Cortisol prevents the suppressive effect of LPS on bovine oocyte maturation in vitro

Sameera PREMARATNE; Mahiro TAMURA; Omowumi ADEMOLA; Yuki MURANISHI; Masafumi TETSUKA

doi:10.1262/jrd.2024-086

. 2025 Apr 12;71(3):137–144. doi: 10.1262/jrd.2024-086

Cortisol prevents the suppressive effect of LPS on bovine oocyte maturation in vitro

Sameera PREMARATNE ¹, Mahiro TAMURA ¹, Omowumi ADEMOLA ¹, Yuki MURANISHI ¹, Masafumi TETSUKA ¹

PMCID: PMC12151636 PMID: 40222902

Abstract

During the periovulatory period, local production of cortisol surges in the bovine cumulus-oocyte complex (COC), although its physiological significance is not well understood. As a potent anti-inflammatory agent, cortisol may protect the COC from inflammation caused by lipopolysaccharide (LPS), an endotoxin known to cause infertility in postpartum cows. This study examined the effect of cortisol, together with progesterone (P4), on LPS-challenged bovine oocyte maturation. COCs were aspirated from follicles 2–5 mm in diameter and subjected to in vitro maturation for 21 h with various combinations of LPS, cortisol, cortisone (a substrate for cortisol production), trilostane (a P4 synthesis inhibitor), and nomegestrol acetate (NA; a synthetic progestogen). LPS (0.001, 0.01, 0.1, 1 μg/ml) suppressed oocyte maturation in a dose-dependent manner, and this effect was reversed by concomitant treatment with cortisol (0.1 μM). COCs converted cortisone to cortisol, and the locally produced cortisol (approximately 0.01 μM) was capable of negating the suppressive effect of LPS (1 μg/ml) on oocyte maturation. Trilostane suppressed oocyte maturation by eliminating P4 production, indicating the crucial role of P4 in this process. LPS equally suppressed oocyte maturation, regardless of the presence or absence of P4 or the various doses of NA (0.001–1 μM). This suggests that P4 alone does not inhibit the action of LPS. However, in the absence of P4, cortisol could not suppress the LPS effect on oocyte maturation. Collectively, these findings suggest that the bovine COC can protect itself from the suppressive effects of LPS by producing cortisol, with P4 being essential for this function.

Keywords: Cortisol, In vitro maturation (IVM), Lipopolysaccharide, Oocyte maturation, Progesterone

Postpartum bacterial infections are common and often cause infertility in dairy cows, resulting in an increased culling rate and significant economic losses [1]. The Gram-negative bacterium Escherichia coli is a well-known pathogen involved in uterine and mammary infections, which releases cell wall components such as lipopolysaccharide (LPS), an endotoxin, into the circulation [2,3,4,5]. Circulating LPS can accumulate in follicular fluid during endometritis [3], which appears to be detrimental to oocyte maturation [6, 7] and early embryonic development [8]. The adverse effects of LPS on early-stage follicles could be irreversible and persistent, even after recovering from inflammation [9].

Toll-like receptor-4 (TLR4) is the primary pattern recognition receptor in cells, initiating an immune response with co-receptors cluster of differentiation 14 (CD14) and myeloid differentiation factor-2 (MD2) upon recognizing LPS, and transmitting downstream signaling [10, 11]. This signal propagation promotes MyD88-mediated nuclear translocation of nuclear factor kappa B (NF-κB) and phosphorylation of mitogen-activated protein kinase (MAPK), subsequently inducing the transcription of several proinflammatory cytokine and chemokine genes that orchestrate the inflammatory response in various tissues, including the bovine cumulus-oocyte complex (COC) [6, 11,12,13,14].

Cortisol is a well-known anti-inflammatory agent that acts through the glucocorticoid receptor (GR) [15,16,17,18]. Bovine cumulus cells have been shown to express GR regardless of their maturity [19]. Local production of cortisol surges in parallel with that of P4 in the maturing cumulus oophorus [20, 21]. This process is mediated by 11β-hydroxysteroid dehydrogenase type1 (HSD11B1), a steroidogenic enzyme that converts cortisone, an inert glucocorticoid, into active cortisol [22,23,24,25]. We have also demonstrated that the expression of HSD11B1 and the production of cortisol are augmented by locally produced P4 in the cumulus cells [19]. These results suggest that bovine cumulus cells are a site of glucocorticoid production and action and that P4 can upregulate this system during the periovulatory period.

Previous studies have found that both cortisol and P4 counteract the activation of NF-κB and MAPK pathways and the subsequent release of inflammatory mediators upon LPS-TLR4 binding in various tissues, including bovine endometrial cells [15, 18, 26,27,28,29,30,31,32,33,34]. Collectively, these reports suggest the presence of a similar defense mechanism driven by cortisol and P4 against LPS insult in maturing COC.

In the present study, we investigated this hypothesis by examining the effects of cortisol and P4 on LPS-challenged bovine oocyte maturation in vitro.

Materials and Methods

Ethics approval

The present study was approved by the Animal Experiment Committee of the Obihiro University of Agriculture and Veterinary Medicine (No. 23-6).

Collection and in vitro maturation (IVM) of cumulus-oocyte complexes (COCs)

Abattoir-derived ovaries were transported to the laboratory in saline supplemented with penicillin (100 U/ml) and streptomycin (100 μg/ml; Meiji Seika Pharma Co., Ltd., Tokyo, Japan). COCs were aspirated from follicles 2–5 mm in diameter using a 10 ml syringe fitted with an 18-gauge needle. COCs with a good morphologic appearance, characterized by more than five layers of compact cumulus cells and oocytes with homogeneous cytoplasm, were used for the experiment. IVM of bovine COCs was performed as described elsewhere [19]. Briefly, 8–12 COCs were cultured in round-bottom 96-microwell plates (Corning, Corning, NY, USA) containing 100 μl of Medium 199 HEPES-modified (Sigma-Aldrich, St. Louis, MO, USA), supplemented with 10% (v/v) newborn calf serum (Catalog No. 16010-159; Thermo Fisher Scientific, Roskilde, NY, USA), penicillin (100 U/ml), streptomycin (100 μg/ml), L-glutamine (2 mM; FUJIFILM Wako Pure Chemical Co., Osaka, Japan), and follicle-stimulating hormone (FSH; 0.02 IU/ml; Antrin R10; Kyoritsu Seiyaku, Tokyo, Japan), with or without various combinations of LPS (Escherichia coli 026:B6; Catalog No. 00-4976; Thermo Fisher Scientific), cortisol (Sigma-Aldrich), cortisone (Sigma-Aldrich), trilostane (3β-hydroxysteroid dehydrogenase type 1 inhibitor; Santa Cruz Biotechnology, Dallas, TX, USA), or the synthetic progestogen nomegestrol acetate (NA; Sigma-Aldrich). The culture was performed at 38.5°C with 5% CO₂ for up to 21 h. Steroid hormones and trilostane were added to the culture media using stock solutions prepared in ethanol or DMSO. Specifically, cortisol, cortisone, and NA were dissolved in ethanol (10 mM), and trilostane was dissolved in DMSO (10 mM). For control groups, equivalent volumes of solvents without these compounds were added as needed. The final concentration of ethanol and DMSO in the medium did not exceed 0.1% (v/v).

