CpG site methylation regulates mouse Rec8 gene promoter activity

Abstract

The Rec8 gene is specifically expressed in fetal and adult gonads. Although the importance of REC8 in gametogenesis is widely acknowledged, the mechanisms underlying its germ cell-specific expression remain unclear. In this study, we utilized the mouse Rec8 gene sequence to construct a 2577 bp sequence, which included intron 1 (180 bp), exon 1 (118 bp), and an upstream 2279 bp region. The dual-luciferase assay results showed significant differences in promoter activity between –650 bp and –385 bp and between –89 bp and –35 bp. This indicated that the core promoter region of the Rec8 gene may exist within these regions. Bisulfite sequencing PCR results showed that CpGs 10–19 were largely unmethylated in the testes but hypermethylated in other tissues. Interestingly, correlation analysis between CpG methylation status and Rec8 mRNA expression levels showed that methylation of CpGs 10 to 19 was negatively correlated with Rec8 mRNA expression levels (Pearson’s r = −0.991, P = 0.009). Furthermore, RNA-Seq data and bioinformatic analyses suggested that the specific expression of Rec8 may be linked to the presence of TATA-like sequences within its core promoter region. Overall, these findings indicate that Rec8 expression is regulated by the low methylation of CpG sites and the presence of TATA-like sequences in its core promoter.

Meiosis, which reduces chromosome numbers from diploid to haploid, is a crucial step in eukaryotic sexual reproduction. This reduction is achieved through two successive nuclear divisions following a single round of DNA replication. During meiosis I, homologous chromosomes pair, recombine, and separate, consequently halving the chromosome number. Meiosis II segregates sister chromatids. Meiotic recombination ensures accurate segregation of homologous chromosomes during meiosis I, while maintenance of centromeric cohesion beyond anaphase I and removal of cohesion during meiosis II are crucial for the precise segregation of sister chromatids. Among several key meiotic proteins, the ring-like cohesin complex comprising four subunits, is highly conserved in eukaryotes. It plays a central role in sister chromatid cohesion and sister centromeric orientation during mitosis and meiosis [1].

In vertebrates, the mitotic cohesin complex comprises four core components: two structural maintenance of chromosome subunits (SMC1 and SMC3), an α-kleisin subunit (RAD21), and either SA1/STAG1 or SA2/STAG2 [2]. Several meiosis-specific components have been identified in mammals, including SMC1β [3], α-kleisins REC8 [4, 5] and RAD21L [6, 7], and the SA protein SA3/STAG3 [8]. In the meiotic prophase, REC8 localizes along the chromosome arms before meiotic DNA replication and persists throughout meiosis I, remaining at the centromeres until metaphase II [5]. REC8 is removed from meiotic chromosomes in a stepwise manner. First, separase-mediated cleavage of REC8 along the chromosomal arms triggers the separation of homologous chromosomes, whereas in the pericentromeric region, REC8 is protected by Sgo1-PP2A throughout meiosis I until metaphase II [9, 10]. After meiosis I, Sgo1 degradation renders centromeric cohesin susceptible to cleavage, facilitating the segregation of sister chromatids during meiosis II, ultimately resulting in haploid gamete production [11]. Various studies have shown that REC8 cleavage during yeast and mammalian meiosis is achieved through similar molecular mechanisms [12, 13]. However, some studies have suggested that DNA double-strand breaks (DSBs) can regulate the cleavage-independent release of Rec8-cohesin [14].

In human oocytes, an age-related increase in aneuploidy is negatively correlated with the expression levels of meiosis-specific cohesins [15], suggesting that maintaining a threshold level of cohesin expression for meiotic sister chromatid cohesion is crucial for normal oocyte development [16, 17]. REC8 functions in chromosome segregation as well as synapsis, DNA repair through homologous chromosome recombination, and formation of the synaptonemal complex [18,19,20,21]. For example, in Rec8^-/- spermatocytes, DSBs cannot be repaired, and synapses occur between sister chromatids instead of homologous chromosomes [19,20,21]. Therefore, elucidating the transcriptional regulatory mechanism of Rec8 is important for controlling the occurrence of normal gametes. However, the transcriptional regulatory mechanisms of Rec8 in mammals remain unexplored.

