Low pH induces amiloride-sensitive expression of leukemia inhibitory factor in endometrial cells

Abstract

An association has been reported between a lower pH in the uterus and an increased rate of implantation. How low pH regulates endometrial function is unclear. This study investigated the effect of low pH on the expression of leukemia inhibitory factor (LIF), which is crucial for implantation, in a human endometrial carcinoma cell line, rat endometrial stromal cells, and porcine endometrial cells. LIF mRNA expression was quantified by real-time PCR and protein expression was assessed using western blot analysis. LIF mRNA and protein expression increased at low pH in human endometrial carcinoma cells. Increased LIF mRNA expression was also detected at low pH in rat endometrial stromal and porcine endometrial cells, suggesting that low intrauterine pH may create favorable conditions for implantation and endometrial receptivity across species. The increase in LIF mRNA expression in the three cell types was attenuated by the addition of amiloride, indicating that low pH promotes the expression of LIF via amiloride-sensitive molecules in the endometrium.

Endometrial receptivity is important for a successful pregnancy. Despite the development of various assisted reproductive technologies, including in vitro fertilization (IVF), approximately 15% of the patients undergoing IVF experience recurrent implantation failure [1, 2]. Knowledge of the pathogenesis of implantation failure and treatment options is urgently required.

Communication between the blastocyst and endometrium is essential for successful implantation. Similar to cancer cells, blastocysts must invade the surrounding endometrial tissue and induce remodeling of the vasculature within the endometrial tissue to obtain nutrients and oxygen from the maternal blood and modulate the local maternal immune system to prevent the blastocyst from being rejected by the maternal immune system [3, 4]. During implantation, blastocysts have a high capacity for aerobic glycolysis and release a substantial amount of lactic acid into the surrounding microenvironment, associated with a decrease in ambient pH [5, 6]. Creating a high-lactic acid microenvironment and accompanying low pH by blastocysts enables endometrial breakdown, angiogenesis, and immunoregulation, thereby facilitating successful implantation [7, 8]. However, the molecular mechanisms involved in the above changes in endometrial tissue due to lactic acid production, the associated decrease in pH, or both by the blastocyst are not fully understood.

Several factors, including cytokines and adhesion factors, regulated endometrial receptivity [2, 9]. Among these cytokines, leukemia inhibitory factor (LIF) is critical for successful embryo implantation [10]. Previous clinical studies and in vivo experiments have shown that deficient or low LIF expression causes repeated implantation failure [2, 11, 12]. LIF binds to its receptor and activates extracellular signal-regulated kinase 1/2 (ERK1/2) [13]. Activation of the ERK1/2 pathway increases matrix metalloproteinase-2 (MMP-2) and MMP-9 expression in primary uterine epithelial cells [14] and is required for the decidualization of endometrial stromal cells in mice and humans [15, 16]. Concerning adhesion factors, integrin α_vβ₃ expression increases during endometrial implantation [17, 18]. Integrin α_vβ₃ expression is considerably lower in the endometrium in patients with unexplained infertility, suggesting that integrin α_vβ₃ expression in the human endometrium could be associated with uterine receptivity [19]. It is unclear how lactic acid produced in blastocysts during implantation and the associated decrease in ambient pH affect the expression of LIF and integrins and what molecular mechanisms, if any, are responsible for this effect.

