 (Mklp2, also called KIF20A) is a member of the Kinesin‐6 family that orchestrates diverse cellular processes. It was discovered and named Rabkinesin‐6 due to its interaction with the small GTPase Rab6 at the Golgi apparatus (Echard et al. 1998). In interphase cells, it is required for the fission of Rab6 vesicles from the Golgi (Miserey‐Lenkei et al. 2017). In addition to this function in interphase, Mklp2 plays a critical role during cell division. Indeed, antibody microinjection in cells identified a role for Mklp2 in cytokinesis (Hill et al. 2000). Subsequent studies using siRNA approaches further detailed Mklp2 mitotic regulation and functions (Neef et al. 2003; Gruneberg 2004) and showed that, at anaphase onset, Mklp2 relocates the chromosomal passenger complex (CPC), a complex composed of INCENP, the kinase Aurora‐B, Survivin, and Borealin, from the chromatin to the spindle midzone and equatorial cortex (Hadders and Lens 2022). Before anaphase onset, Mklp2 activity is inhibited by Cdk1/Cyclin‐B mediated phosphorylation (Kitagawa et al. 2014). At anaphase onset, upon dephosphorylation, Mklp2 competes with INCENP for chromatin binding, resulting in INCENP chromatin detachment (Serena et al. 2020). Then Mklp2 contributes to Aurora‐B re‐localization to the spindle midzone and equatorial cortex, where it triggers a regulatory cascade resulting in spindle midzone stabilization (Douglas et al. 2010; Su et al. 2011), contractile ring assembly (Yüce et al. 2005), and abscission (Steigemann et al. 2009). An incorrect or incomplete relocalization of the CPC to the spindle midzone during anaphase induces cytokinesis failure, leading to the appearance of multinucleated cells (Kitagawa et al. 2013).

However, the timing and nature of cytokinetic failure resulting from Mklp2 depletion are not fully understood. Indeed, it can result, upon siRNA depletion, from an absence of cytokinetic furrow ingression (Landino et al. 2017) or from a failure to maintain cytokinetic ingression (Kitagawa et al. 2013). As an alternative to siRNA, small molecule inhibitors of Mklp2 motor activity were developed, such as Paprotrain (Tcherniuk et al. 2010) and BKS0349 (Labrière et al. 2016). Despite high specificity for Mklp2 activity, Mklp2 inhibitors induced mitotic defects that were not observed upon siRNA knockdown, for example, misaligned chromosomes or multipolar spindles (Labrière et al. 2016). These defects were proposed to result from the inhibition of Mklp2 kinetochore microtubule attachment functions during prometaphase (Schrock et al. 2022).

The development of alternative new tools to deplete and study Mklp2 in an acute manner at different stages of the cell cycle, thus appears of the utmost importance. We decided to implement an AID system to allow for an inducible and rapid degradation of Mklp2 in MDCK (Madin‐Darby canine kidney) epithelial cells, a widely used nontransformed cell line to study epithelial dynamics and epithelial biophysical properties (Martín‐Belmonte et al. 2008; Wang et al. 1990; Balasubramaniam et al. 2021). An optimized version of the AID degron, the AID2 degron system (Yesbolatova et al. 2020), coupled to an EGFP tag, was inserted at both endogenous alleles of Mklp2 using the CRISPR/Cas9 and homologous recombination approach. Upon auxin treatment, Mklp2 is rapidly degraded, resulting in Aurora‐B re‐localization defects, cytokinesis failure, and cell multinucleation. These defects were rescued by re‐expressing Mklp2, showing the specificity of the system. Overall, we report here a highly specific tool that facilitates the study of Mklp2 functions at specific stages of the cell cycle with high efficiency in a cellular model optimal for exploring epithelial organization and dynamics.

2. Materials and Methods

2.1. Cell Culture

MDCK cells were grown in DMEM Glutamax medium supplemented with 10% fetal bovine serum (FBS), 1% penicillin‐streptomycin, 1% L‐glutamine. MDCK Mklp2‐AID‐GFP mScarlet or Mklp2‐mScarlet cells were generated by transfection of mScarlet or Mklp2‐mScarlet plasmids and sorted based on their fluorescence for stable expression of the proteins.

