Skip to main content
Translational Oncology logoLink to Translational Oncology
. 2025 May 27;58:102422. doi: 10.1016/j.tranon.2025.102422

Cucurbitacin B induces oral squamous cell carcinomapyroptosis via GSDME and inhibits tumour growth

Xin Chen a,, Mengyuan Yang a,, Heng Zhang a, Yajun Wang a, Wenpeng Yan a, Chen Cheng a, Rongrong Guo a, Jiawei Chai a, YaHsin Zheng b, Fang Zhang a,
PMCID: PMC12159210  PMID: 40424936

Highlights

  • OSCC management suffers from a lack of biomarkers and molecular targets.

  • Pyroptosis is strongly associated with OSCC progression.

  • CuB promises to improve OSCC immunotherapy outcomes.

  • CuB induces CD8+ T cell infiltration around tumours.

  • CuB-induced OSCC pyroptosis through the GSDME pathway.

Keywords: Cucurbitacin B, GSDME, OSCC, pyroptosis, CD8+T

Abstract

Background

Pyroptosis, a form of programmed cell death, has been shown to induce anti-tumour immunity and inhibit tumour growth. Oral squamous cell carcinoma (OSCC), a prevalent malignant tumour, could benefit from pyroptosis induction as a therapeutic strategy. Cucurbitacin B (CuB), a natural compound derived from various plants, exhibits broad anti-tumour activity. However, whether CuB can exert its anti-tumour effects in OSCC through pyroptosis remains unexplored.

Results

CuB significantly inhibited the proliferation of OSCC cells, induced pyroptosis, and elevated the levels of inflammatory factors in the cell supernatant. Bioinformatics analysis predicted the potential role of pyroptosis in OSCC, which was subsequently validated in a 4NQO-induced OSCC mouse model. The results demonstrated that CuB not only exerted tumour-inhibitory effects but also increased the infiltration of CD8+ T cells in the peritumoural region. To elucidate the mechanism of CuB-induced pyroptosis, STAT3 was identified as a key target of CuB in OSCC, with its expression upregulated in tumour tissues. Further experiments revealed that CuB induced pyroptosis by suppressing STAT3 expression and promoting the cleavage of caspase-3 and Gasdermin-E (GSDME).

Conclusion

CuB triggers OSCC pyroptosis through the STAT3/caspase-3/GSDME pathway, enhancing peritumoural CD8+ T cell infiltration and offering a novel strategy to boost tumour immunotherapy efficacy.

Graphical abstract

Image, graphical abstract

Graphic Abstract: Following the injection of CuB into mice with OSCC, CuB suppresses STAT3 expression in tumour cells, leading to the activation of pro-caspase-3. This activation, in turn, triggers the release of GSDME, which forms GSDME-N and perforates the cytosolic membrane, inducing pyroptosis. Concurrently, the cells release inflammatory mediators and cytokines, such as IL-1β and IL-18, which elevate the levels of CD8+ T cells within the tumour microenvironment, thereby promoting tumour suppression.

Introduction

Pyroptosis, a form of programmed cell death mediated by the Gasdermins (GSDM)family [1], is initiated by caspase activation via inflammatory vesicles. These activated caspases cleave Gasdermins D (GSDMD) or Gasdermins E (GSDME), generating N-terminal fragments (GSDMD-NT/GSDME-NT) with pore-forming activity, which drive pyroptosis. This process results in cell swelling, plasma membrane rupture, and the release of intracellular pro-inflammatory factors, ultimately inducing inflammatory programmed cell death [1,2]. In recent years, pyroptosis has gained prominence in tumour research and is closely associated with the development many types of tumours [3]. By inducing activating pyroptosis in tumour cells, their proliferation can be inhibited. Furthermore, pyroptosis promotes tumour immune function by releasing inflammatory mediators and reshaping the tumour immune microenvironment (TIME), aiding anti-tumour immunity [[3], [4], [5]]. "Cold tumours" exhibit immunosuppression, but pyroptosis can activate anti-tumour immunity, transforming "cold" tumours into "hot" ones, thus improving the efficacy of ICIs [4,6]. However, the mechanisms of pyroptosis in Oral squamous cell carcinoma (OSCC) and its role in tumour therapy have not yet been clarified.

OSCC is the sixth most common cancer globally, with a five-year survival rate below 50 % post-diagnosis[7,8]. Surgical treatment and radiotherapy remain important in the treatment of OSCC [9]. Immune checkpoint inhibitors (ICIs) have also been introduced to treat OSCC, significantly improving the five-year survival rates [10]. However, low clinical responses and acquired resistance have limited their widespread use [11]. Despite the emergence of novel treatments and techniques for OSCC, the five-year survival rate remains suboptimal. Therefore, exploring new therapeutic options and improving the efficacy of tumourimmunotherapy is crucial for prolonging the survival time and reducing side effects in OSCC patients.