Lactic acid is sensed by the G protein-coupled receptor 81 (GPR81). Low pH is sensed by proton-sensing G protein-coupled receptors (GPCRs), acid-sensing ion channels (ASICs), and sodium-proton exchangers (NHEs). GPR81 activation promotes breast cancer cell migration and invasion, and induces angiogenesis [20]. Primary macrophages and monocytes in a high-lactic acid microenvironment reduce interleukin-1β (IL-1β), NOD-, LRR-, and pyrin domain-containing protein 3 (NLRP3), and caspase-1 expression via GPR81 and suppress Toll-like receptor 4 (TLR4)-mediated innate immunity [21]. In endometrial cells, lactate and low pH stimulation can upregulate the expression of GPR81 in Ishikawa cells [22]. Proton-sensing GPCRs, including ovarian cancer G protein-coupled receptor 1 (OGR1; also abbreviated GPR68), T cell death-associated gene 8 (TDAG8; also abbreviated GPR65), and GPR4, are activated at low pH levels [23]. GPCRs are involved in various functions, such as cancer development and inflammation [23]. Regarding endometrial function, TDAG8 inhibits the adhesion, proliferation, and invasion of human choriocarcinoma (JAR) spheroids and mouse blastocysts [24], and low GPR4 expression promotes the proliferation, migration, and invasion of HTR-8/SVneo trophoblast cells [25]. ASICs are activated by low pH [26] and stimulate Na⁺ influx into cells. ASIC1, 2, and 3 are expressed in various tissues and are involved in cell migration and invasion under acidic conditions [27,28,29,30]. ASIC4 and ASIC5 are expressed across multiple brain regions. However, little progress has been made in understanding their functions [31]. The functions of ASICs in the nervous system have been extensively addressed [32]. ASIC1 is involved in epithelial-mesenchymal transition (EMT) during endometriosis [33]. NHEs control intracellular pH by regulating H⁺ efflux and Na⁺ influx [34]. Ten isoforms of NHE have been reported, with NHE1-5 expressed in the plasma membrane, NHE6-9 in the organelle membrane, and NHE10 in osteoclasts [35]. They are involved in numerous physiological processes, ranging from the fine control of intracellular pH and cell volume to systemic electrolyte, acid-base, and fluid volume homeostasis [36]. NHE1, 2, and 4 are expressed in mouse endometrial epithelial cells and amiloride-sensitive sodium ion-dependent proton efflux has been observed [37]. It has been suggested that a decrease in intrauterine pH in cows at the onset of estrus is responsible for increased pregnancy success, and that NHE1, 2, and 3 may regulate intrauterine pH [38]. However, it is unclear how NHEs improve the efficiency of pregnancy.

Despite these observations, the exact molecular pathways through which lactic acid and low pH modulate endometrial receptivity remain unclear. The present study addressed the hypothesis that lactic acid and low pH enhance endometrial receptivity by upregulating LIF and integrin α_vβ₃ expression by activating proton-sensing receptors, ion channels, and sodium-proton exchangers.

Materials and Methods

Materials

Fetal bovine serum (FBS; Lot: 1883407) was purchased from Thermo Fisher Scientific (Waltham, MA, USA). Dulbecco’s modified Eagle medium (DMEM; Cat. No. D2902) and DMEM/F12 (Cat. No. D8900) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Recombinant human LIF (Cat No. HZ-1292) was purchased from Proteintech Group, Inc. (Rosemont, IL, USA). Anti-LIF antibody (Cat. No. GTX101021) was obtained from GeneTax (Los Angeles, CA, USA). Antibodies to ERK (Cat. No. 9102), phosphorylated ERK (p-ERK; Cat. No. 9101), and β-actin antibody (Cat. No.#4967) were purchased from Cell Signaling Technology (Danvers, MA, USA). The secondary antibody (Cat. No. NA934) was purchased from Cytiva (Tokyo, Japan). Amiloride hydrochloride (Cat. No. A2599) was purchased from TCI (Tokyo, Japan). Ym254890 (Cat. No. 257-00631) was obtained from FUJIFILM Wako Pure Chemical Corporation (Osaka, Japan). Pertussis toxin (PTX; Cat. No.168-22471) was obtained from FUJIFILM Wako Pure Chemical Corporation. RNAiso Plus (Cat. No.9109) was from TaKaRa Bio (Shiga, Japan). ReverTra Ace (Cat. No. TRT-101) and THUNDERBIRD NEXT SYBR qPCR Mix (at. No. QPX-201) were purchased from TOYOBO (Osaka, Japan). RQ1 DNaseI (Cat. No. M6101) was purchased from Promega (Madison, WI, USA). Protease inhibitor (Cat. No.160-19501) was purchased from FUJIFILM Wako Pure Chemical Corporation. Phosphatase inhibitor (Cat. No. ab201112) were purchased from Abcam (Cambridge, USA). Polyvinylidene fluoride (PVDF) membranes (Cat. No. IPVH00010) were purchased from Merck Millipore (Billerica, MA, USA). Bicinchoninic acid (BCA) Protein Assay Kit (Cat. No. T9300A) was purchased from TaKaRA Bio. ImmunoStar LD (Cat. No. 292-69903) was purchased from FUJIFILM Wako Pure Chemical Corporation. Skim milk was obtained from MEGMILK (Saitama, Japan). All other reagents were purchased from FUJIFILM Wako Pure Chemical Corporation.