This study aimed to identify the core promoter region of Rec8 and to investigate the relationship between Rec8 expression and DNA methylation within the promoter region. To this end, the main active regions of Rec8 gene were determined using dual-luciferase assays. The DNA methylation status of 38 CpG sites in the promoter region of Rec8 gene in different mouse tissues (testis, liver, ovary, and uterus) was determined by bisulfite sequencing PCR (BSP), and the relationship between Rec8 mRNA expression and DNA methylation was statistically analyzed. RNA-Seq analysis was conducted to identify the promoter-binding factors associated with Rec8 transcriptional activity. The findings were as follows: (1) the Rec8 gene was found to contain two core promoter regions with TATA-like sequences; (2) significant differences in CpG10–19 methylation were observed between the testes and other tissues, and CpG methylation was negatively correlated with Rec8 expression. Based on these results, the specific expression of the Rec8 gene may depend on the TATA-like sequence and methylation status of CpG10–19 in the core promoter regions. These findings provide a new theoretical basis for the development of infertility treatments.

Materials and Methods

Animals

All tissues used in the experiments were harvested from ICR mice purchased from Beijing Weitong Lihua Experimental Animal Technology Co., Ltd. (Beijing, China). All animal experiments were approved by and conducted in accordance with the guidelines of the Animal Research and Ethics Committee of Inner Mongolia Normal University.

Cloning of the mouse Rec8 gene promoter

We selected a 2577 bp sequence including exon I and its upstream sequence, from the mouse Rec8 gene sequence published in the Ensembl database (ENSMUSG0000002324) as transcriptional regulatory sequences. Twelve pairs of primers were designed to amplify various fragments of Rec8 genomic DNA (–2279 bp, –1881 bp, –1345 bp, –883 bp, –650 bp, –385 bp, –263 bp, –183 bp, –145 bp, –89 bp, –35 bp, and –3 bp) (Table 1). DNA was extracted from the testes of ICR mice using the TAKARA Mini BEST Universal Genomic DNA Extraction Kit (Takara, Shiga, Japan) and used as a template for amplification reactions using KOD-FX (TOYOBO, Osaka, Japan). PCR was performed in a 50 µl reaction mixture containing 1 unit of KOD-FX, 25 µl of 2 × PCR Buffer for KOD-FX, 1 mM dNTPs, 2.5 µM of each primer and 100 ng of template DNA. The PCR conditions were as follows: 30 cycles of 98°C for 10 sec and 68°C for 60 sec. PCR amplification products were detected using 1% agarose gel electrophoresis, and the DNA was purified using a San Prep Column DNA Gel Recovery Kit (Sangon Biotech, Shanghai, China). DNA concentration was measured, and the DNA was stored at –20°C.

Table 1. Primers used in dual-luciferase assays.

Primer name	Fragment size	Primer sequence
mpREC8-F (-3)	301 bp	5'- TTACGCGTAGCAGAGTCGAAGAAGGCCTCT -3'
mpREC8-F (-35)	333 bp	5'- TTACGCGTTGGTGGTGGTGGTGGTGGTGGT -3'
mpREC8-F (-89)	387 bp	5'- TTACGCGTGACCTAGAGCAAGGTCCAGAAG -3'
mpREC8-F (-145)	443 bp	5'- TTACGCGTTGTCGGTGGTACAAAGCCTTGG -3'
mpREC8-F (-183)	481 bp	5'- TTACGCGTGAGTCTTTGAGTTTCTTCTGGC -3'
mpREC8-F (-263)	560 bp	5'- TTACGCGTCTCAGAATTCTCGTGATTGGCT -3'
mpREC8-F (-385)	682 bp	5'- TTACGCGTCCAGGGAGAGAGACTGGATTTT -3'
mpREC8-F (-650)	947 bp	5'- GGACGCGTCAGCTGAGATTATAGGAGTTTG -3'
mpREC8-F (-883)	1180 bp	5'- GGACGCGTGGCATTACATGAAAGGGTAAAG -3'
mpREC8-F (-1345)	1642 bp	5'- TTACGCGTGGCCTTGTGTGTGTATGTGTGT -3'
mpREC8-F (-1881)	2178 bp	5'- TTACGCGTAACTCAAGAGGCAGAGGCAAGT -3'
mpREC8-F (-2279)	2577 bp	5'- TTACGCGTCAGCCTCTCAATCACTTTTGGC -3'
mpREC8-R (298)		5'- GGAAGCTTAGATTTCCAGCACCATTGAAGA -3'