The tumour immune environment plays a crucial role in tumour progression. In recent years, research has increasingly focused on activating pyroptosis in OSCC, and many studies have demonstrated the anticancer properties of natural compounds, particularly in their ability to induce pyroptosis, providing new insights into the development of antitumour drugs [12,13]. Cucurbitacin B (CuB), a tetracyclic triterpenoid derived from Cucurbitaceae plants such as squash and cucumber, has garnered attention for its potent antitumour activity [[14], [15], [16], [17]] and its ability to induce tumour cell pyroptosis, particularly in lung cancer [18]. However, the mechanism underlying pyroptosis in OSCC remains unclear.

This study found that CuB can inhibit tumour progression, activate pyroptosis, and increase the infiltration of CD8+ T cells around the tumour. Through bioinformatics analysis, we also determined that STAT3 is the target of CuB for activating pyroptosis via the caspase-3/GSDME pathway in OSCC, thus clarifying the mechanism and providing a new approach to improve the efficacy of tumour immunotherapy.

Experimental section

Cell lines, reagents, and antibodies

Human oral keratinocytes (HOK) (Sciencell) and human tongue squamous carcinoma cell line (HSC-3) (ATCC) were cultured in DMEM medium (Gibco) with 10 % fetal bovine serum (FBS, Gibco), penicillin (100 IU/ml) and streptomycin (100 µg/ml) (meilunbio), respectively. Human tongue squamous carcinoma cell line (SCC-9) is cultured in F12 medium (Gibco) with 10 % FBS, penicillin (100 IU/ml), and streptomycin (100 µg/ml). All cells were grown in anincubator at 37 °C with 5 % CO2,with the medium replaced every 2-3 days.All experiments were conducted with mycoplasma-free cells.

Cucurbitacin B (purity ≥98 %) (meilunbio) powder dissolved in dimethyl sulfoxide (DMSO, MCE), Cell Proliferation and Toxicity Assay Kit CCK-8 (Boster Bio), Apoptosis and Necrosis Detection Kit (Hoechst33342/PI, Beyotime), Reactive Oxygen Detection Kit (Beyotime), Apoptosis Detection Kit (Beyotime), Crystalline Violet Dye (Beyotime), DAPI(Boster Bio), Phalloidin (Solarbio), DAB Kit (Boster Bio),The caspase-3 inhibitor Ac-DEVD-CHO (MCE), and the ROS inhibitor Acetylcysteine, NAC (MCE). Antibodies: Anti-Phospho-STAT3, Anti-STAT3, Anti-active+pro caspase-3(HUABIO), GSDEM (proteintech), Cleaved GSDME, and GSDMD (ABcolonal).

Microscopic images

HSC-3 and SCC-9 cells were inoculated in 6-well plates at a density of 2 × 105 cells/well. After 24 hours later, the medium was replaced with fresh, medium containing different concentrations of CuB, and the cells were treated for 24 hours. Static bright-field images of the cells were captured using an Olympus microscope at room temperature.

Cell proliferation and toxicity

HOK, HSC-3, and SCC-9 cells were inoculated in 96-well plates at a density of 5 × 103 cells/well for 24 hours. After treatment with CuB for 24, 48or72 hours, the medium was replaced with a medium containing CCK-8 reagent (1:10 dilutions). The OD value was measured after 90 minutes with an enzyme marker (Molecular Device).

qRT-PCR

Total RNA was extracted from HSC-3 and SCC-9 cells using Trizol (Mei5bio, CN) reagent and then reverse transcribed to cDNA. The expression levels of relevant genes were amplified using SYBR Green (Solarbio). Quantitative PCR detection system (Thermo Fisher) was used. Relative gene expression levels were calculated using the 2-ΔΔCT method. The gene sequences: GSDME:F: CACACTGTGCCACTTGCTTC; R: GTCAGCTGAGGCAAACAAGC; caspase-3:F: CTCTGGTTTTCGGTGGGTGT;R: CTTCCATGTATGATCTTTGGTTCC; STAT3:F: CTGCCCCATACCTGAAGACC; R: TCCTCACATGGGGGAGGTAG; β-actin: F: GGCACCCAGCACAATGAAG; R: CCGATCCACACGGAGTACTTG.

Colony formation

HSC-3 and SCC-9 cells were inoculated in 6-well plates at a density of 2 × 103 cells/well for overnight growth, then treated with CuB for 24 hours, and then incubated with fresh medium for two weeks. Colonies were fixed with 4 % paraformaldehyde and stained with 0.1 % crystal violet.

Cell migration

HSC-3 and SCC-9 cells were seeded in 6-well plates at a density of 2 × 105 cells/ well for overnight growth. A line was drawn perpendicular to the 6-well plates. Different concentrations of CuB-containing medium were added according to the grouping. Photographs were taken with a microscope, and the 6-well plates were then incubated. Pictures were retaken after 24 hours to record the results.