2.2. Generation of MDCK Mklp2‐AID‐GFP Cells

MDCK Mklp2‐AID‐EGFP cells were generated by adding a mini‐AID tag followed by an EGFP tag at the 3' end of the last exon on the Mklp2 genomic locus. OsTir1‐9xMyc protein was introduced using retroviral transduction and puromycin selection. A clone stably expressing OsTir1 was isolated. Two sgRNA targeting two regions adjacent to the 3’ end of exon 19 of the dog Mklp2 gene (sg1: GCAAAAAATACTAAGGCTGT; sg2: AGGGGAGCGTCGTGAGCGC) were designed using the CRISPOR web tool (Concordet and Haeussler 2018). They were introduced under the control of a U6 promoter in a vector expressing the Cas9 nickase (D10A) (Addgene 74120, Chiang et al. 2016). A donor construct containing 350 bp recombination arms surrounding the 3’ end of the Mklp2 locus, in frame with a sequence encoding an mAID‐EGFP‐STOP sequence, was generated. The donor construct also allows the expression of aminoglycoside phosphotransferase, under the control of the SV40 promoter, to confer resistance to neomycin. The Cas9 vector and the donor construct were transfected in MDCK cells expressing OsTir1 F74G using jetPEI‐DNA transfection reagent (Polyplus). The next day, cells were plated in a 96‐well plate and treated with neomycin (500 µg/mL). Clones heterozygous and homozygous for targeting of the Mklp2 locus were first identified by PCR screening. The targeting of the locus was then confirmed by western blot analysis.

2.3. Establishment of MDCK Fluorescent Cell Lines

For the MDCK Mklp2‐AID‐EGFP H2B‐mCherry cell line used in the live imaging experiment, H2B‐mCherry was inserted using retroviral delivery. Clones were isolated using FACS sorting (Aria Ilu Becton Dickinson) based on mCherry fluorescent signal. For rescue experiments, MDCK Mklp2‐AID‐EGFP cells were transfected with mScarlet and Mklp2‐mScarlet (a gift from Susanne Lens; Adriaans et al. 2020) using Polyplus transfection reagents, and cells expressing similar fluorescent levels of mScarlet were sorted by FACS in batch (Aria Ilu Becton Dickinson).

2.4. Cell Synchronization, Lysates, and Immunoblotting

Cells were treated with thymidine (2 mM) or STLC (5 µM) for 16 h for synchronization in interphase and mitosis, respectively. MDCK cell extracts were obtained after lysis with standard Laemmli buffer. Proteins were separated by SDS‐PAGE electrophoresis and transferred to nitrocellulose membranes. Membranes were blocked with 5% milk in Tris‐buffered saline containing 0.1% Tween‐20 (TBST) and then incubated with primary antibodies overnight at 4°C. Membranes were washed three times with TBST before incubation with secondary fluorescent‐labeled antibodies for 45 min at room temperature. Membranes were revealed using an Odyssey M imager (LicorBio).

2.5. Immunofluorescence

The cells were fixed in −20°C MeOH for binucleation experiments or in 4% paraformaldehyde for other immunofluorescence staining. Cells were blocked with PBS‐BSA 1%‐Triton 0.5% and stained for immunofluorescence with primary and secondary antibodies. Slides were mounted in ProLong Gold (Life Technologies).

2.6. Antibodies

The following primary antibodies were used (western blot WB, immunofluorescence IF): Aurora B (BD Transduction Laboratories #611082, IF: 1/250), Mklp2 (gift from A. Echard, WB: 1/2000), GFP‐FITC (Abcam #ab6662, IF: 1/400), GFP (Proteintech #66002, WB: 1/5000), GFP (Torrey Pines #401, WB: 1/5000), α‐tubulin (DM1α, Sigma‐Aldrich #T6199, WB: 1/1000), E‐cadherin (BD Transduction Laboratories #610182, IF: 1/300), phospho‐PP1 (Abcam #62334, WB: 1/1000), RFP to reveal mScarlet (ChromoTek #6g6, WB: 1/1500), and DAPI (Cell Signaling, IF: 1/10000). Secondary antibodies for IF included Alexa Fluor 647 (#4410S) conjugated anti‐mouse antibody (Molecular Probes, 1/1500), and for WB, anti‐mouse and anti‐rabbit IgG antibodies were used (Invitrogen #SA535521, #SA535571, #35518, and #35568, 1/20000).