Cell preparation

Human endometrial cancer-derived (HHUA) cells provided by the RIKEN BRC CELL BANK (No. RCB0658) were cultured in DMEM containing 10% (v/v) FBS in a humidified air/CO₂ (19:1) atmosphere. Passage of HHUA cells was performed by dislodging adherent cells with 0.25% trypsin solution when growth was 70–80% confluent. Cells passages between two and 20 times were used in the experiments. Rat endometrial stromal cells prepared from the uterus of three Jcl:Wister 10w rats at day 5 of gestation [39] were purchased from CLEA Japan Inc. (Tokyo, Japan). Briefly, the uterine lumen was filled with PBS containing 0.1% collagenase and incubated at 37°C for 1 h in a shaking water bath. The dissociated cells from each of the three rats were washed three times with DMEM/F12 and seeded in a 6 cm culture dish in DMEM/F12 containing 10% FBS. This study was approved by the Animal Experiment Committee of the Meiji University (MUIACUC2020-117). Porcine endometrial cells were prepared from the uterus at the follicular (n = 1) or parturition stage (n = 1) of an eight-month-old female of the three-way cross (LWD) line. Porcine uteri were kindly provided by Dr. Nagashima, Meiji University. The uterus was opened longitudinally using scissors. The inside of the incised uterus was rinsed with saline to remove excess mucus and gently scraped using a cell scraper. The scraped endometrial cells were suspended in saline and sedimented by centrifugation (200 g for 10 min at room temperature). The sedimented endometrial cells were resuspended in DMEM and incubated for 3 h at 37°C in a humidified air/CO₂ (19:1) atmosphere. The incubated cells were used in subsequent experiments. HHUA cells from different batches from two to 20 passages, rat endometrial stromal cells from three different individuals, and porcine endometrial cells from one pig were used for quantitative real-time PCR (Q-PCR) analysis. HHUA and rat endometrial stromal cells were seeded at a density of 2 × 10⁵ cells in 6 cm dishes.

pH experiment

The pH of DMEM was adjusted by titration with HCl or NaOH. pH-adjusted DMEM contained 25 mM HEPES, 27 mM NaHCO_3, and 0.1% bovine serum albumin (BSA, fraction V) to maintain a stable pH. pH was measured using a pH meter (Cat. No. HM-25R; TOADKK, Tokyo, Japan). The cells were incubated for 3 h at the indicated pH in DMEM in a model SCA-165DRS CO₂ incubator (5% CO₂,95% air; Astec, Fukuoka, Japan). To examine the changes in LIF expression at low pH, HHUA, rat endometrial stromal cells, and porcine endometrial cells were stimulated with pH DMEM for 3 h. When inhibitors were used, they were added together at the following concentrations when the culture medium was changed to pH DMEM (Amiloride: 200 µM, Ym254890: 100 nM, CuCl₂: 100 µM, and PTX: 100 nM). Amiloride was used to inhibit ASICs, NHEs, and epithelial sodium channels (ENaC). Ym254890 was used to inhibit the G_q protein coupled with a proton-sensing GPCR. PTX was used to inhibit G_i proteins coupled with GPCR. CuCl_s was used as a general antagonist of proton-sensing GPCRs.

Q-PCR

Q-PCR and reverse transcription PCR (RT-PCR) were performed as previously described [40]. Total RNA was extracted from HHUA, rat endometrial stromal cells, and porcine endometrial cells using RNAiso Plus (2 × 10⁵ cells/ml). The concentration of RNA obtained from HHUA cells and rat endometrial stromal cells was 1.0 µg/µl and that from porcine endometrial cells was 0.8 µg/µl. Reverse transcripts were synthesized in the presence (RT+) or absence (RT–) of ReverTra Ace using 1 µg of total RNA that was pre-treated with DNase I. The transcripts were subjected to PCR. Ex Taq was used for RT-PCR according to the manufacturer’s instructions. Amplification was performed using the following program: 95°C for 1 min, followed by 40 cycles of 95°C for 15 sec, 58°C for 15 sec, and 72°C for 45 sec. For Q-PCR, we used the THUNDERBIRD NEXT SYBR qPCR Mix. Increased fluorescent signals were measured using the Step One Plus Real-Time PCR System (Thermo Fisher Scientific). Information on the primer sequences and other information used in the PCR are provided in Table 1. Primers were designed using primer3plus based on NCBI sequences. Relative gene expression data were analyzed using Q-PCR, and the 2(-Delta C(T)) method was used to estimate the mRNA copy number relative to that of GAPDH, which was used as an internal standard [41].

Table 1. Sequences of primers used in PCR reactions.