Cell death detection with flow cytometry

Cell death induced by CuB treatment was examined using the Annexin V-FITC/PI apoptosis detection kit. HSC-3 and SCC-9 cells were seeded in 6-well plates at a density of 2 × 105 cells/ well for overnight growth. After CuB treatment for 24 h, the cells were harvested, washed with cold PBS, and suspended in 1 × binding buffer. The cells were stained with Annexin V-FITC(5 μM) and PI (5 μM) for 15 min at room temperature in the dark, then detected by flow cytometry (Agilent Technologies), andanalyzed using FlowJo (10.8.1) analysis software.

Immunofluorescence

Cells were seeded at a density of 4 × 104 cells on a confocal culture dish and treated with CuB for 24 h. The medium was removed, and the cells were fixed for 30 min using 4 % paraformaldehyde and washed with PBS. Then, cells were permeabilized with 0.2 % Triton X-100 for 15 min and blocked with 5 % BSA for 1 h. After labeling with a primary antibody (1:100 dilutions) overnight at 4 °C, cells were incubated with secondary antibodies (Alexa Fluor 488, 1:500 di­lutions) for 1 h. Afterward, the cells were washed with PBS and stained with DAPI for 5 min, followed by washes with PBS twice. The cells were visualized under a confocal laser scanning microscope (Leica, Wetzlar, Germany).

Staining with phalloidin

Cells were seeded at a density of 4 × 104 cells on a confocal culture dish treated with CuB for 24 h and washed with PBS two to three times. After the cells were attached to the wall, the culture medium was discarded and washed with PBS 2-3 times. Take the phalloidin (100 nM, 200 µL)and incubate for 30 min at room temperature, avoiding light, and then capture the fluorescence image under a laser scanning confocal microscopy.

Western Blot

Cells were centrifuged, or the tumour tissues were cut and then lysed by ultrasound. Cells or tissues were lysed using RIPA lysis buffer (PH 7.4, containing 1 mM PMSF). Centrifuge at 12000 g for 10 min at 4 °C, the supernatant was transferred to centrifuge tubes. Protein concentration was assayed using the BCA method, and proteins were separated by SDS-PAGE electrophoresis. The proteins were transferred toNC membrane(0.2 μm), blocked with skimmed milk powder prepared with 5 % TBS+Tween (TBST) buffer solution (pH 7.5, containing 0.05 % Tween) at room temperature for 1 h and then incubated with primary antibody (1:1000 dilutions) overnight. The next day, the blot was visualized with HRP-conjugated secondary antibodies (1:8000 dilutions). ECL luminescent solution was added to the membrane to develop the color, and all proteins were visualized with a western blotting substrate. The gray-scale values of related proteins were quantified by Image J (1.8.0).

Transmission electron microscopy

OSCC cells were inoculated in 6-well plates at a density of 2 × 105 cells/well. and treated with CuB for 24 h. The cells were collected, fixed with adding pre-cooled 4 % electron microscope fixative, washed, and fixed with 1 % osmic acid at 4 °C for 1.5 h. The cells were gradient dehydrated in ethanol-acetone solution, embedded in 100 % acetone resin for 24 h, stained with heavy metal, ultrathinly sectioned, and observed under a microscope (Hitachi HT7700, Tokyo, Japan).

ROS

The production of ROS was assessed using the fluorescent probe 2′,7′-dichlorofluorescein diacetate (DCFH-DA). HSC3 and SCC-9 cells were seeded in 6-well plates at 2 × 105 cells/ well density for overnight growth. The next day, the cells were treated with CuB for 24 h and stained with DCFH-DA probes (5 µM) for 30 min. The medium was removed, and the plate was washed with PBS twice; the cells were then collected and detected by flow cytometry (Agilent Technologies), and data were analyzed using FlowJo analysis software.

Plasmid construction and transfection

The full-length human STAT3 Cdna (SinoBiological) was cloned into the pcDNA3.1 (+) vector using EcoRI and XhoI, and the construct was verified by sequencing.HSC3 and SCC9 cells were inoculated in 6-well plates at a density of 2 × 105 cells/well. cells were transfected with 2.5 µg STAT3-pcDNA3.1 (+) or empty vector using Lipofectamine 3000 in Opti-MEM. After 6 hours, the medium was replaced with fresh DMEM, and cells were incubated for 48 hours, and then the cells and proteins were collected for further experiments.