The underline represents restriction enzyme cutting sites of MluI and HindIII.

Construction and identification of plasmid vectors

Initially, for constructing pMD20-T-promoter plasmid vectors, each PCR product (12 fragments of Rec8 genomic DNA) was cloned and inserted into the pMD20-T vector (Takara) by TA cloning. To construct the pGL3-Basic-Promoter plasmid vectors, each of the PCR-amplified promoter sequences was subcloned from the pMD20-T-promoter vectors into a precision destination vector, the pGL3-Basic vector (Promega, Madison, WI, USA), at the MluI and HindIII sites according to the manufacturer’s instructions. All constructs prepared for the present study were verified by DNA sequencing, particularly around the positions of cDNA insertions or deletions.

Transfection and dual-luciferase assay

HEK293T cells were grown in Dulbecco’s modified Eagle medium (Gibco, Suzhou, China) supplemented with 10% fetal bovine serum and cultured in 5% carbon dioxide at 37°C. Cells were seeded on 24-well plates at 2.5 × 10⁵ cells/ml. After 24 h of culture, the cells were transfected for 6 h with 245 ng of plasmid DNA using the Lipofectamine 2000 Reagent (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA) in Opti-MEM (Gibco) according to the manufacturer’s instructions. Transfected cells were then cultured in basic medium for 24 h, including the 6 h of transfection. Promoter activity was detected using a Dual-Luciferase Reporter System (Promega) according to the manufacturer’s instructions. Luciferase (LUC) and Renilla luciferase (REN) activities were measured using Dual-Luciferase Assay Kit (Yeasen Biotechnology, Shanghai, China). The LUC/REN ratio was used to determine the promoter transcriptional activity. All experiments were performed with at least three biological replicates.

DNA extraction and bisulfite sequencing PCR (BSP)

Genomic DNA was extracted from each mouse tissue sample using the TAKARA Mini BEST Universal Genomic DNA Extraction Kit (Takara) following the manufacturer’s instructions. Genomic DNA samples were quantified and stored at –20°C until use. DNA samples (3 µg) were treated with bisulfite using the Methyl Easy^TM Xceed Rapid DNA Bisulfite Modification Kit (Takara). Bisulfite-treated DNA was used as the template for PCR. PCR was performed in a 50 µl reaction mixture containing 1.25 units of EpiTaq HS polymerase (Takara), 5 µl of 10 × EpiTaq PCR Buffer, 2.5 mM MgCl₂, 2.5 mM dNTPs, 4 µM of each primer and 60 ng of template DNA. The PCR primers used to amplify the bisulfite–converted mouse Rec8 region are listed in Table 2. The PCR conditions were as follows: 40 cycles of 98°C for 10 sec, 60°C for 30 sec, and 72°C for 60 sec. PCR products were separated on 1% agarose gels and purified using a San Prep Column DNA Gel Recovery Kit (Sangon Biotech). Purified PCR products were cloned, inserted into the pMD20-T vector, and transformed into XL10 Gold competent cells. Using blue/white screening, plasmid DNAs extracted from white colonies were identified using Quick Cut restriction enzyme (HindIII/EcoRI) analysis, and sequencing was performed by Sangon Biotech Co., Ltd.