Target	Forward primer	Reverse primer	Product size	Annealing temperature	Accession number
human-LIF	TGGTTCTGCACTGGAAACATG	GTAATAGAGAATAAAGAGGGCATTGG	164 bp	58°C	NM_002309.5
human-GAPDH	GAAGGTGAAGGTCGGAGTC	GAAGGTGAAGGTCGGAGTC	152 bp	58°C	NM_001256799.3
human-integrinαv	ATGCTCCATGTAGATCACAAGAT	TTCCCAAAGTCCTTGCTGCT	339 bp	58°C	NM_001144999.3
human-integrinβ3	CTGCCGTGACGAGATTGAGT	TGCCCCGGTACGTGATATTG	383 bp	58°C	NM_000212.3
human-LIFR	AGCCTCAAGCAAAACCAGAA	TTGGCCTGAGGTCTGTAACC	154 bp	58°C	NM_001364298.2
human, rat-ASIC1	TCCGTAAGTCACCTCCAACC	AGGTTGCCAAGAGAAGCAAA	234 bp	60°C	NM_001095.4, NM_001414903.1
human, rat-ASIC2	AGGATGGCAAACCTCTGCTC	TGTAGCGGGTTAGGTTGCAG	510 bp	60°C	NM_001094.5, NM_001034014.1
human, rat-ASIC3	CATCATCGATCAGCTGGGCT	GTCACCAAGCAGCTCTGACA	574 bp	60°C	NM_004769.4, NM_173135.2
human, rat-ASIC4	AGGATGCGAAACCCAAGGAG	TCCGCGTTGAAGGTGTAACA	583 bp	60°C	NM_018674.6, NM_022234.2
human, rat-ASIC5	CCTTGGGGAGAATGCAATCCT	GCCTTTTGCTGCTGGGTTAT	425 bp	60°C	NM_017419.3, NM_022227.2
human, rat-NHE1	CGCTCATAGCCTCAGGAGTG	AGTGGCCACAGATGTCTTCG	558 bp	60°C	NM_003047.5, NM_012652.2
human, rat-NHE2	TGCAGGAATCGCCAACTTCT	AACGCAAAACAGATGGCACC	519 bp	60°C	NM_003048.6, NM_001113335.1
human, rat-NHE3	CGGCAGGAGTACAAGCATCT	GCCGGGAGAGTAGGGAATCT	504 bp	60°C	NM_004174.4, NM_012654.3
human, rat-NHE4	GATGATCTTTGGGGAGGCCC	TGGCTCTCCAGATTTGGCAG	518 bp	60°C	NM_001011552.4, NM_001413317.1
human, rat-NHE5	GCTGTTTGGGAGCCTCATCT	CCTTCAGGTAGTCAGTGGCC	203 bp	60°C	NM_004594.3, NM_138858.1
human, rat-ENaC	TGCCTGGAATCAACAACGGT	GCCATCGTGAGTAACCAGCA	519 bp	60°C	NM_001159575.2, NM_031548.2
rat-LIF	TACCCTGGGATGGAATGTGT	TTGGGTCTATCAGGCTTTGG	153 bp	58°C	NM_022196.3
rat-GAPDH	AGTGCCAGCCTCGTCTCATA	GATGGTGATGGGTTTCCCGT	248 bp	58°C	NM_017008.4
pig-LIF	AAAGGAGCCTCAATCCTGGT	TGACAGCCCAGCTTCTTCTT	190 bp	58°C	NM_214402.2
pig-GAPDH	GTCGGTTGTGGATCTGACCT	AGCTTGACGAAGTGGTCGTT	210 bp	58°C	NM_001206359.1
pig-ASIC1	GAACATCCTGGTGCTGGACA	AGTCCTCAAAAGTGCCTCGG	368 bp	60°C	XM_021091640.1
pig-ASIC2	AAACGACGTTTGAAGCAGGC	AGGCGGTGATGCTGTAAACA	210 bp	60°C	XM_021067438.1
pig-ASIC3	AGACTCGCTTTGTGACTCGG	CGTTCTCCTCGATGTAGGCC	264 bp	60°C	XM_013990732.2
pig-ASIC4	GGGTGCTCTCTGTTCCAGAC	TCCCGGATTCCTGGATTCCT	306 bp	60°C	XM_021076308.1
pig-ASIC5	ATTGTCTGGAACCGGAGCAG	GCTGCGGCTTCTGTTTGAAA	212 bp	60°C	XM_003128998.4
pig-NHE1	GACTCCTCGCTGCCTATGTC	AGGCCATGGCTTCTGAGAAC	169 bp	60°C	NM_001007103.1
pig-NHE2	TCTTGCCGGAACAGTTCTCC	TGGCCGTTTCCATTAAGGCT	311 bp	60°C	NM_001100189.1
pig-NHE3	GGACAGTGGACACCTGGAAG	GTGAGCAGGTCCGAACTTCA	270 bp	60°C	XM_021077062.1
pig-NHE4	CGCTGCTGCATTCTTAGCTG	ATTTCCAAAGCCCCTCCTGG	200 bp	60°C	XM_003354711.3
pig-NHE5	CGTGGTGCTGTACAAGGTCT	TGTTGGCCTCCACGTACTTC	308 bp	60°C	XM_021094077.1
pig-ENaC	GGGGCGACTATAGTGACTGC	ACACTTGGTGAAACAGCCCA	263 bp	60°C	NM_213758.2