Enzyme-linked immunosorbent assay (ELISA)

HSC3 and SCC9 cells were inoculated in 6-well plates at a density of 2 × 105 cells/well. After 24 h later, the medium was replaced with fresh medium containing different concentrations of CuB, and the supernatant was collected after treating the cells for 24 h. Optical densities were measured at 450 nm, and the amounts of IL-1β (Jiangsu Meimian Industrial) and IL-18 (Jiangsu Meimian Industrial) were calculated based on the standard curves prepared using recombinant proteins.

Bioinformatics analysis

Transcriptome data for Oral Squamous Cell Carcinoma were screened from The Cancer Genome Atlas (TCGA) public dataset: the dataset samples were from Homo sapiens; the dataset contains both tumour and normal samples; the dataset contains more than 20 samples. Transcriptomic data and clinical information were downloaded for 503 primary OSCC tumours and 44 adjacent normal tissues. Pyroptosis genes were obtained by literature search. Differentially expressed genes (DEGs) were identified for their co-intersections using the R language limma software package revealing potential target genes associated with pyroptosis in oral squamous carcinoma. The selection thresholds for DEGs in this study included corrected P < 0.05 and |log2FC| > 2. DEGs were categorized as up- or down-regulated based on logFC values.

In combination with disease databases, including the Drugbank database (https://www.drugbank.ca/), the DisGeNET database (https://www.disgenet.org/home/), the GeneCards database (https://www.genecards. org/), OMIM database (https://omim.org/), "Oral squamous cell carcinoma" as the keyword to obtain disease-related targets. Compound databases SwissTargetPrediction (http://swisstargetprediction.ch), TCMSP (https://old.tcmsp-e.com/tcmsp.php), and other databases were used to identify the targets of CuB. The results were combined, retaining one duplicate target to generate a Venn diagram using the Venn online tool.

To gain insight into OSCC gene functions and signalling pathways associated with pyroptosis, the Metascape (https://www.metascape.org/) tool, was used for GO analysis to identify enriched cellular components (CCs), biological processes (BPs), molecular functions (MFs), and KEGGanalysis of the core pathways to explorepyroptosis's role in OSCC occurrence, as well as biological functions and signalling pathway mechanisms.

Docking

Docking aims to discover new drug candidates effiiciently and cost-effectively using computational tools. Dockingobserves the ligand bound to the receptor and predicts the interactions and energies between the receptor and ligand. Docking of CuB with STAT3 (PDB ID: 6NJS) was carried out using Veen 1.1.2 software, and the CuB/STAT3 interaction was visually analyzed using Discovery Studio.

In vivo experiments

Female, 6-8 weeks old, 18-22 g wild-type C57BL / 6 mice were purchased from the Experimental Animal Centre of Shanxi Medical University, with free access to food and water, at a temperature of (22 ± 2) °C and humidity of (50 ± 5) %. OSCC was induced by adding 50 μg/ mL of 4-nitroquinoline N -oxide (4NQO) to the drinking water, and allanimals underwent a whole mouth examination under anesthesia every two weekst. They were weighed, recorded weekly, and the data was recorded and plotted on a line graph using GraphPad Prism9.

CuB (0.25 mg/kg or 0.5 mg/kg) was injected intraperitoneally daily for 28 days, after which the mice were executed, the tongue tissuesexcised, and images taken. The area of tongue lesions in mice: the areas of lesions visible to the naked eye and the total area of the tongue were counted in IMAGE J 1.52p, respectively, and the formula was calculated as follows: Percentage of lesion area = area of lesion/total area of the tongue. The tongue tissues were divided into three equal parts, one fixed-embedded for HEstaining, one for flow cytometry of peritumour infiltration of CD3 and CD8+ T-cells, and one frozen at -80 °C for Western Blot.

Hematoxylin and eosin (HE) staining

The mouse tongue, heart, liver, spleen, lung, and kidney tissues were fixed, and paraffin (Sigma) was embedded and sectioned. After baking at 60 °C for 12 h, the segments were dewaxed to water. The sections were stained with hematoxylin (Abiowell) and eosin (Abiowell). Finally, the cells were dehydrated, sealed, and examined under a microscope (Olympus).

Immunohistochemical (IHC) staining

4 μm sections were prepared from paraffin-embedded samples of patients. Endogenous peroxidase activity was quenched after deparaffinization, rehydration, and antigen repair. Cells were incubated with primary antibody overnight at 4 °C. IHC staining was then achieved by incubation with secondary antibody and staining with a DAB kit.

CD3 and CD8+ T cell infiltration

The collected fresh mouse tongue tissue was cut into 1-2 mm3 particles with ophthalmic scissors and ground into homogenate. Thirty times the amount of tissue was added with trypsin (containing 0.02 % EDTA) and digested at 37 °C, then filtered through a strainer and centrifuged to discard the supernatant, The cells were then resuspended using cell staining buffer (Cell Staining Buffer, Elabscience). Cells were resuspended with Cell Staining Buffer (Elabscience) to 1 × 107 cells/mL, and fluorescent antibodies against PE Anti-Mouse CD3 Antibody (Elabscience) and APC Anti-Mouse CD8 Antibody (Elabscience) were added. The cells were incubated at 4 °C for 30 min under low light conditions, resuspended after centrifugation, and then analyzed by flow cytometry.