2.7. Microscopy and Image Analysis

Live imaging of Mklp2 localization during mitosis was performed at 37°C in a CO2‐controlled atmosphere, using a spinning disk confocal microscope, Nikon Dragonfly Andor, coupled to two EMCCD iXon888 Life Andor cameras (objective: 100×/1.45 NA DT Plan‐Apo), and controlled by Fusion software (Andor, Oxford Instruments). Epifluorescence images of binucleation were acquired using a Leica Thunder microscope coupled to an sCMOS Leica DFC9000 GT USB3 camera (objective: 40×/1.3 NA Plan‐Apo) and controlled by LAS X software. Images of Aurora B localization were acquired using a spinning disk confocal microscope Nikon Ti coupled to a Yokogawa CSU‐X1 spinning disk head and a sCMOS back‐illuminated Prime95B camera (objective: 100×/1.45 NA Plan‐Apo) and controlled by Inscoper software. Live‐cell imaging of cytokinesis failure was performed overnight at 37°C in a CO2‐controlled atmosphere, using an inverted Olympus IX83 microscope equipped with a Zyla 4.2 MP sCMOS camera (objective: 40 × LUCPLFLN 0.6NA RC2, air) and controlled by MetaMorph (Molecular Devices) on cells seeded in a 24‐well plate. Image processing and analysis were performed with ImageJ. Fluorescent localization of Aurora‐B in cells was obtained using the ImageJ Plot Profile tool on the region of interest corresponding to the yellow rectangle visible on the DNA channel images.

2.8. Statistical Analysis

The number of cells counted per experiment for statistical analysis is indicated in figure legends. Graphs were created using GraphPad Prism software and error bars represent the standard deviation. p values were calculated using a two‐tailed Student's t test. **p < 0.001, ***p < 0.001, and ****p < 0.0001.

3. Results

In order to develop a rapid inducible degradation system of endogenous Mklp2 in MDCK epithelial cells, we chose to fuse an auxin inducible degron (AID) tag to the endogenous Mklp2 protein. The AID tag allows for a quick and reversible degradation of a variety of proteins in multiple cell systems (Nishimura et al. 2009; Holland et al. 2012; Yesbolatova et al. 2020; Vitre et al. 2020). Upon 5‐phenyl‐indole‐3‐acetic acid (5‐Ph‐IAA, hereafter called auxin) treatment, the AID tagged protein of interest is poly‐ubiquitinated through the activity of an SCF ubiquitin ligase containing the plant F‐box protein OsTir1 that recognizes the degron tag, leading to its targeting to the proteasome for degradation. To generate an Mklp2 degradable MDCK cell line, a modified version of Oryza sativa Tir1, OsTir1 F74G (Yesbolatova et al. 2020), was first introduced into MDCK cells using retroviral delivery. Cells were selected using puromycin treatment, and a clone stably expressing OsTir1‐F74G was isolated. We then genetically modified these cells using CRISPR‐Cas9 and homologous recombination. Both endogenous alleles of Mklp2 were targeted at their C‐termini in order to introduce a sequence encoding for a modified AID2 tag, followed by an EGFP tag (Figure 1A). Cells were co‐transfected with a plasmid encoding for a Cas9 nickase (Chiang et al. 2016) and a donor plasmid encoding the AID‐EGFP tag surrounded by recombination arms (see methods for details). Clones targeted on both alleles were isolated and screened by PCR, and the addition of the AID‐EGFP tag to endogenous Mklp2 protein was validated by western blot (Figure 1B). Mklp2 molecular weight switched from 100 kDa for the wild type protein to 133 kDa for the AID‐EGFP tagged protein (Figure 1B). The absence of signal at 100 kDa, in the modified cell line confirmed the targeting of both Mklp2 endogenous alleles (Figure 1B). We then assessed the localization of Mklp2‐AID‐EGFP using live microscopy and confirmed the expected localization of Mklp2 at different stages of the cell cycle. Indeed, Mklp2 showed a dim nuclear localization in interphase, a dim cytoplasmic localization in prometaphase, and a strong accumulation at the mid‐spindle in early anaphase, evolving toward a very strong and discrete accumulation at the spindle midzone microtubule bundle in late anaphase (Figure 1C and Movie 1). In addition to those conventional localizations, EGFP tagging of endogenous Mklp2 allowed its visualization at localizations that are more difficult to label using immunofluorescence staining. For example, Mklp2‐AID‐EGFP accumulation was observed in the vicinity of the cell cortex in early anaphase (Figure 1C and Movie 1), consistent with its localization on microtubules extending toward the cortex upon overexpression in mitotic HeLa cells (Adriaans et al. 2020). Mklp2‐AID‐EGFP was also visible at midbody remnants after cell division (Figure S1B). Altogether, these results indicate that the endogenous tagging method can be used to monitor Mklp2 without affecting its localization.

Figure 1.