Experimental design

Experiment 1: Effect of LPS on oocyte nuclear maturation, P4 production, and expression of genes involved in P4 and cortisol synthesis in bovine COCs during IVM

Bovine COCs (8–10 COCs/100 μl/well) were subjected to IVM with different concentrations of LPS (0, 0.001, 0.01, 0.1, and 1 µg/ml) for 21 h. These concentrations were within the range of LPS observed in the follicular fluid of cows with subclinical and clinical endometritis [3]. The group without LPS served as the control. After IVM, denuded oocytes, cumulus cells, and spent medium were collected to evaluate oocyte nuclear maturation, expression of genes involved in P4 and cortisol synthesis, and cumulus P4 production, respectively.

Experiment 2: Effect of added cortisol on oocyte nuclear maturation in LPS-challenged bovine COCs during IVM

Bovine COCs (10 COCs/100 μl/well) were subjected to IVM with LPS (0 or 1 µg/ml) and different concentrations of cortisol (0, 0.1, 1 and 10 µM) for 21 h. The group without LPS or cortisol served as the control. After IVM, oocytes were evaluated for nuclear maturation.

Experiment 3: Effect of added cortisone on oocyte nuclear maturation, local cortisol production, and HSD11B1 gene expression in LPS-challenged bovine COCs during IVM

Bovine COCs (10–12 COCs/100 μl/well) were subjected to IVM with LPS (0 or 1 µg/ml) and cortisone (0 or 0.1 µM) for 21 h. The group without LPS or cortisone served as the control. After IVM, oocytes, cumulus cells, and spent medium were collected for subsequent analyses.

Experiment 4: Effect of P4 deprivation and locally produced cortisol on oocyte nuclear maturation, and expression of genes involved in P4 and cortisol synthesis in bovine COCs during IVM

Bovine COCs (9–10 COCs/100 μl/well) were subjected to IVM with LPS (0 or 1 µg/ml), trilostane, (0 or 10 µM), and/or cortisone (0.1 µM) for 21 h. The group without LPS, trilostane, or cortisone served as the control. Oocytes, cumulus cells, and spent medium were collected after IVM for subsequent analyses.

Experiment 5: Effect of P4 deprivation and nomegestrol acetate (NA) replacement on oocyte nuclear maturation, and HSD11B1 gene expression in LPS-challenged bovine COCs during IVM

Bovine COCs (9–10 COCs/100 μl/well) were subjected to IVM with LPS (0 or 1 µg/ml), trilostane (0 or 10 µM), and NA (0.001, 0.01, 0.1, 1 µM) for 21 h. The group without LPS, trilostane, or NA served as the control. After IVM, oocytes and cumulus cells were collected for subsequent analyses.

Assessment of oocyte nuclear maturation

After IVM, COCs were incubated in Accumax (Innovative Cell Technologies, San Diego, CA, USA) for 5–10 min at room temperature and vortexed to remove cumulus cells. Denuded oocytes were fixed and stained with 1% acetic orcein. Oocyte nuclear maturation was evaluated as described elsewhere [35] using phase-contrast microscopy. Maturation rates were determined as follows: MI% = (number of oocytes at MI or later stages / total oocytes) × 100, MII% = (number of oocytes at MII / total oocytes) × 100.

RNA extraction, cDNA synthesis, and real-time polymerase chain reaction (real-time PCR)

Cumulus cells were lysed in TRIzol reagent (Life Technologies, Carlsbad, CA, USA), and total RNA was extracted according to the manufacturer’s instructions. Residual genomic DNA was removed, and cDNA synthesis was performed using a QuantiTect Reverse Transcription kit (QIAGEN GmbH, Hilden, Germany). Real-time PCR was conducted with FastStart Essential DNA Green Master (Roche Diagnostics GmbH, Mannheim, Germany) on a LightCycler^® 96 (Roche, Basel, Switzerland). The Primer-BLAST tool of the National Centre for Biotechnology Information (NCBI) was used to design primers [36] based on previously reported bovine sequences (Table 1). In this study, we quantified the expression of four genes involved in P4 and cortisol synthesis, namely: steroidogenic acute regulatory protein (StAR), a career protein that transports cholesterol from the outer to the inner mitochondrial membrane, cholesterol side-chain cleavage enzyme (CYP11A1), which converts cholesterol to pregnenolone, 3β-hydroxysteroid dehydrogenase type-1 (HSD3B1), which mediates production of P4 from pregnenolone [37, 38], and HSD11B1. The amplification program consisted of an initial activation at 95^ºC for 10 min, followed by 45 cycles of denaturation at 94^ºC for 10 sec, annealing at 60^ºC for 10 sec, and extension at 72^ºC for 15 sec. The results were normalized to the geometric means of three stably expressed reference genes, ribosomal protein L4 (RPL4), ribosomal protein L15 (RPL15), and TATA-box binding protein (TBP) as previously described [19, 21]. The intra- and inter-assay coefficients of variations were less than 10% for all the measurements.

Table 1. Primers used for real-time PCR.

Gene (bp)		Sequence (5'-3')	GenBank No.	Position ^a
HSD11B1 (111)	F	AAGCAGACCAACGGGAGCATT	NM001123032.1	532-552
	R	GGAGAAGAACCCATCCAGAGCA	NM001123032.1	642-621
StAR (149)	F	CAGCAGAAGGGTGTCATCAGAG	NM_174189.3	767-788
	R	AGGACCTGGTTGATGATGGTCT	NM_174189.3	915-894
CYP11A1 (118)	F	CCCTGAAAGTGACTTGGTTCTTCA	NM_176644.2	1209-1232
	R	GTCAAACTTGTCCGGACTGGAG	NM_176644.2	1326-1305
HSD3B1 (118)	F	CCTTGTACACTTGTGCCCTGAG	NM_174343.3	640-661
	R	AACTTGCAGTGATTGGTCAGGA	NM_174343.3	757-736
RPL4 (116)	F	ACTCCGAGCACCACGCAAGA	NM001014894.1	945-964
	R	TGGTGTTCCTGCGCATGGTCT	NM001014894.1	1060-1040
RPL15 (90)	F	GCGGCAGCCATCAGGGTGAG	NM001077866.1	17-36
	R	AGGAAGCGCATCACGTCCGA	NM001077866.1	106-87
TBP (200)	F	GCCTTGTGCTTACCCACCAACAGTTC	NM001075742.1	1133-1158
	R	TGTCTTCCTGAAACCCTTCAGAATAGGG	NM001075742.1	1332-1305

Open in a new tab

^a Nucleotide position in the reported sequence. HSD11B1, 11β-hydroxysteroid dehydrogenase type 1; StAR, steroidogenic acute regulatory protein; CYP11A1, cholesterol side-chain cleavage enzyme; HSD3B1, 3β-hydroxysteroid dehydrogenase type 1; RPL4, ribosomal protein L4; RPL15, ribosomal protein L15; TBP, TATA-box binding protein.