Statistical methods

In this study, we used t-test and one-way ANOVA to compare the significance of differences between the CuB treatment and control groups. Results are expressed as mean ± standard error. P < 0.05 was considered significantly different (95 % confidence level). At least three independent replications of each experiment were performed.

Result

CuB inhibits OSCC cell activity and inducespyroptosis

To explore whether CuB affects cell viability and proliferation in OSCC, we treated HOK, and OSCC cells with different concentrations of CuB (structural formula Fig. 1a, obtained from PubChem) for 24 h, and found that the inhibitory effect of CuB on cancer cells was significantly higher than that on HOK cells at the same concentration (Figure S1a); A cytotoxicity assay showed that CuB inhibited cell viability (Fig. 1b & Figure S1b) in a concentration-dependent manner; significantly reducing viability. Colony formation and cell scratch assays showed that the proliferation and migration ability of OSCC cells was inhibited with increasing CuB concentration (Fig. 1c&d) (Figure S1c&d).

Fig. 1.

Fig 1

CuB inhibits OSCC cell proliferation and activates pyroptosis.The structural formula of CuB (a). Cell viability (%) and IC50 of SCC9 cells after treatment with different concentrations of CuB for 24 h (b). Colony number of SCC9 treated with different concentrations of CuB for 24 h (c).The migration rate of SCC9 treated with different concentrations of CuB for 24 h(d). Changes in cell morphology of SCC9 cells after treatment with CuB for 24 h. Scale bar: 50 μm (e). Transmission electron microscopy images visualizing the cell membrane pore formation. (red arrows indicating cell membrane pore formation) (f). Flow cytometry detection of cell death in SCC9 after 24 hours of CuB treatment (g&h). Laser confocal observation of cytoskeletal changes in SCC9 treated with different concentrations of CuB for 24 hours (DAPI: blue; Phalloidin: red), scale bar: 50 μm (i). Data are represented as mean ± SD (n = 3). Compared with the 0 nM group, ns is not significant, *Р < 0.05, **Р < 0.01, ***Р < 0.001, ****Р < 0.0001.

To clarify the type of CuB-induced cell death, we observed it under a microscope. OSCC cells exhibited swelling, rupture and cellular debris formation after CuB treatment for 24 h (Fig. 1e & Figure S1e). Transmission electron microscopy revealed cell membrane rupture and hole formation, characteristic of pyroptosis (Fig. 1f & Figure S1f); Annexin V and PI double staining detected by flow cytometry demonstrated that the cells underwent necrotic cell death. (Fig. 1g&h) (Figure S1g&h);

Next, we explored the potential mechanism of CuB-induced cellular pyroptosis. Phalloidin is widely used to study F-actin in cells [19], and cytoskeletal disruption a crucial manifestation of pyroptosis [20,21],can be observed after staining CuB-induced cytoskeletal disruption and loss of normal cell morphology, and preventing Phalloidin from binding to F-actin (Fig. 1i & Figure S1i). Meanwhile, CuB-induced cell death resulted in the release of immunostimulators IL-1β and IL-18 in the supernatants of the tumour cells (Fig. 7a&b) (Figure S5a&b).

Fig. 7.

Fig 7

CuB increases ROS levels and induces pyroptosisvia STAT3/caspase-3/GSDME in vivo. ELISA detection of IL-1β and IL-18 in cell supernatants after SCC9treatment with CuB and Ac-DEVD-CHO (a&b). Flow cytometry detection of cell ROS levels after CuB and NAC (10 mM, 2 h) treatment (c). Western blot detection of GSDME and GSDME-N protein levels in cells after CuB and NAC treatment. Data are represented as mean±SD (n = 3) (d&e). Western blot detection of GSDME, GSDME-N, pro-caspase-3, STAT3 and p-STAT3 in vivo (f&g). Data are represented as mean ± SD(n = 4), with three technical replicates for each group within the same experiment. Compared with the 4NQO group ns is not significant, * indicates *Р < 0.05, **Р < 0.01, ***Р < 0.001, ****Р < 0.0001.

Pyroptosis plays a role in T cell activation in OSCC

Combining the above conclusions, we found that CuB induces OSCC cell pyroptosis. To clarify the possible role of pyroptosis in OSCC, we obtained differentially expressed genes (DEGs) between OSCC and pyroptosis (Fig. 2a). The differentiated genes were enriched in OSCC through GO (Fig. 2b) and KEGG (Fig. 2d) analyses, revealing that pyroptosis-related differential gene functions in OSCC were enriched in processes such as T cell activation and Th cell differentiation.