Table 2. Primers used in bisulfite sequencing PCR.

Primer name	Fragment size	Primer sequence
MeREC8-1F	502 bp	5'-GTTTTTTAATTATTTTTGGTTATAGTTATG-3'
MeREC8-1R		5'-TTTTAAAACAAAATTTCTCTATATAACCCT-3'
MeREC8-2F	388 bp	5'-GTAGATTATTATGGTTTTAGATTTATAGGA-3'
MeREC8-2R		5'-AAACATAATACTTTTATCTCAACAACAAA-3'
MeREC8-3F	370 bp	5'-TTTGTTGTTGAGATAAAAGTATTATGTTT-3'
MeREC8-3R		5'-ATACACACCTCTTAAAAAAACTAAAATAAC-3'
MeREC8-4F	339 bp	5'-GTATAGATTTTTATTGGGTATAAAAT-3'
MeREC8-4R		5'-AACCATAAACTCTTAAAAAATAATC-3'
MeREC8-5F	389 bp	5'-GGAATTGAGTTTTGTTGTTTGGT-3'
MeREC8-5R		5'-AAAAACTAAACATCCCTCCTTTAAC-3'

Three mice were used in the experiment and 10 repeated experiments were conducted using each tissue. The DNA methylation level for each CpG is shown as the average of 30 experimental results. Methylation of the cloned DNA was analyzed using web-based QUMA analysis (http://quma.cdb.riken.jp) [22]. Student t-test was used for the statistical analysis of CpG methylation in the testes and other tissues. Statistical significance was defined as P < 0.0001.

In vitro methylation treatment of Rec8 deficient constructs

In vitro methylation treatment of Rec8-deficient constructs was performed using a CpG Methyltransferase (M.SssI) (Thermo Scientific, Vilnius, Lithuania). First, the following reaction was assembled at room temperature: 2 µl 10 × M.SssI buffer, 0.4 µl 50 × SAM, 1 µg DNA, 1 µl M.SssI, and nuclease-free water to 20 µl. The mixture was then gently mixed and centrifuged for several seconds followed by incubation at 37°C for 15 min, and then heating at 65°C for 20 min to stop the reaction. Finally, DNA was purified using the TAKARA Mini BEST Universal Genomic DNA Extraction Kit (Takara) according to the manufacturer’s instructions. The methylated Rec8 deficient constructs were used for transfection and dual-luciferase assays. Transfection and dual-luciferase assays were performed as described previously.

Quantitative real-time RT-PCR (qRT-PCR)

Total RNA from the liver, uterus, ovaries, and testes of 8-week-old ICR mice was isolated using a TAKARA Mini BEST Universal RNA Extraction Kit (Takara). Single-stranded cDNA was generated for qRT-PCR using these RNA samples as templates. According to the iScript™ gDNA Clear cDNA Synthesis Kit instructions (Bio-Rad, Hercules, CA, USA), a 16 µl gDNA removal system was prepared on ice, using the maximum recommended RNA amount. The system was incubated at 25°C for 5 min and at 75°C for 5 min to remove gDNA. A 20 µl reverse transcription system was then prepared on ice, incubated at 25°C for 5 min, followed by 46°C for 20 min, and denatured at 95°C for 1 min. After cooling on ice, the resulting cDNA was immediately used for the qPCR analysis. Quantitative analysis of gene expression was performed using a qRT-PCR instrument in a 20 μl total reaction volume containing 100 ng of cDNA, 10 μl of 2 × qRT-PCR mix and 10 μM forward and reverse primers. The primer pairs used for qRT-PCR were 5′-TGCCAGTACCTTGTGGAAGA-3′ and 5′-TTGGGAAGAAGCAAGCTAGG-3′ for mouse Rec8 mRNA, and 5′-GGCTGTATTCCCCTCCATCG-3′ and 5′-CCAGTTGGTAACAATG CCATGT-3′ for β-actin. The PCR conditions comprised a polymerase activation step for 300 sec at 95°C, followed by 40 cycles of 95°C for 10 sec and 65°C for 30 sec. The specificity of qRT-PCR was verified using both dissociation curve analysis and agarose gel electrophoresis. β-actin was used as an internal control, and the 2^−∆∆Ct method was used to calculate the relative expression level of the Rec8 gene in various tissues. Differences in gene expression levels between different tissues were statistically analyzed using a t test.