Measurement of intracellular calcium ([Ca²⁺]_i)

The change in [Ca²⁺]_i was measured using the fura-2 method as described previously [42, 43]. Changes in the intensities of fluorescence at 540 nm obtained at 340 nm and 380 nm excitations were monitored using a model FP-8200 spectrofluorometer (JASCO, Tokyo, Japan).

Western blot analysis

Western blot analysis was performed as previously described [44]. Briefly, cells were lysed on ice in RIPA buffer (20 mM Tris [pH 7.4], 150 mM NaCl, 1% NP-40 alternative, 0.5% sodium deoxycholate, 0.1% SDS, and 2 mM EDTA) containing protease and phosphatase inhibitors. The extracted protein content was quantified using BCA protein assay kit. Before loading samples, the proteins were denatured by boiling at 100°C for 5 min in 2 × SDS sample buffer. Denatured samples (10 μg/sample) were subjected to SDS-PAGE and transferred to PVDF membranes. The membranes were blocked with 3% skim milk for 1 h at room temperature. The membranes were then incubated with primary antibodies at 4°C overnight. The primary antibodies used targeted LIF, ERK, p-ERK, and β-actin (all 1:1000 dilution). Each membrane was washed three times with Tris-buffered saline-Tween (TBST) and incubated with the secondary antibody (1:10,000) for 1 h at room temperature. After washing the membrane three times with TBST, each membrane was treated using an ImmunoStar LD ECL Chemiluminescence Kit to detect positive signals. The LAS4000 gel imaging system (FUJIFILM, Tokyo, Japan) was used for imaging and analysis.

Statistical analysis

The results of multiple observations are presented as the mean ± standard error of the mean (SE) or a representative result (mean ± standard deviation), as indicated in the figure legend. Statistical significance was assessed using the Student’s t-test. Statistical significance was set at P < 0.05.

Results

Lactic acid and low pH-induced LIF and integrin α_v β₃ expression in HHUA cells

To elucidate the effect of lactic acid on LIF expression in endometrial cells, HHUA, human endometrial carcinoma cells were used. LIF mRNA expression was increased upon stimulation with 100 mM lactic acid (Fig. 1A). The stimulation medium containing 100 mM lactic acid had a pH of approximately 5.6 under the conditions employed. Next, we investigated whether the expression of LIF upon the addition of lactic acid was attributable to lactic acid itself or to the decrease in pH caused by the addition of lactic acid. When the cells were stimulated with hydrochloric acid in lieu of lactic acid, an elevation in LIF mRNA expression was detected at pH = 5.6 (Fig. 1B). Moreover, LIF mRNA expression was enhanced and LIF protein expression was increased at pH = 5.6 (Fig. 1C). In contrast, the LIF receptor expression did not undergo notable alterations in response to low pH conditions (Fig. 1D). The function of increased LIF was evaluated by assessing LIF receptor-mediated activation of ERK in these cells. As shown in Fig. 1E, the extracellular addition of LIF resulted in the activation of ERK1/2. Activation of ERK1/2 was also observed at pH = 5.6. LIF expression increased at this pH (Fig. 1C). Next, we investigated whether the expression of integrin α_v β₃, was influenced by the low pH. As shown in Figs. 1F and 1G, mRNA expression of integrin α_v and integrin β₃ were upregulated with low pH. These findings suggest that acidic conditions may enhance the expression of the molecules associated with implantation in endometrial cells.

Fig. 1.