Fig. 2.

Fig 2

Bioinformatics analysis of the role of pyroptosis in OSCC.Heatmap of genes related to pyroptosis differentially expressed in normal tissues and OSCC in the TCGA database (a). GO enrichment analysis of differential genes (b). KEGG pathway enrichment analysis of differential genes (c). ns is not significant, *Р < 0.05, **Р < 0.01, ***Р < 0.001, ****Р < 0.0001.

CuB inhibits tumour progression and increases peritumoral CD8+ T cell infiltration in OSCC mice in vivo

Given CuB’s significant anti-tumour ability in vitro and the bioinformatics data, we evaluated its anti-tumour efficacy and effect on T cells in a mouse model of OSCC. The model was constructed in C57BL/6 mice using the 4NQO drinking water method (Fig 3a), with 4NQO formulated into 50 μg/mL drinking water [22]. After 16 weeks of continuous administration, CuB (0.25 mg/kg or 0.5 mg/kg, i.p.) was given daily for 28 days. Compared to the control group, the CuB group’s body weight reduction was smaller than the control group (Fig. 3b), and the area of tongue lesions was significantly improved (Fig. 3c&d). HE staining showed that the epithelium of the tongue dorsal mucosa in the 4NQO group displayed carcinoma and severe epithelial hyperplasia, while in the CuB group, mild and moderate epithelial hyperplasia dominated, proving that CuB effectively suppressed the malignant progression of OSCC. Most of the 4NQO group had carcinoma and severe epithelial hyperplasia, while the CuB group mainly had mild and moderate epithelial hyperplasia, with no invasion of carcinoma nests and the basilar membrane breakthrough (Figure S2a&b). HE staining on the hearts, livers, spleens, lungs and kidneys of the mice indicated no apparent toxicity from CuB to other organs (Figure S2c&d).

Fig. 3.

Fig 3

CuB inhibits tumours in OSCC mice. Construction of an OSCC mouse model using the 4NQO (50 μg/mL) drinking method(a). Body weight changes of mice in the 4NQO group, 0.25 mg/kg CuB group and 0.5 mg/kg CuB group (b). Tongue lesions of mice in 4NQO, 0.25 mg/kg CuB and 0.5 mg/kg CuB groups (c&d). Flow cytometry to detect CD3 and CD8+ T cell levels infiltrating the tumour and its surrounding tissues (e&f). Data are represented as mean±SD (n = 4). Compared with 4NQO group, ns is not significant, *indicates *Р < 0.05, **Р < 0.01, ***Р < 0.001, ****Р < 0.0001.

Substantial evidence suggests that pyroptosis affects tumour immune function. To validate GO and KEGG analyses and further confirm the role of CuB-induced pyroptosis in vivo, we detected the levels of CD3 and CD8+ T cells infiltrate around the mice’stumour tissues using flow cytometry after grinding the tissues into a single-cell suspension (Fig. 3e&f).

STAT3 is a target of CuB for inducing OSCC pyroptosis

To clarify the relationship between CuB, OSCC and pyroptosis, we deeply explored the mechanism of CuB-induced pyroptosis in OSCC. We obtained 3335 OSCC-related targets from GeneCards, OMIM and DisGeNET, 286 CuB targets from SwissTargetPrediction, TCMSP and other databases, and 51 pyroptosis genes from the literature search. A Venn diagram was constructed to identify the common action targets (Fig. 4a), revealing that STAT3 is the common intersection of all three.

Fig. 4.

Fig 4

Targets of CuB for inducing pyroptosis in OSCC. Venn diagram showing the intersection of CuB-interacting, OSCC, and pyroptosis targets(a). The binding mode of STAT3 protein with Cucurbitacin-B (b). The 3D structure of the complex (1). The 3D detail binding mode of Cucurbitacin-B with STAT3 protein (2). The electrostatic surface of STAT3 protein (3). Differential expression of STAT3 in OSCC tumour tissue and normal tissue (c). Immunohistochemical staining results of STAT3 in oral normal epithelial tissues and oral squamous cell carcinoma tissues (n = 10). Scale bar, 100 μm. (d) ns is not significant, *indicates *Р < 0.05, **Р < 0.01, ***Р < 0.001, ****Р < 0.0001.

We further analyzed the mode of action of CuB and STAT3 through molecular docking. The structure of CuB was obtained from the PubChem database, and the protein structure of STAT3 (PDB ID: 6NJS) was obtained from the RCSB database (https://www.rcsb.org/structure/6NJS). The molecular docking results showed that CuB binds well to STAT3 with a binding energy of -7.65 kcal/mol. Amino acids SER-611, SER-613, LYS-591, ARG-595, and GLN-633 of the protein pocket form strong hydrogen bonding interactions, and the compound is also able to interact with PRO-639, THR-620, ILE-620, and ILE-633, THR-620, ILE-634, THR-632 amino acids. These interactions can effectively promote the formation of stable complexes between small molecules and proteins, and there is a good correlation with protein targets (Fig. 4b).