Steroid hormone assay

Cortisol concentration in the spent medium was measured using a commercial ELISA kit (Item No. 500360; Cayman Chemical Company, Ann Arbor, MI, USA). P4 levels were measured using a Progesterone ELISA kit (Item No. 582601; Cayman), combined with an anti-P4 serum (Catalog No. BC-1113; Oxis International, Foster City, CA, USA). The samples were diluted 1:10 or 1:20 for cortisol and 1:50 for P4 with EIA buffer. The detection limits were 30 pg/ml for cortisol and 20 pg/ml for P4. Blank values were determined and subtracted where necessary. The standard range for both assays was 7.8–1000 pg/ml. Cross-reactivities of the cortisol monoclonal antibody were as follows: cortisone (0.13%), pregnenolone (< 0.01%), and P4 (< 0.01%). The P4 antibody showed cross-reactivities with cortisone (0.11%) and pregnenolone (< 0.01%). The intra- and inter-assay coefficients of variation for cortisol and P4 were both < 10%.

Statistical analysis

Data were analyzed using the R computing environment [39] and Eazy R [40]. Logistic regression was used to analyze oocyte maturation rates. Data for mRNA expression and steroid concentrations were transformed to base 10 logarithms and analyzed using one-way ANOVA, followed by Tukey’s multiple comparison test. Results are presented as mean ± SEM, and differences among groups were considered significant at P < 0.05.

Results

Effect of LPS on oocyte nuclear maturation, P4 production, and expression of genes involved in P4 and cortisol synthesis in bovine COCs during IVM

The MII rate was significantly decreased in oocytes matured with 0.01 µg/ml (65.9%, P < 0.05), 0.1 µg/ml (66.7%, P < 0.05), and 1 μg/ml (59.3%, P < 0.05). LPS compared to the control (87.6%) (Fig. 1A). MI rates ranged from 89–98.9% and did not change significantly.

LPS, regardless of the dose, did not affect P4 production (Fig. 1B) or the expression of genes involved in P4 synthesis: StAR (Fig. 1C), CYP11A1 (Fig. 1D), and HSD3B1 (Fig. 1E). Moreover, LPS did not alter the relative expression level of HSD11B1, which is responsible for converting cortisone to cortisol (Fig. 1F).

Effect of added cortisol on oocyte nuclear maturation in LPS-challenged bovine COCs during IVM

The MII rate was significantly reduced by LPS (67.3%, P < 0.05) compared to the control (88.9%, P < 0.05). The addition of cortisol at 0.1 μM and 10 μM reversed the effect of LPS on the MII rate (80.4% and 85.1%, respectively, P < 0.05) (Fig. 2A). MI rates were between 93.3–100% across treatments.

Effect of added cortisone on oocyte nuclear maturation, local cortisol production, and HSD11B1 gene expression in LPS-challenged bovine COCs during IVM

LPS did not affect HSD11B1 expression (Fig. 2B) or local cortisol production (Fig. 2C). Approximately 10% of the added cortisone (3.6 ng/100 µl) was converted to cortisol by COCs (40 pg/COC) during IVM (Fig. 2C). Cortisol was undetectable in the medium without cortisone.

LPS reduced the MII rate (75.2%, P < 0.05) compared to the control (93.6%). Locally produced cortisol (from cortisone) negated the LPS effect (88.3%, P < 0.05) (Fig. 2D). MI rates remained high (99.2–100%) in all groups.

Effect of P4 deprivation and locally produced cortisol on oocyte nuclear maturation, and expression of genes involved in P4 and cortisol synthesis in bovine COCs during IVM

Trilostane suppressed P4 production below the detection limit. Treatment with trilostane, LPS, or both equally suppressed the MII rate (68.6%, 67.0%, and 69.5%, respectively) compared to the control (83.5%, P < 0.05) (Fig. 3A). Adding cortisone reversed the effect of LPS (82.7%, P < 0.05), but this reversal was negated when trilostane was also present (59.8%, P < 0.05). MI rates ranged from 95.2–100% for all treatments.

Trilostane did not affect StAR (Fig. 3B) or HSD3B1 (Fig. 3D) expression but upregulated CYP11A1 (Fig. 3C). Furthermore, trilostane downregulated HSD11B1 (Fig. 3E).

Effect of P4 deprivation and nomegestrol acetate (NA) replacement on oocyte nuclear maturation, and HSD11B1 gene expression in LPS-challenged bovine COCs during IVM

A dose-dependent effect of progestogen on LPS-challenged oocyte nuclear maturation was examined. Combined treatment with LPS and trilostane suppressed the MII rate (71.6%) compared to the control (87%, P < 0.05). Although adding NA (0.001–1 μM) partially increased the MII rate (81.5%, 81.3%, 82.2%, and 80.2% for 0.001, 0.01, 0.1, and 1 µM, respectively), the improvement was not statistically significant compared to LPS + trilostane (Fig. 4A). MI rates remained at 97.8–100% across treatments.

NA negated the combined effect of LPS and trilostane on HSD11B1 expression, regardless of the dose (Fig. 4B).

Discussion

In this study, LPS disrupted bovine oocyte maturation in a dose-dependent manner (Fig. 1A), consistent with previous reports [6, 7]. The LPS concentrations used (0.001–1 µg/ml) reflect those found in the follicular fluid of cows with subclinical and clinical endometritis [3]. Cortisol at an upper physiological concentration of 0.1 μM reversed the detrimental effect on oocyte maturation (Fig. 2A) induced by 1 µg/ml LPS, indicating that cortisol can suppress local inflammatory reactions caused by this endotoxin.

During the maturation period, COCs converted added cortisone to cortisol via HSD11B1, the enzyme responsible for glucocorticoid activation in various organs, including the ovary [20, 21]. Approximately 10% of the added cortisone was converted to cortisol, increasing the cortisol concentration in the culture medium to 0.01 µM. At this concentration, cortisol was still able to counteract the deleterious effect of LPS on oocyte maturation (Fig. 2D). Before the LH surge, the follicular fluid of bovine preovulatory follicles contains 5–25 ng/ml (approximately 0.014–0.07 µM) cortisol [41,42,43], primarily derived from the adrenal cortex. After the preovulatory gonadotropin surge, follicles destined for ovulation begin producing cortisol, leading to a temporary increase in local cortisol levels [44]. These findings suggest that preovulatory and periovulatory follicles are protected from LPS by both locally produced and endocrine-derived cortisol. However, follicular development and ovulation are influenced not only by local conditions but also by extra-ovarian factors, such as the availability of gonadotropins and nutrients. Given that LPS has widespread effects on various physiological functions, a cautious approach is required to fully elucidate its impact on follicular development in vivo.