Lactic acid and low pH-induced LIF expression and low pH-induced integrin expression in HHUA cells. (A) HHUA cells were stimulated with 100 mM lactic acid in DMEM containing 10% FBS for 3 h. The expression of LIF mRNA was normalized as a ratio to the expression of GAPDH mRNA and is expressed as relative values with the pH 7.4 value as 1. (B) HHUA cells were stimulated for 3 h at the indicated pH in DMEM containing 10% FBS, and LIF mRNA expression is shown as in (A). (C) HHUA cells were stimulated at the indicated pH or with 50 ng/ml human LIF in DMEM containing 10% FBS for 3 h, and LIF protein expression was estimated by western blotting. The level of LIF expression was calculated as the ratio of the expression level of β-actin (LIF/β-actin ratio). (D) HHUA cells were stimulated at the indicated pH in DMEM containing 10% FBS for 3 h, and the expression level of LIF receptor (LIFR) mRNA was estimated as in (A). (E) HHUA cells were stimulated at the indicated pH or with 50 ng/ml human LIF in DMEM containing 10% FBS for 3 h, and the protein expression of ERK1/2 and the phosphorylated form of ERK1/2 was estimated using western blotting. The activation level of ERK1/2 was estimated as the ratio of p-ERK/ERK (p-ERK/ERK ratio). (F) HHUA cells were stimulated at the indicated pH in DMEM containing 10% FBS for 3 h and integrin α_v (ITGα_v) mRNA expression was estimated as in (A). (G) HHUA cells were stimulated at the indicated pH in DMEM containing 10% FBS for 3 h and integrin β₃ (ITG β₃) mRNA expression was estimated as in (A). Results are represented as mean ± SE of three different experiments performed in triplicate (A, B, D, F, G). A representative result is shown in C and E. The other two experiments showed similar results. The asterisk (*) indicates that the activities are significantly different (P < 0.05).

LIF upregulation with low pH does not involve proton-sensing GPCRs or GPR81

Because the upregulation of LIF and integrin expression was caused by lactic acid and low pH, we analyzed the mechanism of LIF upregulation under acidic conditions in subsequent experiments. We examined whether the proton-sensing GPCRs (OGR1 [GPR68], TDAG8 [GPR65], and GPR4) or GPCR for lactic acid (GPR81) were involved in the increased expression of LIF under acidic conditions. To examine this, we measured the [Ca²⁺]_i in addition to LIF mRNA expression and used an antagonist and G-protein inhibitors. As shown in Fig. 2A, a transient increase in [Ca²⁺]_i was detected in HHUA cells stimulated at low pH. This increase was attenuated by Ym259890. Since Ym254890 inhibits the G_q protein, this result indicates that OGR1, which is coupled to the G_q protein, is functionally expressed in HHUA cells. Therefore, we examined the effect of Ym254890 on LIF expression induced by low pH. The G_q inhibitor did not attenuate LIF expression, indicating that the OGR1/G_q pathway was not involved in this increase (Fig. 2B). Subsequently, we examined whether the other proton-sensing GPCRs, TDAG8 and GPR4, were involved in increased LIF expression at low pH using copper ions, which have antagonistic effects on proton-sensing GPCRs [45]. Low pH-induced LIF expression was not attenuated by the addition of CuCl₂, indicating that LIF expression was not induced by the proton-sensing GPCRs (Fig. 2C). Finally, we examined the possible involvement of GPR81 coupled to G_i protein in LIF upregulation. This upregulation was not attenuated by treatment with pertussis toxin, which inhibits the G_i protein, suggesting that GPR81 is not involved in the low pH-induced expression of LIF (Fig. 2D).

Fig. 2.

Proton-sensing and lactic acid GPCRs are not involved in the low pH-induced LIF mRNA expression. (A) Low pH-induced a transient increase in intracellular calcium concentration ([Ca²⁺]_i). HHUA cells were harvested from the dishes, and [Ca²⁺]_i was measured. The typical trace of [Ca²⁺]_i change with HCl is shown in the absence (left panel) or in the presence of 100 nM Ym254890 (right panel). (B) HHUA cells were stimulated for 3 h in DMEM containing 10% FBS at pH 5.6 in the absence (white column) or presence (black column) of 100 nM Ym254890. LIF mRNA expression was normalized as a ratio of GAPDH mRNA expression and is shown as a relative value in the absence of inhibitor at the pH 5.6 value as 1. (C) HHUA cells were stimulated for 3 h in DMEM containing 10% FBS at pH 5.6 in the absence (white column) or presence (black column) of 100 μM CuCl₂. LIF mRNA expression was estimated as in (B). (D) HHUA cells were stimulated for 3 h in DMEM containing 10% FBS at pH 5.6 in the absence (white column) or presence (black column) of 100 nM PTX. LIF mRNA expression was estimated as in (B). A representative result is shown in A. The other two experiments showed similar results. Results are represented as mean ± SE of three different experiments performed in triplicate (B, C, D).