Figure 1

Open in a new tab

Characterization of Mklp2‐AID‐EGFP MDCK epithelial cells. (A) Schematic of Mklp2 endogenous allele targeting. (B) Western blot showing endogenous wild type Mklp2 and targeted Mklp2‐AID‐EGFP protein (anti Mklp2 antibody). α‐Tubulin is used as a loading control. After auxin addition, Mklp2‐AID‐EGFP degradation is visualized over 180 min. (C) Images of MDCK cells expressing Mklp2‐AID‐EGFP and H2B‐mCherry at different stages of the cell cycle. (D) Western blot of Mklp2‐AID‐EGFP protein (anti GFP antibody) degradation upon auxin treatment in cells arrested in mitosis. Mitotic arrest is visible with the increased phosho‐PP1 signal observed in STLC treated cells compared to cells arrested in interphase with thymidine (Thy.). The graph at the bottom represents the ratio of GFP signal intensity to the control with no auxin treatment (t 0: 100%), at indicated time points. Signals were normalized to tubulin loading control. Bars indicate the mean of a minimum of two experiments, and error bars represent the standard deviation. AID‐EGFP: Mklp2‐AID‐EGFP targeted cell line. (E) Images of Mklp2‐AID‐EGFP degradation upon auxin treatment. WT, wild type nontargeted MDCK cells.

To assess the efficiency of the AID degron system, we then treated the cells with auxin (1 µM final) to induce Mklp2 degradation. In asynchronous cells, more than 90% of protein degradation was observed by western blot 1 h after treatment, and the degradation was complete after 2 h of auxin treatment (Figure 1B). We also tested the efficiency of the degron system in mitotic cells by inducing Mklp2‐AID‐EGFP degradation in cells arrested in mitosis using Eg5 inhibitor STLC (Figure 1D). In this condition 76% of Mklp2‐AID‐EGFP was degraded after 1 h of auxin treatment and 95% after 2 h. Protein degradation was also observed by live imaging (Figure 1E). Indeed, 1 h after auxin treatment, Mklp2‐AID‐EGFP was no longer visible at the spindle midzone in early anaphase (Figure 1E, left; Figure S1A, left). At the same time point, a faint EGFP signal was still visible at the mid‐spindle microtubule bundle in late anaphase (Figure 1E, middle; Figure S1A, middle), but this late anaphase signal completely disappeared after 2 h of auxin treatment (Figure 1E, right; Figure S1A, right). These results indicate that AID‐EGFP tagging of endogenous Mklp2 allows for an acute degradation of the protein upon auxin treatment in both asynchronous and mitotic cells.

To further characterize the Mklp2‐AID‐EGFP MDCK line, we investigated the phenotypes resulting from the complete degradation of Mklp2. Mklp2 is essential for CPC re‐localization from chromatin to the spindle midzone and equatorial cortex in anaphase (Gruneberg 2004). We thus used the re‐localization of Aurora‐B, the kinase part of the CPC, as a read‐out of CPC re‐localization and proper Mklp2 function. In the control condition, we observed that in early anaphase, the Aurora‐B signal was lost from chromatin and re‐localized to the mid‐spindle, where it co‐localized with Mklp2‐AID‐EGFP, indicating that the tagged endogenous Mklp2 was able to re‐localize the CPC (Figure 2A, top). Upon auxin treatment, Mlkp2 was degraded, and the Aurora‐B signal was retained at the chromatin, indicating a re‐localization defect (Figure 2A, bottom). These results are consistent with Mklp2 siRNA depletion (Gruneberg 2004) or Mklp2 chemical inhibition (paprotrain) (Taulet et al. 2017) and showed that efficient inducible degradation of Mklp2 impairs the proper re‐localization of Aurora‐B to the spindle midzone in anaphase. To confirm that the delay in Aurora‐B re‐localization was specific to Mklp2 degradation, we then performed a rescue experiment. Mklp2‐mScarlet or mScarlet, were transfected in the Mklp2‐AID‐EGFP MDCK cell line. Stable cell lines expressing Mklp2‐mScarlet or mScarlet were selected by FACS (fluorescence‐activated cell sorting), and protein expression was controlled by western blot analysis (Figure 2B). Of note, expression of mScarlet or Mklp2‐mScarlet did not impair endogenous Mklp2‐AID‐EGFP degradation upon auxin treatment (Figure 2B). As expected, cells expressing mScarlet showed a strong retention of Aurora‐B at the chromatin during anaphase upon Mklp2 degradation (Figure 2C). However, a complete re‐localization of Aurora‐B was observed in cells expressing Mklp2‐mScarlet (Figure 2C). Quantification of Aurora‐B re‐localization delay measured by the ratio of Aurora‐B signal at the spindle midzone to the signal on chromatin confirmed the rescue of Mklp2 degradation with Mklp2‐mScarlet (Figure 2D).

Figure 2.