Prediction of the core promoter region and transcription factor-binding sites

The core promoter region of mouse Rec8 was predicted and evaluated using online software such as TSSW (http://www.softberry.com/berry.phtml?topic=tssw&group =programs&subgroup=promoter) and Promoter 2.0 (http://www.cbs.dtu.dk/services/Promoter/). Transcription factor-binding sites were predicted using the online software AliBaba 2.1 (http://gene-regulation.com/pub/programs/alibaba2/index.html). CpG islands (CGIs) in the mouse Rec8 gene were predicted using the online software Meth Primer (http://www.urogene.org/).

RNA-Seq and data analysis

Mouse testes, ovaries, and livers were immediately transferred to RNase-free microcentrifuge (Eppendorf, Hamburg, Germany) tubes, snap-frozen in liquid nitrogen, and sent to the Shanghai Meiji Biotechnology Company (Shanghai, China) for transcriptome analysis.

Gene expression analysis was performed using the Meiji Biotechnology platform to identify the differentially expressed genes (DEGs) between tissues. DEGs with a |log2(foldchange)| > 1 and adjusted P-value (Padj) < 0.05 were selected for volcano plot generation. Functional enrichment analysis of DEGs was conducted using Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses to identify their biological functions and associated signaling pathways.

To explore the interactions between DEGs, a protein-protein interaction (PPI) network was constructed on the Meiji Biotechnology platform, selecting interactions with a correlation coefficient absolute value greater than 0.4. The PPI network was visualized using Cytoscape software. Additionally, key functional gene modules were identified using the Cytoscape plugin MCODE.

Results

Rec8 gene contains two core promoter regions

To identify the core promoter regions of the mouse Rec8 gene, we measured luciferase activity using a dual-luciferase assay on a transcriptional regulatory sequence comprising 2577 bp, including exon I and its upstream sequence. Compared with the pGL3-Basic control group (0.03), all 12 dual-luciferase reporter gene vectors of decreasing length exhibited significant promoter activity (0.11–5.56). As the sequence lengths gradually decreased, the LUC/REN ratios first increased significantly, followed by a gradual decrease, a slight increase, and finally a sudden decrease (Fig. 1A). The LUC/REN ratio of the –1881 bp region (4.95) was twice as high as that of the –2279 bp (2.52), indicating the possible presence of repressor protein-binding sequences in this region. In contrast, the LUC/REN ratio of –883 bp (5.56) was 4.8 times greater than that of –183 bp (1.15). The largest difference in transcriptional activity between –650 bp (4.39) and –385 bp (2.61) was particularly notable, suggesting the possible presence of promoters or enhancers in this region. The LUC/REN ratio of –89 bp (2.67) was approximately 2.3 times greater than that of –183 bp (1.15), indicating the possible presence of insulators or repressor protein-binding sequences in this region. However, the LUC/REN ratio of –89 bp (2.67) was approximately 24 times greater than that of –35 bp (0.11), suggesting that this region may contain the main active promoter region. These results indicate that the Rec8 gene may have two core promoter regions: –650 bp to –385 bp and –89 bp to –35 bp.

Fig. 1.

Analysis of Rec8 Promoter Activity. (A) Deletion analysis of the Rec8 promoter: Left panel shows a schematic representation of Rec8 promoter deletion constructs. Right panel displays the relative luciferase activities measured after the transfection of twelve Rec8 promoter deletion constructs. (B) Effect of in vitro methylation on Rec8 promoter activity: relative luciferase activity of the twelve Rec8 deletion constructs following in vitro methylation treatment. Each bar represents the mean ± SD (n = 3).