We analyzed the expression of STAT3 in patients with OSCC through the TCGA database, finding it significantly upregulated in tumour tissues (Fig. 4c). Immunohistochemical staining of OSCC patients’ tissues and surrounding normal tissues from the Oral Stomatology Hospital of Shanxi Medical University showed STAT3 expression levels higher in normal tissues (Fig. 4d), demonstrating that STAT3 may be a potential target for CuB to induce pyroptosis in OSCC.

CuB induces pyroptosisin OSCC via the STATA3/caspase-3/GSDME pathway

While caspase-3 has traditionally been associated with apoptosis, recent evidence shows that activated caspase-3 cleaves GSDME, releasing the pore-forming active GSDME-N-terminus [4], which leads to cell swelling, membrane rupture, and DAMP (Damage Associated Molecular Patterns) release furtherinducing pyroptosis [1]. Previous studies have shown that GSDMD is also closely related to pyroptosis [23]. Therefore, upon examining OSCC cell lines treated with different concentrations of CuB, we found no significant difference in GSDMD expression (Figure S3a&b). Immunofluorescence staining showed that GSDME-N expression increased and GSDME levels decreased after adding CuB (Fig. 5a&b). Detection of mRNA levels of GSDME and caspase-3 in CuB-treated cells revealed that activation of caspase-3 was accompanied by down-regulation of GSDME (Fig. 5c), and western blot results showed the same results (Fig. 5d&e, Figure S3c-j).

Fig. 5.

Fig 5

CuB induces pyroptosis viathe STAT3/caspase-3/GSDME pathway.Laser confocal observation of GSDME and GSDME-N expression in SCC9 treated with CuB for 24 hours. Scale bar, 50 μm (a&b). mRNA levels of GSDME and caspase-3 after CuB treatment of SCC9 (c). The expression of GSDME, GSDME-N, and pro-caspase-3 was detected by western blot (d&e). mRNA levels of STAT3 after CuB treatment (f). Western blot detection of STAT3 and p-STAT3 expression (g&h). mRNA levels of STAT3 and GSDME after CuB and Ac-DEVD-CHO (10 μM, 30 min.) treatment of SCC9 cells (i). Data are represented as mean ± SD (n = 3). Compared with the 0 nM group, ns is not significant, *indicates *Р < 0.05, **Р < 0.01, ***Р < 0.001, ****Р < 0.0001.

According to our molecular docking results, STAT3 may be a target of CuB to induce pyroptosis in OSCC. To verify this, we examined the STAT3 mRNA level in the cells revealing a concentration-dependent decrease in STAT3 expression in CuB-treated cells compared to the control group (Fig. 5f), Furthermore, western blot experiments demonstrated that CuB downregulates STAT3 expression in cells and inhibits its phosphorylation level (Fig. 5g&h).

We hypothesize that CuB promotes pyroptosis by modulating the STAT3-caspase-3-GSDME signaling pathway. To further investigate this hypothesis, we overexpressed STAT3 in OSCC cells and subsequently treated the cells with CuB. Following CuB treatment, after CuB treatment, the inhibition of STAT3, caspase-3, and GSDME was partially reversed by the overexpression of STAT3 (Fig. 6a-f&h), while the expression of GSDME-N exhibited an opposite trend (Fig. 6d&g). Further studies revealed that STAT3 overexpression significantly reduced the levels of IL-1β and IL-18 in OSCC cells (Fig. 6i&j). We have also observed an interesting phenomenon, when STAT3 is overexpressed, the expression of GSDME and caspase-3, which were originally suppressed, is also upregulated (Fig. 6a-f&h). However, without CuB induction, the levels of pyroptosis products such as GSDME-N, IL-18, and IL-1β show no significant difference compared to the control group (Fig. 6d,g,i&j). All these data indicate that STAT3 is involved in CuB-induced pyroptosis in OSCC (Figure S4).

Fig. 6.

Fig 6

Overexpression of STAT3 inhibits CuB-induced OSCC pyroptosis. mRNA levels of STAT3, GSDME and caspase-3 of SCC9overexpressing STAT3 after treatment with CuB (a-c). The expression of STAT3, GSDME, GSDME-N, and pro-caspase-3 was detected by western blot in SCC9 cells overexpressing STAT3 after treatment with CuB (d&h). ELISA detection of IL-1β and IL-18 in the supernatants of SCC9 overexpressing STAT3 after treatment with CuB (i&j). Data are represented as mean ± SD (n = 3). Compared with the corresponding group, ns is not significant, *indicates *Р < 0.05, **Р < 0.01, ***Р < 0.001, ****Р < 0.0001.