Figure 2

Open in a new tab

Mklp2 degradation induces Aurora‐B re‐localization defects. (A) Immunofluorescence images showing Aurora‐B and Mklp2‐AID‐EGFP localization during early anaphase in cells treated with DMSO or Auxin. Graphs on the left represent the fluorescent intensity profile of the indicated channels within the yellow square represented on the DNA images. (B) Left panel, western blot showing Mklp2‐mScarlet and Mklp2‐AID‐EGFP expression (using anti‐Mklp2 antibody) in the MDCK Mklp2‐AID‐EGFP cell line. Right panel, western blot showing Mklp2‐mScarlet and mScarlet expression (using anti‐RFP antibody) in the MDCK Mklp2‐AID‐EGFP cell line. (C) Immunofluorescence images showing Aurora‐B, Mklp2‐AID‐EGFP, mScarlet, or Mklp2‐mScarlet wild type localization during anaphase in cells treated with DMSO or Auxin for 9 h. (D) Ratio of the mean fluorescence intensity of Aurora‐B at the spindle midzone divided by the mean fluorescence intensity of Aurora B at the chromatin. n = 94, n = 92, and n = 97 cells for mScarlet (DMSO), mScarlet (Auxin), and Mklp2‐mScarlet conditions, respectively. Bars indicate the mean of three experiments; error bars represent the standard error of the mean (SEM). ****p < 0.0001.

To functionally assess the effect of Mklp2‐AID‐EGFP degradation on cell division, we monitored multinucleated cell formation previously described in studies using antibody perturbation, siRNA depletion, or small molecule inhibition (Hill et al. 2000; Neef et al. 2003; Schrock et al. 2022). Live imaging of MDCK Mklp2‐AID‐EGFP cells showed that upon Mklp2 degradation, cells failed to achieve successful cytokinesis, leading to the appearance of binucleated cells, 2 h after auxin addition (Figure 3A; Movies 2 and 3). This result is consistent with Mklp2 degradation timing observed by western blot (Figure 1). To confirm that the multinucleation phenotype was specific to Mklp2 degradation, we expressed mScarlet or Mklp2‐mScarlet and induced Mklp2‐AID‐EGFP degradation. As expected, cells depleted in Mklp2 and expressing mScarlet showed a strong proportion of multinucleated cells (54.4%, Figures 3B,C). However, the expression of Mklp2‐mScarlet rescued the multinucleation phenotype (1.9%, Figures 3B,C) demonstrating that the cytokinesis failure defect was specific to Mklp2 degradation. Altogether, these results show that the Mklp2‐AID‐EGFP MDCK cell line generated here can be used as a new tool to study Mklp2 functions in epithelial cells.

Figure 3.

Figure 3

Open in a new tab

Mklp2 degradation results in cytokinesis failure and cell multinucleation. (A) Still images from Movie 2 showing a cell going through mitosis and failing to complete cytokinesis, leading to its binucleation in the auxin treatment condition. Numbers indicate the time since auxin treatment. Dotted lines indicate the dividing cell periphery. (B) Immunofluorescence images of MDCK Mklp2‐AID‐EGFP mScarlet or MDCK Mklp2‐AID‐EGFP Mklp2‐mScarlet cell lines after 48 h of DMSO or Auxin treatment. (C) Quantification of the percentage of binucleated cells after 24 h of DMSO or Auxin treatment. Bars indicate the mean of three experiments; error bars represent the standard error of the mean (SEM). **p < 0.001.

4. Discussion

We report here a new tool to study the discrete localization of endogenous Mklp2 at different stages of the cell cycle, combined with a highly specific tool that allows an acute degradation of endogenous Mklp2 in MDCK epithelial cells. Using the MDCK Mklp2‐AID‐EGFP line generated here, we show that auxin addition triggers a rapid degradation of Mklp2, resulting in strong Aurora‐B re‐localization defects and subsequent cytokinesis failure leading to multinucleated cells.

The development of this rapid and versatile degradation system will be an important addition to the existing perturbation systems. Compared to siRNA approaches classically used that take multiple days to achieve full protein depletion and can cause nonspecific phenotypes, this system allows complete protein degradation in less than 2 h and can be combined with wild type or mutant protein expression to validate the specificity of the observed phenotypes. This AID system is also an alternative to small molecule inhibition of Mklp2 motor activity. Indeed, while chemical inhibition shows high efficiency, it also triggers prometaphase phenotypes (Schrock et al. 2022) that were not observed upon siRNA depletion, raising questions regarding potential nonspecific effects. This AID system will thus be of particular interest to tackle the roles of MKLP2 at different stages of the cell cycle.

The regulation of Mklp2 either by phosphorylation (Neef et al. 2003; Kitagawa et al. 2014; Fung et al. 2017) or through the binding of a regulatory partner (Serena et al. 2020; Taulet et al. 2017; Adriaans et al. 2020) is essential for its activity. By combining rapid degradation of endogenous Mklp2 with inducible expression of wild type or mutant Mklp2, the system described here will, in the future, allow the study of Mklp2 cellular roles at different stages of the cell cycle, while controlling the degradation timing of the endogenous protein and the expression level of wild type or mutant rescue constructs.