To further validate whether these two regions contained the main active promoter region, we performed in vitro methylation of the 12 Rec8 deficient constructs mentioned above, followed by an analysis of the LUC/REN ratio (Fig. 1B). The results showed that the LUC/REN ratio between –650 bp and –385 bp was 0.17–0.23, while that between –89 bp and –35 bp was 0.10–0.13, suggesting that these two regions are likely to be important promoter regions for Rec8.

We then used bioinformatics methods to predict the promoter region (–2279 bp) of the mouse Rec8 gene. The TSSW software predicted that the promoter would be located at –561 bp and that the TATA-like sequence would be located at –591 bp. Promoter 2.0 online software predicted that the promoter region would be located at –479 bp. These predictions were consistent with our experimental results (Fig. 1). Analysis using AliBaba2.1 software revealed 33 transcription factor-binding sites, including the TATA-like sequence in the –650 bp to –385 bp and –89 bp to –35 bp regions, further indicating that these regions are core promoter regions (Fig. 2; Supplementary Table 1).

Fig. 2.

Locations of CpG dinucleotides on the mouse Rec8 target gene. The positions of the CpG motifs are marked as red boxes and are numbered sequentially from 1 to 38. Exon I is underlined in green, while the regions for bisulfite PCR primers are indicated by arrows. The aqua blue areas signify the relatively CpG-rich region, with numbers on the right showing nucleotide positions relative to the Rec8 gene transcription initiation site.

CpG methylation in the Rec8 promoter region is lower in the testes than in other tissues

BSP was performed to analyze the methylation status of the Rec8 gene in mouse tissues. ApE software was used to compare the target fragment sequences of the sequenced recombinant plasmids with the original sequences and to analyze the methylation status of the CpG sites. We analyzed a 2457 bp sequence of the mouse Rec8 gene, which included intron 1 (60 bp), exon 1 (118 bp), and the upstream region (2279 bp). This region contained 38 CpG dinucleotides numbered from CpG 1 to CpG 38 (red boxes in Fig. 2).

First, CpG islands (CGIs) in the mouse Rec8 gene were predicted using Meth Primer online software (Supplementary Fig. 1). According to the software predictions, the sequence contained two relatively CpG-rich regions, similar to CGI. The length of the first relatively CpG-rich region was 122 bp (–384 to –262 bp), containing CpGs 13–16, and the length of the second relatively CpG-rich region was 151 bp (–148 to +3 bp), containing CpGs 22–33 (aqua blue areas in Fig. 2).

Second, we investigated the methylation level differences of the Rec8 gene promoter region in the testes, ovaries, uterus, and liver. Three biological replicates and ten technical replicates were performed for each tissue.

The methylation patterns of mouse Rec8 across different tissues were as follows: CpGs 1–38 were highly methylated in the ovaries, uterus, and liver, with average methylation rates of 79, 71, and 87%, respectively. This result is consistent with published whole-genome methylation sequencing data [23]. However, low methylation was observed in the testes, especially at CpGs 10–19, with an average methylation rate of 18.4%, which was significantly different from that in the other tissues (P < 0.0001) (Fig. 3; Supplementary Fig. 2).

Fig. 3.

CpG methylation statuses in various mouse tissues. Bar charts depicting the percentage of methylation at each CpG position are presented. Tissues analyzed include the testis (A), ovary (B), uterus (C), and liver (D), with data obtained from three mice.

Correlation between CpG site methylation and Rec8 expression

To evaluate the degree of correlation between CpG site methylation and Rec8 mRNA expression, we also performed qRT-PCR analysis of Rec8 expression in the testis, ovary, uterus, and liver tissues of ICR mice (Fig. 4). The qRT-PCR results showed that the Rec8 gene expression level was greater in the testes than in other tissues.

Fig. 4.

Mouse Rec8 gene expression in tissues. The data are presented as the means ± SDs and were obtained from three independent experiments in mice.