The present study demonstrated that LPS suppressed the MII rate without affecting MI rates (Figs. 1A, 2A, 2D, 3A, and 4A), suggesting that LPS may act during the transition from MI to MII. Cortisol production [21] and the MI-to-MII transition [45] predominantly occur toward the end of IVM. Therefore, the timing of cortisol action on COCs may coincide with the MI-to-MII transition, where LPS is likely to exert its effect. The molecular mechanisms by which cortisol suppresses the effects of LPS on oocyte maturation were not elucidated in this study. However, cortisol likely inhibits the activation of the NF-κB and MAPK pathways [15, 18, 26,27,28,29, 33, 34] following LPS binding to TLR4 [6, 11,12,13,14]. Bovine cumulus cells express both GR [19, 46] and TLR4 [7]. Since periovulatory cortisol production mediated by HSD11B1 occurs exclusively in cumulus cells [20], cortisol may exert its inhibitory effect on LPS through an autocrine mechanism.

Bovine oocytes also express TLR4, and their mitochondrial function and distribution are affected by LPS [7]. However, whether glucocorticoids directly suppress the effects of LPS in oocytes remains unclear. We have previously demonstrated that GR is exclusively expressed in cumulus cells and not in oocytes [19]. Furthermore, we have shown that bovine oocytes express HSD11B2, a dehydrogenase that inactivates glucocorticoids by efficiently converting cortisol to cortisone [20]. Further studies are needed to clarify the specific mechanisms by which cortisol acts within bovine COCs.

In the present study, trilostane effectively eliminated cumulus P4 production and suppressed oocyte maturation, confirming that P4 is essential for oocyte maturation, as reported in various species, including cattle [47,48,49,50,51]. LPS suppressed oocyte maturation to a similar extent, regardless of the presence of P4 (i.e., LPS vs. LPS + trilostane) (Fig. 3A). Interestingly, when NA was administered in combination with LPS and trilostane, it exhibited a trend of partially reversing the LPS effect. However, this increase was not statistically significant (Fig. 4A). Collectively, these findings indicate that LPS-induced suppression is not mitigated by P4.

Conversely, the suppression of HSD11B1 expression induced by trilostane in LPS-challenged COCs was reversed by a broad range of NA concentrations (0.001–1 µM) (Fig. 4B), consistent with our previous findings [19]. This suggests that the activity of progestogen is not impaired by LPS and that even a minimal amount of P4 produced by COCs is sufficient to activate HSD11B1-mediated local cortisol production. Interestingly, P4 deprivation enhanced the expression of CYP11A1 (Fig. 3C), a rate-limiting enzyme crucial for P4 production, suggesting the presence of an auto-regulatory feedback system governing local P4 synthesis.

Nevertheless, P4 deprivation abolished the protective effect of cortisol against LPS-induced inhibition of oocyte maturation (Fig. 3A), suggesting that P4 is necessary for cortisol to exert its protective function. The precise mechanism by which P4 and cortisol interact to counteract LPS during the periovulatory period remains unclear. P4 is known to play a critical role during and after the periovulatory period [52,53,54,55,56,57]. It is possible that P4 establishes the necessary physiological conditions for oocyte maturation and ovulation, thereby enabling cortisol to perform its anti-inflammatory function.

LPS did not suppress P4 or cortisol production in the cumulus oophorus, regardless of the concentration used (Figs. 1B and 2C), suggesting that these steroids provide an effective defense against LPS-induced local inflammation. Since their production peaks just before ovulation, they may also help prevent potentially deleterious inflammatory events associated with ovulation.

In conclusion, this study demonstrates that locally produced cortisol protects bovine COCs from the detrimental effects of LPS on oocyte maturation. Although P4 alone does not counteract LPS, it is a crucial prerequisite for cortisol synthesis, enabling the cortisol-mediated defense mechanism against LPS-induced disruption of oocyte maturation (Fig. 5).

Fig. 5. — Proposed mechanism of cortisol-mediated defense against the suppressive effect of LPS on oocyte maturation in bovine cumulus-oocyte complexes (COCs) subjected to IVM: (1) Binding of LPS to TLR4 triggers inflammation by activating the NF-κB and MAPK pathways. (2) Both circulating and locally produced cortisol suppresses inflammation caused by LPS. (3) Progesterone may indirectly strengthen cortisol-mediated defense against LPS-induced disruption of oocyte maturation by enhancing the expression of *HSD11B1* and local cortisol production in cumulus cells.

Conflict of interests

The authors have no conflicts of interest to declare.

Acknowledgments

We are grateful to Mr. Kenichi Takahashi of the Genetics Hokkaido Association and the staff of the Hokkaido Livestock Cooperation Doto Plant Tokachi Factory for supplying bovine ovaries. We also thank Dr. H. Watanabe of the Obihiro University of Agriculture and Veterinary Medicine for technical assistance. This study was supported by a Grant-in-Aid for Scientific Research (19K06365) from the Japan Society for the Promotion of Science awarded to MT.