Amiloride inhibits low pH-induced LIF expression in HHUA, rat endometrial stromal, and porcine endometrial cells

Since GPR81 and proton-sensing GPCRs are not involved in low pH-induced LIF expression in HHUA cells, we assessed the effect of amiloride, which inhibits ASICs, NHEs, and ENaCs [26, 34, 46]. Amiloride partially but significantly suppressed LIF expression in HHUA cells at low pH (Fig. 3A). Since HHUA is a cell line derived from endometrial carcinoma, we next investigated whether this amiloride-sensitive, low pH-dependent increase in LIF expression was also observed in normal endometrial cells. Endometrial stromal and endometrial cells were prepared from the uteri of pregnant rats and porcine uteri during the follicular phase, respectively. As shown in Figs. 3B and 3D, low pH increased LIF expression in these cells, which was suppressed by the addition of amiloride (Figs. 3C and 3E). These results indicate that the low pH-induced increase in LIF expression mediated by amiloride-sensitive molecules is not a phenomenon specific to the HHUA cell line, but may be common to endometrial cells.

Fig. 3.

The effect of amiloride on LIF expression induced by low pH in HHUA, rat endometrial stromal, and porcine endometrial cells. (A) HHUA cells were cultured at pH 5.6 in the absence (white column) or presence (white column) of 200 μM amiloride for 3 h. LIF mRNA expression was normalized as a ratio of GAPDH mRNA expression and is shown as a relative value in the absence of amiloride at the pH 5.6 value as 1. Results are the mean ± SE of three different experiments performed in triplicate. The asterisk (*) indicates that the activities are significantly different (P < 0.05). (B) Rat endometrial stromal cells (n = 3) were stimulated at the indicated pH in DMEM containing 10% FBS for 3 h. LIF mRNA expression was normalized as a ratio of GAPDH mRNA expression and is shown as a relative value at the pH 7.4 value as 1. Results are represented as mean ± SE of three different experiments performed in triplicate. The asterisk (*) indicates that the activities are significantly different (P < 0.05). (C) Rat endometrial stromal cells were cultured at pH 5.6 in the absence (white column) or presence (black column) of 200 µM amiloride for 3 h. LIF mRNA expression was normalized as a ratio of GAPDH mRNA expression and is shown as a relative value in the absence of amiloride at the pH 5.6 value as 1. Results are the mean ± SE of three different experiments performed in triplicate. The asterisk (*) indicates that the activities are significantly different (P < 0.05). (D) Porcine endometrial cells at the follicular stage (n = 1) were stimulated at the indicated pH in DMEM containing 10% FBS for 3 h. LIF mRNA expression was normalized as a ratio of GAPDH mRNA expression and is shown as a relative value at the pH 7.4 value as 1. Results are represented as mean ± SD of one experiment performed in triplicate. (E) Porcine endometrial cells were cultured at the indicated pH in the absence (white column) or presence (black column) of 200 μM amiloride for 3 h. LIF mRNA expression was normalized as a ratio of GAPDH mRNA expression and is shown as a relative value in the absence of amiloride at the pH 7.4 value as 1. Results are represented as mean ± SD of one experiment in triplicate.

NHE1 and NHE4 are commonly expressed in endometrial cells

To identify the target molecules of amiloride that induce LIF expression at a low pH, we first examined the expression of ASICs, NHEs, and ENaCs, which are localized in the plasma membrane of HHUA cells. Expression of ASIC1, NHE1, NHE4, and ENaC was detected in these cells (Fig. 4A). Next, we examined the expression of these genes in rat endometrial stromal cells, which showed similar amiloride sensitivity to low pH LIF expression in HHUA cells. As shown in Fig. 4B, ASIC1, NHE1, and NHE4, but not ENaC, were detected in these cells. These results indicate that the expression of ASIC1, NHE1, and NHE4 is a typical feature in endometrial cells with low pH-induced LIF expression. We further examined the expression of ASICs, NHEs, and ENaC in other types of primary endometrial cells, such as follicular phase porcine endometrial cells. These cells displayed similar amiloride sensitivity to LIF expression at low pH. NHE1, NHE4, and ENaC expression was also detected in porcine endometrial cells, while ASIC1 expression was not (Fig. 4C).

Fig. 4.

Expression of ASICs, NHEs, and ENaC in HHUA, rat endometrial stromal, and porcine endometrial cells. RT-PCR was performed to determine whether ASIC subtypes 1~5, NHE subtypes 1~5, and ENaC are expressed in HHUA cells (A), rat endometrial stromal cells (B), and porcine endometrial cells at the follicular stage (C). After 40 cycles of PCR reaction, samples were electrophoresed on 1% agarose and stained with ethidium bromide. GAPDH was used as a positive control.