Based on the Rec8 mRNA expression levels and the methylation status of CpG sites within the differential regions of the 12 fragments, we performed a correlation analysis (Table 3). The results revealed a significant negative correlation between Rec8 mRNA expression in the testes and the methylation of CpGs 10–12, CpGs 13–17, CpGs 18–19, and CpGs 22–24 (bold numbers in Table 3). CpGs 10–19 were located within the –650 bp to –183 bp region, where the LUC/REN ratio was significantly decreased. Notably, this region encompassed the core promoter (–650 bp to –385 bp) and a relatively CpG-rich region (–384 to –262 bp). These findings suggested that the transcriptional activity of Rec8 is closely associated with the activity of the core promoter region, the relatively CpG-rich region, and the degree of CpG methylation within these regions.

Table 3. Correlation analysis between Rec8 gene expression level and CpG methylation degree in 12 fragments.

CpG position	1–3	4–6	7, 8	9	10–12	13–17
	(–2279~ –1881 bp)	(–1881~ –1345 bp)	(–1345~ –883 bp)	(–883~ –650 bp)	(–650~ –385 bp)	(–385~ –263 bp)
Pearson’s (r-values)	0.472	0.650	–0.504	–0.606	–0.998	–0.983
P-value	0.528	0.350	0.496	0.394	0.002	0.017
CpG position	18, 19	20, 21	22–24	25–32	33	34–38
	(–263~ –183 bp)	(–183~ –145 bp)	(–145~ –89 bp)	(–89~ –35 bp)	(–35~ –3 bp)	(–3~ +188 bp)
Pearson’s (r-values)	–0.972	–0.140	–0.972	–0.104	–0.504	–0.807
P-value	0.028	0.860	0.028	0.896	0.496	0.193

Pearson’s r-values ≥ ± 0.3 and P-values ≤ 0.05 are considered to indicate significant correlations.

RNA-Seq analysis results

We performed RNA-Seq for the testes (or ovaries) and livers, which exhibited significant differences in Rec8 mRNA expression levels, to characterize the transcriptomic features of these tissues. Twenty-one Rec8-related transcription factors were obtained from the Network Analyst database (https://www.networkanalyst.ca/) (Fig. 5A).

Fig. 5.

Transcriptome analysis results. (A) Heatmaps of 21 DEGs associated with Rec8 in the testes, ovaries, and liver. (B) GO analysis of the 21 DEGs enriched in the testes and liver. (C) KEGG pathway analysis of the 21 DEGs enriched in the testes and liver. (D) PPI network constructed using the DEGs identified in the testis and liver. Red represents upregulated proteins, blue represents downregulated proteins, and yellow indicates unaffected proteins.

Next, we conducted bioinformatics analysis using the GO and KEGG databases to explore the functions of the DEGs. The DEGs were categorized into three main groups based on their p-values: biological process (BP), cellular component (CC), and molecular function (MF). In GO-BP analysis, DEGs in the testes were primarily enriched in processes such as cellular processes and biological regulation (Fig. 5B). In the GO-CC analysis, they were mainly enriched in cellular components such as cellular parts and organelles (Fig. 5B). In the GO-MF analysis, DEGs were predominantly associated with molecular functions such as binding and transcriptional regulation (Fig. 5B). These results suggested that Rec8-related DEGs act as transcriptional regulatory factors within the Rec8 promoter region to regulate cellular processes.

We further explored the DEGs using KEGG analysis, which revealed 18 enriched pathways, including signal transduction, cell growth and death, and cancer-related pathways, all of which were upregulated (Fig. 5C). These findings indicate that Rec8-related DEGs help maintain normal cell proliferation by regulating the transcriptional activity of Rec8. The dysregulation of these factors may lead to abnormal Rec8 transcription, potentially contributing to cancer development.

We sought to gain further insight into the genes differentially expressed in the testes and liver by further exploring them using PPI networks. Among them, TBP (TATA-box-binding protein), an upregulated REC8 protein, attracted our attention, in addition to the various cohesin subunits that interact with REC8 (Fig. 5D). This is consistent with our previous hypothesis that the TATA-like sequence present in the core promoter region is an important sequence that regulates Rec8 transcriptional activity.