References

1.Sheldon IM, Cronin J, Goetze L, Donofrio G, Schuberth HJ. Defining postpartum uterine disease and the mechanisms of infection and immunity in the female reproductive tract in cattle. Biol Reprod 2009; 81: 1025–1032. [DOI] [PMC free article] [PubMed] [Google Scholar]
2.Dohmen MJ, Joop K, Sturk A, Bols PE, Lohuis JA. Relationship between intra-uterine bacterial contamination, endotoxin levels and the development of endometritis in postpartum cows with dystocia or retained placenta. Theriogenology 2000; 54: 1019–1032. [DOI] [PubMed] [Google Scholar]
3.Herath S, Williams EJ, Lilly ST, Gilbert RO, Dobson H, Bryant CE, Sheldon IM. Ovarian follicular cells have innate immune capabilities that modulate their endocrine function. Reproduction 2007; 134: 683–693. [DOI] [PMC free article] [PubMed] [Google Scholar]
4.Ibeagha-Awemu EM, Lee JW, Ibeagha AE, Bannerman DD, Paape MJ, Zhao X. Bacterial lipopolysaccharide induces increased expression of toll-like receptor (TLR) 4 and downstream TLR signaling molecules in bovine mammary epithelial cells. Vet Res 2008; 39: 11. [DOI] [PubMed] [Google Scholar]
5.Williams EJ, Sibley K, Miller AN, Lane EA, Fishwick J, Nash DM, Herath S, England GC, Dobson H, Sheldon IM. The effect of Escherichia coli lipopolysaccharide and tumour necrosis factor alpha on ovarian function. Am J Reprod Immunol 2008; 60: 462–473. [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Bromfield JJ, Sheldon IM. Lipopolysaccharide initiates inflammation in bovine granulosa cells via the TLR4 pathway and perturbs oocyte meiotic progression in vitro. Endocrinology 2011; 152: 5029–5040. [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Magata F, Shimizu T. Effect of lipopolysaccharide on developmental competence of oocytes. Reprod Toxicol 2017; 71: 1–7. [DOI] [PubMed] [Google Scholar]
8.Castro B, Candelaria JI, Austin MM, Shuster CB, Gifford CA, Denicol AC, Hernandez Gifford JA. Low-dose lipopolysaccharide exposure during oocyte maturation disrupts early bovine embryonic development. Theriogenology 2024; 214: 57–65. [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Magata F, Kuroki C, Sakono T, Matsuda F. Lipopolysaccharide impairs the in vitro growth, steroidogenesis, and maturation of oocyte-cumulus-granulosa cell complexes derived from bovine early antral follicles. Theriogenology 2024; 215: 187–194. [DOI] [PubMed] [Google Scholar]
10.Ohnishi T, Muroi M, Tanamoto K. The lipopolysaccharide-recognition mechanism in cells expressing TLR4 and CD14 but lacking MD-2. FEMS Immunol Med Microbiol 2007; 51: 84–91. [DOI] [PubMed] [Google Scholar]
11.Takeuchi O, Akira S. Pattern recognition receptors and inflammation. Cell 2010; 140: 805–820. [DOI] [PubMed] [Google Scholar]
12.Cronin JG, Turner ML, Goetze L, Bryant CE, Sheldon IM. Toll-like receptor 4 and MYD88-dependent signaling mechanisms of the innate immune system are essential for the response to lipopolysaccharide by epithelial and stromal cells of the bovine endometrium. Biol Reprod 2012; 86: 51. [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Liu T, Zhang L, Joo D, Sun SC. NF-κB signaling in inflammation. Signal Transduct Target Ther 2017; 2: 17023. [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Zhao S, Pang Y, Zhao X, Du W, Hao H, Zhu H. Detrimental effects of lipopolysaccharides on maturation of bovine oocytes. Asian-Australas J Anim Sci 2019; 32: 1112–1121. [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Coutinho AE, Chapman KE. The anti-inflammatory and immunosuppressive effects of glucocorticoids, recent developments and mechanistic insights. Mol Cell Endocrinol 2011; 335: 2–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Hapgood JP, Avenant C, Moliki JM. Glucocorticoid-independent modulation of GR activity: Implications for immunotherapy. Pharmacol Ther 2016; 165: 93–113. [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Schreiber JR, Nakamura K, Erickson GF. Rat ovary glucocorticoid receptor: identification and characterization. Steroids 1982; 39: 569–584. [DOI] [PubMed] [Google Scholar]
18.Timmermans S, Souffriau J, Libert C. A General Introduction to Glucocorticoid Biology. Front Immunol 2019; 10: 1545. [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Anbo N, Suzuki A, Mukangwa M, Takahashi R, Muranishi Y, Tetsuka M. Progesterone stimulates cortisol production in the maturing bovine cumulus-oocyte complex. Theriogenology 2022; 189: 183–191. [DOI] [PubMed] [Google Scholar]
20.Tetsuka M, Takagi R, Ambo N, Myat TS, Zempo Y, Onuma A. Glucocorticoid metabolism in the bovine cumulus-oocyte complex matured in vitro. Reproduction 2016; 151: 73–82. [DOI] [PubMed] [Google Scholar]
21.Tetsuka M, Tanakadate M. Activation of HSD11B1 in the bovine cumulus-oocyte complex during IVM and IVF. Endocr Connect 2019; 8: 1029–1039. [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Krozowski Z, Li KX, Koyama K, Smith RE, Obeyesekere VR, Stein-Oakley A, Sasano H, Coulter C, Cole T, Sheppard KE. The type I and type II 11beta-hydroxysteroid dehydrogenase enzymes. J Steroid Biochem Mol Biol 1999; 69: 391–401. [DOI] [PubMed] [Google Scholar]
23.Michael AE, Thurston LM, Rae MT. Glucocorticoid metabolism and reproduction: a tale of two enzymes. Reproduction 2003; 126: 425–441. [DOI] [PubMed] [Google Scholar]
24.Seckl JR. 11beta-hydroxysteroid dehydrogenases: changing glucocorticoid action. Curr Opin Pharmacol 2004; 4: 597–602. [DOI] [PubMed] [Google Scholar]
25.Holmes MC, Seckl JR. The role of 11beta-hydroxysteroid dehydrogenases in the brain. Mol Cell Endocrinol 2006; 248: 9–14. [DOI] [PubMed] [Google Scholar]
26.Busillo JM, Cidlowski JA. The five Rs of glucocorticoid action during inflammation: ready, reinforce, repress, resolve, and restore. Trends Endocrinol Metab 2013; 24: 109–119. [DOI] [PMC free article] [PubMed] [Google Scholar]
27.Cruz-Topete D, Cidlowski JA. One hormone, two actions: anti- and pro-inflammatory effects of glucocorticoids. Neuroimmunomodulation 2015; 22: 20–32. [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Whirledge S, Cidlowski JA. A role for glucocorticoids in stress-impaired reproduction: beyond the hypothalamus and pituitary. Endocrinology 2013; 154: 4450–4468. [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Whirledge S, Cidlowski JA. Glucocorticoids and Reproduction: Traffic Control on the Road to Reproduction. Trends Endocrinol Metab 2017; 28: 399–415. [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Cui L, Wang H, Lin J, Wang Y, Dong J, Li J, Li J. Progesterone inhibits inflammatory response in E.coli- or LPS-Stimulated bovine endometrial epithelial cells by NF-κB and MAPK pathways. Dev Comp Immunol 2020; 105: 103568. [DOI] [PubMed] [Google Scholar]