Finally, to study the consequence of polyploidization on genome stability in mammalian cells, researchers use chemical perturbation of the cytoskeleton or of the mitotic checkpoint (Gemble et al. 2022; Kim et al. 2010; Nakayama et al. 2014), which are known to cause chromosome segregation defects and DNA damage (Janssen et al. 2011). As an alternative, AID degron systems of Cyclin A and Cyclin B were previously shown to be efficient at inducing mitotic slippage without chemical perturbation (Gemble et al. 2022; Hégarat et al. 2020). The Mklp2 AID system described here provides an interesting alternative system to acutely perturb cytokinesis and transiently induce a high level of cell polyploidization. This tool will thus more generally be useful to assess consequences of cytokinesis perturbation and cell polyploidization on genome stability or epithelial tissue organization.

Author Contributions

Conceptualization: Bénédicte Delaval and Benjamin Vitre. Investigation: Morgane Rodriguez, Valérie Simon, Bénédicte Delaval, and Benjamin Vitre. Methodology: Morgane Rodriguez, Valérie Simon, Bénédicte Delaval, and Benjamin Vitre. Supervision: Bénédicte Delaval and Benjamin Vitre. Funding acquisition: Bénédicte Delaval and Benjamin Vitre. Writing Morgane Rodriguez, Bénédicte Delaval, and Benjamin Vitre with inputs from Valérie Simon.

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Supporting information

BOC-117-e70015-s003.docx (2.5MB, docx)

Supporting information

Download video file (3.3MB, avi)

Supporting information

Download video file (1.3MB, avi)

Supporting information

Download video file (1.1MB, avi)

Acknowledgments

This work was supported by the Agence National de la Recherche, grant number ANR‐18‐CE11‐0025‐01 to BV and grant number ANR‐19‐CE13‐0014 LUCELL to BD and by the Fondation pour la Recherche Médicale, grant number EQU20210301256 to BD. This project have received financial support from the CNRS through the MITI interdisciplinary programs. We acknowledge the Biocampus Montpellier Ressources Imagerie (MRI) facility that contributed to the project by providing imaging and FACS sorting technologies and support. MRI is member of the national infrastructure France‐BioImaging supported by the French National Research Agency (ANR‐10‐INBS‐04, «Investments for the future»).

Funding: This work was supported by the Agence National de la Recherche, grant number ANR‐18‐CE11‐0025‐01 to BV and grant number ANR‐19‐CE13‐0014 LUCELL to BD and by the Fondation pour la Recherche Médicale, grant number EQU20210301256 to BD. This project has received financial support from the CNRS through the MITI interdisciplinary programs. We acknowledge the Biocampus Montpellier Ressources Imagerie (MRI) facility that contributed to the project by providing imaging and FACS sorting technologies and support. MRI is member of the national infrastructure France‐BioImaging supported by the French National Research Agency (ANR‐10‐INBS‐04, «Investments for the future»).

Contributor Information

Bénédicte Delaval, Email: benedicte.delaval@crbm.cnrs.fr.

Benjamin Vitre, Email: benjamin.vitre@crbm.cnrs.fr.