Discussion

REC8 is detected on chromosomes prior to DNA replication at the preleptotene stage of meiosis I, and remains bound at the centromeres until the anaphase stage of meiosis II [5]. However, the molecular mechanisms that regulate the transcriptional activity of the Rec8 gene remain poorly understood. This study is the first to describe the characteristics of the core promoter region of the Rec8 gene, as well as the relationship between the DNA methylation of CpGs and Rec8 gene expression.

Luciferase assay results revealed that deletion of the –650 bp to –385 bp and –89 bp to –35 bp regions in the upstream sequence of the Rec8 gene led to a marked decrease in Rec8 promoter activity. This suggests that these two regions likely represent the core promoter regions of Rec8. Based on computational predictions and RNA-Seq analysis, we focused on TATA-like sequences as potential regulatory elements in these regions.

According to previous reports, the bovine elastin gene has a TATA-like sequence, ATAAAA, in its natural promoter region, and this sequence is demonstrated to bind to TBP for initiating transcription of the elastin gene [24]. Therefore, the TATA-like sequence in the Rec8 promoter region may also bind to TBP and initiate RNA synthesis.

A study using a dual-luciferase assay demonstrated that in orange groupers, Rec8 expression may be regulated by Dmrt1, as deletion of the Dmrt1 binding sequence (approximately –2202 bp to –1079 bp) in the Rec8 gene promoter region leads to reduced promoter activity [25, 26]. However, we did not find a Dmrt1-binding sequence in the promoter region of mouse Rec8, indicating that the mechanisms regulating the transcriptional activity of the Rec8 gene differ among vertebrates.

DNA methylation is a well-known epigenetic modification, and DNA methylation in promoter regions has become a widely studied area because of its association with gene transcriptional silencing [27]. Some studies have shown that approximately 70% of gene promoters are associated with CGIs, making CGIs the most common promoter type in vertebrate genomes, including almost all housekeeping genes and some tissue-specific genes [28,29,30]. Meth Primer online software analysis revealed two relatively CpG-rich regions similar to CGI in the promoter region of Rec8: 122 bp (–384 bp – –262 bp) and 151 bp (–148 bp – +3 bp) (Fig. 2). The complete or partial sequences of these two CpG-rich regions were located within the two identified core promoter regions. Consequently, the absence of these relatively CpG-rich regions likely led to a significant reduction in Rec8 promoter activity. These two relatively CpG-rich regions significant affected the activity of the Rec8 promoter.

In general, enhancer regions tend to have mostly CpG-poor and variable methylation conditions, termed low-methylated regions (LMRs) [31]. Our results indicated that CpGs 10–19, located within the core promoter region (–650 bp to –385 bp) and the relatively CpG-rich regions, exhibited low methylation levels in the testes (Fig. 3). A study utilizing whole-genome methylation sequencing of mouse sperm, zygotes, and early embryos indicated that the methylation level of Rec8 in sperm was 66.26% (which is similar to the methylation levels of Rec8 in the other tissues analyzed). In contrast, the methylation level of Rec8 in MII stage germ cells was 0% [32]. Therefore, we can rule out the possibility of low methylation of Rec8 in sperm. Additionally, methylation of CpG sites 10–19 was negatively correlated with Rec8 expression (Table 3). This suggests that Rec8 expression in germ cells may be regulated by methylation.

The difference in methylation status between the ovaries and testes seems to contradict some previous research hypotheses [33], likely because we used ovarian tissue rather than oocytes in our study. We plan to use oocytes for future research on methylation status.

In summary, the promoter of the Rec8 gene has two core regions. Specific expression of this gene may be associated with the presence of a TATA-like sequence and low methylation of CpGs 10–19 within the core regions (Fig. 5). Overall, the results of this study provide a new theoretical basis for the development of infertility treatments.

Conflict of interests

The authors declare no competing interests