31.Cui L, Wang Y, Wang H, Dong J, Li Z, Li J, Qian C, Li J. Different effects of cortisol on pro-inflammatory gene expressions in LPS-, heat-killed E.coli-, or live E.coli-stimulated bovine endometrial epithelial cells. BMC Vet Res 2020; 16: 9. [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Cui L, Shao X, Sun W, Zheng F, Dong J, Li J, Wang H, Li J. Anti-inflammatory effects of progesterone through NF-κB and MAPK pathway in lipopolysaccharide- or Escherichia coli-stimulated bovine endometrial stromal cells. PLoS One 2022; 17: e0266144. [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Dong J, Li J, Cui L, Wang Y, Lin J, Qu Y, Wang H. Cortisol modulates inflammatory responses in LPS-stimulated RAW264.7 cells via the NF-κB and MAPK pathways. BMC Vet Res 2018; 14: 30. [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Dong J, Qu Y, Li J, Cui L, Wang Y, Lin J, Wang H. Cortisol inhibits NF-κB and MAPK pathways in LPS activated bovine endometrial epithelial cells. Int Immunopharmacol 2018; 56: 71–77. [DOI] [PubMed] [Google Scholar]
35.Hewitt DA, Watson PF, England GC. Nuclear staining and culture requirements for in vitro maturation of domestic bitch oocytes. Theriogenology 1998; 49: 1083–1101. [DOI] [PubMed] [Google Scholar]
36.Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden TL. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics 2012; 13: 134. [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Payne AH, Hales DB. Overview of steroidogenic enzymes in the pathway from cholesterol to active steroid hormones. Endocr Rev 2004; 25: 947–970. [DOI] [PubMed] [Google Scholar]
38.Slominski RM, Tuckey RC, Manna PR, Jetten AM, Postlethwaite A, Raman C, Slominski AT. Extra-adrenal glucocorticoid biosynthesis: implications for autoimmune and inflammatory disorders. Genes Immun 2020; 21: 150–168. [DOI] [PMC free article] [PubMed] [Google Scholar]
39.R Core Team. (2023) R: A language and environment for statistical computing. R Foun dation for Statistical Computing, Vienna, Austria. [Google Scholar]
40.Kanda Y. Investigation of the freely available easy-to-use software ‘EZR’ for medical statistics. Bone Marrow Transplant 2013; 48: 452–458. [DOI] [PMC free article] [PubMed] [Google Scholar]
41.Mukangwa M, Takizawa K, Aoki Y, Hamano S, Tetsuka M. Expression of genes encoding mineralocorticoid biosynthetic enzymes and the mineralocorticoid receptor, and levels of mineralocorticoids in the bovine follicle and corpus luteum. J Reprod Dev 2020; 66: 75–81. [DOI] [PMC free article] [PubMed] [Google Scholar]
42.Tetsuka M, Yamamoto S, Hayashida N, Hayashi KG, Hayashi M, Acosta TJ, Miyamoto A. Expression of 11β-hydroxysteroid dehydrogenases in bovine follicle and corpus luteum. J Endocrinol 2003; 177: 445–452. [DOI] [PubMed] [Google Scholar]
43.Tetsuka M, Nishimoto H, Miyamoto A, Okuda K, Hamano S. Gene expression of 11β-HSD and glucocorticoid receptor in the bovine (Bos taurus) follicle during follicular maturation and atresia: the role of follicular stimulating hormone. J Reprod Dev 2010; 56: 616–622. [DOI] [PubMed] [Google Scholar]
44.Acosta TJ, Tetsuka M, Matsui M, Shimizu T, Berisha B, Schams D, Miyamoto A. In vivo evidence that local cortisol production increases in the preovulatory follicle of the cow. J Reprod Dev 2005; 51: 483–489. [DOI] [PubMed] [Google Scholar]
45.Yang Q, Zhu L, Wang M, Huang B, Li Z, Hu J, Xi Q, Liu J, Jin L. Analysis of maturation dynamics and developmental competence of in vitro matured oocytes under time-lapse monitoring. Reprod Biol Endocrinol 2021; 19: 183. [DOI] [PMC free article] [PubMed] [Google Scholar]
46.da Costa NN, Brito KN, Santana P, Cordeiro MS, Silva TV, Santos AX, Ramos PC, Santos SS, King WA, Miranda MS, Ohashi OM. Effect of cortisol on bovine oocyte maturation and embryo development in vitro. Theriogenology 2016; 85: 323–329. [DOI] [PubMed] [Google Scholar]
47.Akison LK, Robker RL. The critical roles of progesterone receptor (PGR) in ovulation, oocyte developmental competence and oviductal transport in mammalian reproduction. Reprod Domest Anim 2012; 47(Suppl 4): 288–296. [DOI] [PubMed] [Google Scholar]
48.Aparicio IM, Garcia-Herreros M, O’Shea LC, Hensey C, Lonergan P, Fair T. Expression, regulation, and function of progesterone receptors in bovine cumulus oocyte complexes during in vitro maturation. Biol Reprod 2011; 84: 910–921. [DOI] [PubMed] [Google Scholar]
49.Reynaud K, Saint-Dizier M, Tahir MZ, Havard T, Harichaux G, Labas V, Thoumire S, Fontbonne A, Grimard B, Chastant-Maillard S. Progesterone plays a critical role in canine oocyte maturation and fertilization. Biol Reprod 2015; 93: 87. [DOI] [PubMed] [Google Scholar]
50.Shimada M, Yamashita Y, Ito J, Okazaki T, Kawahata K, Nishibori M. Expression of two progesterone receptor isoforms in cumulus cells and their roles during meiotic resumption of porcine oocytes. J Mol Endocrinol 2004; 33: 209–225. [DOI] [PubMed] [Google Scholar]
51.Yamashita Y, Shimada M, Okazaki T, Maeda T, Terada T. Production of progesterone from de novo-synthesized cholesterol in cumulus cells and its physiological role during meiotic resumption of porcine oocytes. Biol Reprod 2003; 68: 1193–1198. [DOI] [PubMed] [Google Scholar]
52.Fortune JE, Willis EL, Bridges PJ, Yang CS. The periovulatory period in cattle: progesterone, prostaglandins, oxytocin and ADAMTS proteases. Anim Reprod 2009; 6: 60–71. [PMC free article] [PubMed] [Google Scholar]
53.Lonergan P. Influence of progesterone on oocyte quality and embryo development in cows. Theriogenology 2011; 76: 1594–1601. [DOI] [PubMed] [Google Scholar]
54.Fair T, Lonergan P. The role of progesterone in oocyte acquisition of developmental competence. Reprod Domest Anim 2012; 47(Suppl 4): 142–147. [DOI] [PubMed] [Google Scholar]
55.Lonergan P, Forde N. The role of progesterone in maternal recognition of pregnancy in domestic ruminants. Adv Anat Embryol Cell Biol 2015; 216: 87–104. [DOI] [PubMed] [Google Scholar]
56.Lonergan P, Forde N, Spencer T. Role of progesterone in embryo development in cattle. Reprod Fertil Dev 2016; 28: 66–74. [DOI] [PubMed] [Google Scholar]
57.McGlade EA, Miyamoto A, Winuthayanon W. Progesterone and inflammatory response in the oviduct during physiological and pathological conditions. Cells 2022; 11: 1075. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r1] 1.Sheldon IM, Cronin J, Goetze L, Donofrio G, Schuberth HJ. Defining postpartum uterine disease and the mechanisms of infection and immunity in the female reproductive tract in cattle. Biol Reprod 2009; 81: 1025–1032. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r2] 2.Dohmen MJ, Joop K, Sturk A, Bols PE, Lohuis JA. Relationship between intra-uterine bacterial contamination, endotoxin levels and the development of endometritis in postpartum cows with dystocia or retained placenta. Theriogenology 2000; 54: 1019–1032. [DOI] [PubMed] [Google Scholar]