References

  1. Adriaans, I. E. , Hooikaas P. J., Aher A., et al. 2020. “MKLP2 Is a Motile Kinesin That Transports the Chromosomal Passenger Complex During Anaphase.” Current Biology 30, no. 13: 2628–2637.e9. [DOI] [PubMed] [Google Scholar]
  2. Balasubramaniam, L. , Doostmohammadi A., Saw T. B., et al. 2021. “Investigating the Nature of Active Forces in Tissues Reveals How Contractile Cells Can Form Extensile Monolayers.” Nature Materials 20: 1156–1166. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Cavin‐Meza, G. , Kwan M. M., and Wignall S. M.. 2022. “Multiple Motors Cooperate to Establish and Maintain Acentrosomal Spindle Bipolarity in C. Elegans Oocyte Meiosis.” eLife 11: 1–33. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Chiang, T. W. W. , Le Sage C., Larrieu D., Demir M., and Jackson S. P.. 2016. “CRISPR‐Cas9D10A Nickase‐Based Genotypic and Phenotypic Screening to Enhance Genome Editing.” Scientific Reports 6: 1–17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Concordet, J. , and Haeussler M.. 2018. “CRISPOR: Intuitive Guide Selection for CRISPR /Cas9 Genome Editing Experiments and Screens.” Nucleic Acids Research 46: 242–245. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Douglas, M. E. , Davies T., Joseph N., and Mishima M.. 2010. “Aurora B and 14‐3‐3 Coordinately Regulate Clustering of Centralspindlin During Cytokinesis.” Current Biology 20: 927–933. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Driesschaert, B. , Mergan L., and Temmerman L.. 2021. “Conditional Gene Expression in Invertebrate Animal Models.” Journal of Genetics and Genomics 48: 14–31. [DOI] [PubMed] [Google Scholar]
  8. Echard, A. , Jollivet F., Martinez O., Lacapère JJ., Rousselet A., Janoueix‐Lerosey I., and Goud B.. 1998. “Interaction of a Golgi‐associated kinesin‐like protein with Rab6.” Science (1979) 279: 580–585. [DOI] [PubMed] [Google Scholar]
  9. Fung, S. Y. S. , Kitagawa M., Liao P. J., Wong J., and Lee S. H.. 2017. “Opposing Activities of Aurora B Kinase and B56‐PP2A Phosphatase on MKlp2 Determine Abscission Timing.” Current Biology 27: 78–86. [DOI] [PubMed] [Google Scholar]
  10. Gemble, S. , Wardenaar R., Keuper K., et al. 2022. “Genetic Instability From a Single S Phase After Whole‐Genome Duplication.” Nature 604: 146–151. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Giandomenico, S. L. , and Schuman E. M.. 2023. “Genetic Manipulation and Targeted Protein Degradation in Mammalian Systems: Practical Considerations, Tips and Tricks for Discovery Research.” FEBS Open Bio 13: 1164–1176. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Gruneberg, U. 2004. “Relocation of Aurora B From Centromeres to the Central Spindle at the Metaphase to Anaphase Transition Requires MKlp2.” Journal of Cell Biology 166: 167–172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Hadders, M. A. , and Lens S. M. A.. 2022. “Changing Places: Chromosomal Passenger Complex Relocation in Early Anaphase.” Trends in Cell Biology 32: 165–176. [DOI] [PubMed] [Google Scholar]
  14. Hégarat, N. , Crncec A., Suarez Peredo Rodriguez M. F., et al. 2020. “Cyclin A Triggers Mitosis Either Via the Greatwall Kinase Pathway or Cyclin B.” Embo Journal 39: 1–23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Hill, E. , Clarke M., and Barr F. A.. 2000. “The Rab6‐Binding Kinesin, Rab6‐KIFL, Is Required for Cytokinesis.” EMBO Journal 19: 5711–5719. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Holland, A. J. , Fachinetti D., Han J. S., and Cleveland D. W.. 2012. “Inducible, Reversible System for the Rapid and Complete Degradation of Proteins in Mammalian Cells.” Proceedings of the National Academy of Sciences of the United States of America 109: E3350–E3357. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Janssen, A. , Van Der Burg M., Szuhai K., Kops G., and Medema R. H.. 2011. “Chromosome Segregation Errors as a Cause of DNA Damage and Structural Chromosome Aberrations.” Science (1979) 333: 1895–1898. [DOI] [PubMed] [Google Scholar]
  18. Kim, J. A. , Lee J., Margolis R. L., and Fotedar R.. 2010. “SP600125 Suppresses Cdk1 and Induces Endoreplication Directly From G2 Phase, Independent of JNK Inhibition.” Oncogene 29: 1702–1716. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Kitagawa, M. , Fung S. Y. S., Hameed U. F. S., Goto H., Inagaki M., and Lee S. H.. 2014. “Cdk1 Coordinates Timely Activation of MKlp2 Kinesin With Relocation of the Chromosome Passenger Complex for Cytokinesis.” Cell Reports 7: 166–179. [DOI] [PubMed] [Google Scholar]