Discussion

In this study, we found that lactic acid induces LIF expression in HHUA cells (Fig. 1A). LIF expression was also detected at low pH following the addition of lactic acid (Figs. 1B and 1C). Low pH-induced LIF expression was detected in rat endometrial stromal cells (Fig. 3B) and in porcine endometrial cells at the follicular stage (Fig. 3D), indicating that low pH-stimulated LIF expression in uterine endothelial cells may be a common phenomenon in different species. Low pH-induced integrin α_vβ₃ expression in HHUA cells (Figs. 1F and 1G). Since LIF and integrins play important roles in implantation, it is possible that a low intrauterine pH creates favorable conditions for implantation and endometrial receptivity. In fact, the mouse uterine epithelium becomes more acidic at the onset of embryo implantation, and suppression of uterine epithelial acidification negatively affects embryo implantation [47]. Furthermore, the possibility that lower intrauterine pH may be involved in increased pregnancy efficiency has also been reported in cows [38]. LIF expression was not detected in endometrial cells derived from the porcine uterus during late pregnancy, even under low pH conditions (data not shown). This suggests that LIF expression and upregulation may be characteristics of endometrial cells prepared for implantation.

Blastocysts release a substantial amount of lactic acid and lower the ambient pH in the surrounding microenvironment at the time of implantation [5, 6]. Moreover, blastocyst-derived lactic acid upregulates S100A6, which plays an important role in stromal cell decidualization [48]. Exposure to lactic acid and low pH increased vascular endothelial growth factor expression in Ishikawa cells and migration of stromal cells into lactide spheres [22].

ERK1/2 activation was observed in HHUA cells upon LIF treatment (Fig. 1E). Since the LIF receptor expression did not change considerably with decreasing pH in these cells (Fig. 1D), the activation of ERK1/2 at pH 5.6 may result from the activation of its own LIF receptor owing to an increased amount of LIF, whose expression is induced at pH 5.6. Activation of ERK leads to cell proliferation, migration, and apoptosis [14, 49]. In primary uterine epithelial cells, activation of the ERK1/2 pathway increases the expression of MMP2 and MMP9 [50]. Activation of the ERK1/2 pathway is also required for desmoplasia of mouse and human endometrial stromal cells [15, 16].

As autocrine/paracrine factors involved in implantation, such as prostaglandins and lysophosphatidic acid, exert their effects through GPCRs [51, 52], we first investigated the possibility that GPR81 and proton-sensing GPCRs (OGR1, GPR4, and TDAG8) are involved in lactic acid- and low pH-induced LIF expression. The involvement of GPR81 in low pH-induced LIF expression is unlikely because low pH-induced LIF expression was not inhibited by treatment with pertussis toxin, which inhibits G_i proteins coupled to GPR81 [53]. This suggests that low pH may not produce sufficient lactic acid to induce LIF expression via GPR81 in HHUA cells. However, we could not rule out the possibility that lactic acid itself induces LIF expression via GPR81, because the level of LIF expression was higher than that under low pH conditions (Figs. 1A and 1B). Similar to proton-sensing GPCRs, a transient increase in [Ca²⁺]_i was observed when HHUA cells were stimulated at low pH. This increase was inhibited by Ym259890, indicating that OGR1 is functionally expressed in the cells (Fig. 2A). However, since Ym259890 and copper ions did not inhibit LIF expression at low pH (Figs. 2B and 2C), it is unlikely that proton-sensing GPCRs are responsible for stimulating LIF expression at low pH.

Amiloride is a potassium-retaining diuretic [46]. Its primary targets are ENaCs. It also acts on ASICs and NHEs [26, 34]. In this study, NHE1 and 4 were commonly detected in HHUA (Fig. 4A), rat endometrial stromal (Fig. 4B), and porcine endometrial cells (Fig. 4C). Regarding the expression of NHEs in the uterus, the expression of NHE1, NHE2, and NHE4 has been reported in mouse uterine epithelial cells [37] and expression NHE1, 2, 3, and 4 described in the bovine endometrium [38], which is partially different from the NHE expression pattern in this study. Whether this difference is due to species or sex-cycle differences should be investigated in future studies. NHE1 may mediate low pH-induced LIF expression because NHE4 is highly resistant to amiloride [54]. However, further studies are required to confirm these findings.

In conclusion, low pH enhanced LIF expression in HHUA, rat endometrial stromal, and porcine endometrial cells. This expression was suppressed by amiloride, indicating that NHE1 is involved in low pH-induced LIF expression in endometrial cells. The results of this study provide valuable insights into the molecular and cellular mechanisms that govern successful implantation during early pregnancy. The identification of the key factors that influence NHE1 activity offers potential strategies for improving IVF outcomes. In clinical practice, the use of intrauterine pH as a biomarker of successful implantation may allow clinicians to monitor patients more effectively and provide real-time guidance regarding the most appropriate course of action.

Conflict of interests

The authors declare no conflicts of interest.