[r3] 3.Herath S, Williams EJ, Lilly ST, Gilbert RO, Dobson H, Bryant CE, Sheldon IM. Ovarian follicular cells have innate immune capabilities that modulate their endocrine function. Reproduction 2007; 134: 683–693. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r4] 4.Ibeagha-Awemu EM, Lee JW, Ibeagha AE, Bannerman DD, Paape MJ, Zhao X. Bacterial lipopolysaccharide induces increased expression of toll-like receptor (TLR) 4 and downstream TLR signaling molecules in bovine mammary epithelial cells. Vet Res 2008; 39: 11. [DOI] [PubMed] [Google Scholar]

[r5] 5.Williams EJ, Sibley K, Miller AN, Lane EA, Fishwick J, Nash DM, Herath S, England GC, Dobson H, Sheldon IM. The effect of Escherichia coli lipopolysaccharide and tumour necrosis factor alpha on ovarian function. Am J Reprod Immunol 2008; 60: 462–473. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r6] 6.Bromfield JJ, Sheldon IM. Lipopolysaccharide initiates inflammation in bovine granulosa cells via the TLR4 pathway and perturbs oocyte meiotic progression in vitro. Endocrinology 2011; 152: 5029–5040. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r7] 7.Magata F, Shimizu T. Effect of lipopolysaccharide on developmental competence of oocytes. Reprod Toxicol 2017; 71: 1–7. [DOI] [PubMed] [Google Scholar]

[r8] 8.Castro B, Candelaria JI, Austin MM, Shuster CB, Gifford CA, Denicol AC, Hernandez Gifford JA. Low-dose lipopolysaccharide exposure during oocyte maturation disrupts early bovine embryonic development. Theriogenology 2024; 214: 57–65. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r9] 9.Magata F, Kuroki C, Sakono T, Matsuda F. Lipopolysaccharide impairs the in vitro growth, steroidogenesis, and maturation of oocyte-cumulus-granulosa cell complexes derived from bovine early antral follicles. Theriogenology 2024; 215: 187–194. [DOI] [PubMed] [Google Scholar]

[r10] 10.Ohnishi T, Muroi M, Tanamoto K. The lipopolysaccharide-recognition mechanism in cells expressing TLR4 and CD14 but lacking MD-2. FEMS Immunol Med Microbiol 2007; 51: 84–91. [DOI] [PubMed] [Google Scholar]

[r11] 11.Takeuchi O, Akira S. Pattern recognition receptors and inflammation. Cell 2010; 140: 805–820. [DOI] [PubMed] [Google Scholar]

[r12] 12.Cronin JG, Turner ML, Goetze L, Bryant CE, Sheldon IM. Toll-like receptor 4 and MYD88-dependent signaling mechanisms of the innate immune system are essential for the response to lipopolysaccharide by epithelial and stromal cells of the bovine endometrium. Biol Reprod 2012; 86: 51. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r13] 13.Liu T, Zhang L, Joo D, Sun SC. NF-κB signaling in inflammation. Signal Transduct Target Ther 2017; 2: 17023. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r14] 14.Zhao S, Pang Y, Zhao X, Du W, Hao H, Zhu H. Detrimental effects of lipopolysaccharides on maturation of bovine oocytes. Asian-Australas J Anim Sci 2019; 32: 1112–1121. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r15] 15.Coutinho AE, Chapman KE. The anti-inflammatory and immunosuppressive effects of glucocorticoids, recent developments and mechanistic insights. Mol Cell Endocrinol 2011; 335: 2–13. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r16] 16.Hapgood JP, Avenant C, Moliki JM. Glucocorticoid-independent modulation of GR activity: Implications for immunotherapy. Pharmacol Ther 2016; 165: 93–113. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r17] 17.Schreiber JR, Nakamura K, Erickson GF. Rat ovary glucocorticoid receptor: identification and characterization. Steroids 1982; 39: 569–584. [DOI] [PubMed] [Google Scholar]

[r18] 18.Timmermans S, Souffriau J, Libert C. A General Introduction to Glucocorticoid Biology. Front Immunol 2019; 10: 1545. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r19] 19.Anbo N, Suzuki A, Mukangwa M, Takahashi R, Muranishi Y, Tetsuka M. Progesterone stimulates cortisol production in the maturing bovine cumulus-oocyte complex. Theriogenology 2022; 189: 183–191. [DOI] [PubMed] [Google Scholar]

[r20] 20.Tetsuka M, Takagi R, Ambo N, Myat TS, Zempo Y, Onuma A. Glucocorticoid metabolism in the bovine cumulus-oocyte complex matured in vitro. Reproduction 2016; 151: 73–82. [DOI] [PubMed] [Google Scholar]

[r21] 21.Tetsuka M, Tanakadate M. Activation of HSD11B1 in the bovine cumulus-oocyte complex during IVM and IVF. Endocr Connect 2019; 8: 1029–1039. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r22] 22.Krozowski Z, Li KX, Koyama K, Smith RE, Obeyesekere VR, Stein-Oakley A, Sasano H, Coulter C, Cole T, Sheppard KE. The type I and type II 11beta-hydroxysteroid dehydrogenase enzymes. J Steroid Biochem Mol Biol 1999; 69: 391–401. [DOI] [PubMed] [Google Scholar]

[r23] 23.Michael AE, Thurston LM, Rae MT. Glucocorticoid metabolism and reproduction: a tale of two enzymes. Reproduction 2003; 126: 425–441. [DOI] [PubMed] [Google Scholar]

[r24] 24.Seckl JR. 11beta-hydroxysteroid dehydrogenases: changing glucocorticoid action. Curr Opin Pharmacol 2004; 4: 597–602. [DOI] [PubMed] [Google Scholar]

[r25] 25.Holmes MC, Seckl JR. The role of 11beta-hydroxysteroid dehydrogenases in the brain. Mol Cell Endocrinol 2006; 248: 9–14. [DOI] [PubMed] [Google Scholar]

[r26] 26.Busillo JM, Cidlowski JA. The five Rs of glucocorticoid action during inflammation: ready, reinforce, repress, resolve, and restore. Trends Endocrinol Metab 2013; 24: 109–119. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r27] 27.Cruz-Topete D, Cidlowski JA. One hormone, two actions: anti- and pro-inflammatory effects of glucocorticoids. Neuroimmunomodulation 2015; 22: 20–32. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r28] 28.Whirledge S, Cidlowski JA. A role for glucocorticoids in stress-impaired reproduction: beyond the hypothalamus and pituitary. Endocrinology 2013; 154: 4450–4468. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r29] 29.Whirledge S, Cidlowski JA. Glucocorticoids and Reproduction: Traffic Control on the Road to Reproduction. Trends Endocrinol Metab 2017; 28: 399–415. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r30] 30.Cui L, Wang H, Lin J, Wang Y, Dong J, Li J, Li J. Progesterone inhibits inflammatory response in E.coli- or LPS-Stimulated bovine endometrial epithelial cells by NF-κB and MAPK pathways. Dev Comp Immunol 2020; 105: 103568. [DOI] [PubMed] [Google Scholar]

[r31] 31.Cui L, Wang Y, Wang H, Dong J, Li Z, Li J, Qian C, Li J. Different effects of cortisol on pro-inflammatory gene expressions in LPS-, heat-killed E.coli-, or live E.coli-stimulated bovine endometrial epithelial cells. BMC Vet Res 2020; 16: 9. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r32] 32.Cui L, Shao X, Sun W, Zheng F, Dong J, Li J, Wang H, Li J. Anti-inflammatory effects of progesterone through NF-κB and MAPK pathway in lipopolysaccharide- or Escherichia coli-stimulated bovine endometrial stromal cells. PLoS One 2022; 17: e0266144. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r33] 33.Dong J, Li J, Cui L, Wang Y, Lin J, Qu Y, Wang H. Cortisol modulates inflammatory responses in LPS-stimulated RAW264.7 cells via the NF-κB and MAPK pathways. BMC Vet Res 2018; 14: 30. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r34] 34.Dong J, Qu Y, Li J, Cui L, Wang Y, Lin J, Wang H. Cortisol inhibits NF-κB and MAPK pathways in LPS activated bovine endometrial epithelial cells. Int Immunopharmacol 2018; 56: 71–77. [DOI] [PubMed] [Google Scholar]