  20. Kitagawa, M. , Fung S. Y. S., Onishi N., Saya H., and Lee S. H.. 2013. “Targeting Aurora B to the Equatorial Cortex by MKlp2 Is Required for Cytokinesis.” PLoS ONE 8: e64826. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Labrière, C. , Talapatra S. K., Thoret S., Bougeret C., Kozielski F., and Guillou C.. 2016. “New MKLP‐2 Inhibitors in the Paprotrain Series: Design, Synthesis and Biological Evaluations.” Bioorganic & Medicinal Chemistry 24: 721–734. [DOI] [PubMed] [Google Scholar]
  22. Landino, J. , Norris S. R., Li M., Ballister E. R., Lampson M. A., and Ohi R.. 2017. “Two Mechanisms Coordinate the Recruitment of the Chromosomal Passenger Complex to the Plane of Cell Division.” Molecular Biology of the Cell 28: 3634–3646. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Martín‐Belmonte, F. , Yu W., Rodríguez‐Fraticelli A. E., et al. 2008. “Cell‐Polarity Dynamics Controls the Mechanism of Lumen Formation in Epithelial Morphogenesis.” Current Biology 18: 507–513. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Miserey‐Lenkei, S. , Bousquet H., Pylypenko O., et al. 2017. “Coupling Fission and Exit of RAB6 Vesicles at Golgi Hotspots Through Kinesin‐Myosin Interactions.” Nature Communications 8, no. 1: 1254. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Nakayama, Y. , Saito Y., Soeda S., et al. 2014. “Genistein Induces Cytokinesis Failure Through RhoA Delocalization and Anaphase Chromosome Bridging.” Journal of Cellular Biochemistry 115: 763–771. [DOI] [PubMed] [Google Scholar]
  26. Neef, R. , Preisinger C., Sutcliffe J., et al. 2003. “Phosphorylation of Mitotic Kinesin‐Like Protein 2 by Polo‐Like Kinase 1 Is Required for Cytokinesis.” Journal of Cell Biology 162: 863–875. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Nishimura, K. , Fukagawa T., Takisawa H., Kakimoto T., and Kanemaki M.. 2009. “An Auxin‐Based Degron System for the Rapid Depletion of Proteins in Nonplant Cells.” Nature Methods 6: 917–922. [DOI] [PubMed] [Google Scholar]
  28. Prozzillo, Y. , Fattorini G., Santopietro M. V., et al. 2020. “Targeted Protein Degradation Tools: Overview and Future Perspectives.” Biology (Basel) 9: 1–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Schrock, M. S. , Scarberry L., Stromberg B. R., et al. 2022. “MKLP2 Functions in Early Mitosis to Ensure Proper Chromosome Congression.” Journal of Cell Science 135, no. 12: jcs259560. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Serena, M. , Bastos R. N., Elliott P. R., and Barr F. A.. 2020. “Molecular Basis of MKLP2‐Dependent Aurora B Transport From Chromatin to the Anaphase Central Spindle.” Journal of Cell Biology 219, no. 7: e201910059. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Steigemann, P. , Wurzenberger C., Schmitz M. H. A., et al. 2009. “Aurora B‐Mediated Abscission Checkpoint Protects Against Tetraploidization.” Cell 136: 473–484. [DOI] [PubMed] [Google Scholar]
  32. Su, K. C. , Takaki T., and Petronczki M.. 2011. “Targeting of the RhoGEF Ect2 to the Equatorial Membrane Controls Cleavage Furrow Formation During Cytokinesis.” Developmental Cell 21: 1104–1115. [DOI] [PubMed] [Google Scholar]
  33. Taulet, N. , Vitre B., Anguille C., et al. 2017. “IFT Proteins Spatially Control the Geometry of Cleavage Furrow Ingression and Lumen Positioning.” Nature Communications 8, no. 1: 1928. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Tcherniuk, S. , Skoufias D. A., Labriere C., et al. 2010. “Relocation of Aurora B and Survivin From Centromeres to the Central Spindle Impaired by a Kinesin‐Specific MKLP‐2 Inhibitor.” Angewandte Chemie International Edition 49: 8228–8231. [DOI] [PubMed] [Google Scholar]
  35. Vitre, B. , Taulet N., Guesdon A., et al. 2020. “IFT Proteins Interact With HSET to Promote Supernumerary Centrosome Clustering in Mitosis.” EMBO Reports 21: e49234. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Wang, A. Z. , Ojakian G. K., and Nelson W. J.. 1990. “Steps in the Morphogenesis of a Polarized Epithelium. I. Uncoupling the Roles of Cell‐Cell and Cell‐Substratum Contact in Establishing Plasma Membrane Polarity in Multicellular Epithelial (MDCK) Cysts.” Journal of Cell Science 95, no. 1: 137–151. [DOI] [PubMed] [Google Scholar]
  37. Yesbolatova, A. , Saito Y., Kitamoto N., et al. 2020. “The Auxin‐Inducible Degron 2 Technology Provides Sharp Degradation Control in Yeast, Mammalian Cells, and Mice.” Nature Communications 11, no. 1: 5701. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Yüce, Ö. , Piekny A., and Glotzer M.. 2005. “An ECT2‐Centralspindlin Complex Regulates the Localization and Function of RhoA.” Journal of Cell Biology 170: 571–582. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supporting information

BOC-117-e70015-s003.docx (2.5MB, docx)

Supporting information

Download video file (3.3MB, avi)

Supporting information

Download video file (1.3MB, avi)

Supporting information

Download video file (1.1MB, avi)

Articles from Biology of the Cell are provided here courtesy of Wiley

RESOURCES