[r35] 35.Hewitt DA, Watson PF, England GC. Nuclear staining and culture requirements for in vitro maturation of domestic bitch oocytes. Theriogenology 1998; 49: 1083–1101. [DOI] [PubMed] [Google Scholar]

[r36] 36.Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden TL. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics 2012; 13: 134. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r37] 37.Payne AH, Hales DB. Overview of steroidogenic enzymes in the pathway from cholesterol to active steroid hormones. Endocr Rev 2004; 25: 947–970. [DOI] [PubMed] [Google Scholar]

[r38] 38.Slominski RM, Tuckey RC, Manna PR, Jetten AM, Postlethwaite A, Raman C, Slominski AT. Extra-adrenal glucocorticoid biosynthesis: implications for autoimmune and inflammatory disorders. Genes Immun 2020; 21: 150–168. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r39] 39.R Core Team. (2023) R: A language and environment for statistical computing. R Foun dation for Statistical Computing, Vienna, Austria. [Google Scholar]

[r40] 40.Kanda Y. Investigation of the freely available easy-to-use software ‘EZR’ for medical statistics. Bone Marrow Transplant 2013; 48: 452–458. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r41] 41.Mukangwa M, Takizawa K, Aoki Y, Hamano S, Tetsuka M. Expression of genes encoding mineralocorticoid biosynthetic enzymes and the mineralocorticoid receptor, and levels of mineralocorticoids in the bovine follicle and corpus luteum. J Reprod Dev 2020; 66: 75–81. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r42] 42.Tetsuka M, Yamamoto S, Hayashida N, Hayashi KG, Hayashi M, Acosta TJ, Miyamoto A. Expression of 11β-hydroxysteroid dehydrogenases in bovine follicle and corpus luteum. J Endocrinol 2003; 177: 445–452. [DOI] [PubMed] [Google Scholar]

[r43] 43.Tetsuka M, Nishimoto H, Miyamoto A, Okuda K, Hamano S. Gene expression of 11β-HSD and glucocorticoid receptor in the bovine (Bos taurus) follicle during follicular maturation and atresia: the role of follicular stimulating hormone. J Reprod Dev 2010; 56: 616–622. [DOI] [PubMed] [Google Scholar]

[r44] 44.Acosta TJ, Tetsuka M, Matsui M, Shimizu T, Berisha B, Schams D, Miyamoto A. In vivo evidence that local cortisol production increases in the preovulatory follicle of the cow. J Reprod Dev 2005; 51: 483–489. [DOI] [PubMed] [Google Scholar]

[r45] 45.Yang Q, Zhu L, Wang M, Huang B, Li Z, Hu J, Xi Q, Liu J, Jin L. Analysis of maturation dynamics and developmental competence of in vitro matured oocytes under time-lapse monitoring. Reprod Biol Endocrinol 2021; 19: 183. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r46] 46.da Costa NN, Brito KN, Santana P, Cordeiro MS, Silva TV, Santos AX, Ramos PC, Santos SS, King WA, Miranda MS, Ohashi OM. Effect of cortisol on bovine oocyte maturation and embryo development in vitro. Theriogenology 2016; 85: 323–329. [DOI] [PubMed] [Google Scholar]

[r47] 47.Akison LK, Robker RL. The critical roles of progesterone receptor (PGR) in ovulation, oocyte developmental competence and oviductal transport in mammalian reproduction. Reprod Domest Anim 2012; 47(Suppl 4): 288–296. [DOI] [PubMed] [Google Scholar]

[r48] 48.Aparicio IM, Garcia-Herreros M, O’Shea LC, Hensey C, Lonergan P, Fair T. Expression, regulation, and function of progesterone receptors in bovine cumulus oocyte complexes during in vitro maturation. Biol Reprod 2011; 84: 910–921. [DOI] [PubMed] [Google Scholar]

[r49] 49.Reynaud K, Saint-Dizier M, Tahir MZ, Havard T, Harichaux G, Labas V, Thoumire S, Fontbonne A, Grimard B, Chastant-Maillard S. Progesterone plays a critical role in canine oocyte maturation and fertilization. Biol Reprod 2015; 93: 87. [DOI] [PubMed] [Google Scholar]

[r50] 50.Shimada M, Yamashita Y, Ito J, Okazaki T, Kawahata K, Nishibori M. Expression of two progesterone receptor isoforms in cumulus cells and their roles during meiotic resumption of porcine oocytes. J Mol Endocrinol 2004; 33: 209–225. [DOI] [PubMed] [Google Scholar]

[r51] 51.Yamashita Y, Shimada M, Okazaki T, Maeda T, Terada T. Production of progesterone from de novo-synthesized cholesterol in cumulus cells and its physiological role during meiotic resumption of porcine oocytes. Biol Reprod 2003; 68: 1193–1198. [DOI] [PubMed] [Google Scholar]

[r52] 52.Fortune JE, Willis EL, Bridges PJ, Yang CS. The periovulatory period in cattle: progesterone, prostaglandins, oxytocin and ADAMTS proteases. Anim Reprod 2009; 6: 60–71. [PMC free article] [PubMed] [Google Scholar]

[r53] 53.Lonergan P. Influence of progesterone on oocyte quality and embryo development in cows. Theriogenology 2011; 76: 1594–1601. [DOI] [PubMed] [Google Scholar]

[r54] 54.Fair T, Lonergan P. The role of progesterone in oocyte acquisition of developmental competence. Reprod Domest Anim 2012; 47(Suppl 4): 142–147. [DOI] [PubMed] [Google Scholar]

[r55] 55.Lonergan P, Forde N. The role of progesterone in maternal recognition of pregnancy in domestic ruminants. Adv Anat Embryol Cell Biol 2015; 216: 87–104. [DOI] [PubMed] [Google Scholar]

[r56] 56.Lonergan P, Forde N, Spencer T. Role of progesterone in embryo development in cattle. Reprod Fertil Dev 2016; 28: 66–74. [DOI] [PubMed] [Google Scholar]

[r57] 57.McGlade EA, Miyamoto A, Winuthayanon W. Progesterone and inflammatory response in the oviduct during physiological and pathological conditions. Cells 2022; 11: 1075. [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Cortisol prevents the suppressive effect of LPS on bovine oocyte maturation in vitro

Sameera PREMARATNE

Mahiro TAMURA

Omowumi ADEMOLA

Yuki MURANISHI

Masafumi TETSUKA

Abstract