Furthermore, by inhibiting caspase-3 expression, we observed that after CuB treatment, the expression of STAT3 remained unchanged, while the cleavage of GSDME-N was suppressed (Fig. 5i & Figure S3k); levels of IL-1β and IL-18 in the cell supernatants were also reversed (Fig. 7a&b & Figure S5a&b). indicating that STAT3 is located upstream of the caspase-3/GSDME signaling pathway.

CuB significantly increased ROS release from cells, but this was reversed by the ROS inhibitor, NAC (Fig. 7c & Figure S5c). NAC alsosignificantly inhibited the cleavage of GSDME (Fig. 7d&e, Figure S5d&e) .

To clarify whether CuB can induce OSCC pyroptosis in vivo, western blot assays revealed a significant upregulation of GSDME-N in the tumour tissues of CuB-injected mice, along with the activation of pro-caspase-3, indicating that CuB induces OSCC pyroptosis in vivo. STAT3 and p-STAT3 expression were also inhibited in CuB-treated mice (Fig. 7f&g).

In conclusion, CuB induces pyroptosis in OSCC via the STAT3/caspase-3/GSDME pathway both in vitro and in vivo, and ROS are also involved in CuB-mediated OSCC pyroptosis.

Discussion

In this study, we demonstrated that CuB induces pyroptosis in OSCC cells, characterized by cell swelling, membrane rupture, cytoskeletal disruption, and the release of inflammatory mediators. Bioinformatics analysis further suggested a potential link between pyroptosis and anti-tumour immunity in OSCC. In vivo, experiments revealed that CuB not only inhibited tumour progression but also promoted CD8+ T-cell infiltration in the tumour microenvironment of OSCC mice. To elucidate the mechanism of CuB-induced pyroptosis, we identified STAT3 as a common target among OSCC, pyroptosis, and CuB. Our findings indicate that CuB triggers pyroptosis in OSCC through the STAT3/caspase-3/GSDME pathway, ultimately suppressing tumour growth.

CuB, a natural compound with therapeutic potential in various cancers, effectively suppresses the proliferation and migration of SCC-9 and HSC-3 cells. The 24-hour IC50 values for SCC-9 and HSC-3 cells were determined to be 148.7 nM and 84.78 nM, respectively, highlighting its potential as a promising agent for OSCC treatment. Additionally, CuB interacts with TLR4, activates NLRP3, and promotes GSDMD-dependent pyroptosis to inhibit NSCLC [18]; It also exhibits antiproliferative effects and induces G2/M cell cycle arrest [24]. Structural modifications of CuB have yielded derivatives with potent antiproliferative activity and a wide therapeutic window [25]. A large number of studies have demonstrated the involvement of natural compounds in pyroptosis, such as tretinoin (TPL), Trichosanthin and Polyphyllin VI [[26], [27], [28]]. Thus, pyroptosis activation may be a viable suppresstumour strategy, making it crucialto explore whether CuB can suppress tumour via pyroptosis for OSCC treatment.

Pyroptosis, a form of inflammatory programmed cell death, has been increasingly implicated in cancer development and progression. It is characterized by the formation of pores in the cell membrane, which disrupts osmotic balance, induces cellular swelling, and ultimately leads to membrane rupture. We observed by light microscopy that the morphology of CuB-treated cells was swollen and rounded, transmission electron microscopy demonstrates a characteristic manifestation of pyroptosis: the appearance of cell membrane porosity, phalloidin staining shows disruption of the F-actin network and microtubules, and it was demonstrated that the disruption of F-actin was associated with the production of ROS and that these mechanisms collectively led to the pyroptosis and further promoted systemic anti-tumour immunity [5,29]; These above experiments demonstrated the occurrence of pyroptosis from a morphological point of view. Annexin V and PI double staining demonstrated that cells treated with CuB underwent necrotic cell death and that the dead cells were predominantly clustered in the region of (Annexin V+ and PI+), demonstrating disruption of cell membrane integrity; finally, we examined the release of biomarkers of pyroptosis: ELISA for IL-1β and IL-18 in cell supernatants. As cytoskeletal is a key manifestation of pyroptosis [20,21], we speculate that CuB-induced OSCC cytoskeleton disruption may related to pyroptosis. The above conditions combined demonstrate the occurrence of cellular pyroptosis in terms of cell morphology, cell membrane integrity, as well as the mode of cell death and the detection of biomarker levels after death.

Pyroptosis is a prevalent innate immune effector mechanism in vertebrates and plays a significant role in tumour biology [30,31]. Unlike other forms of cell death, pyroptosis is highly immunogenic. Inducing pyroptosis in tumour cells not only inhibits their proliferation but also alters tumour immune function and remodels the tumour immune microenvironment (TIME) [32,33]. The immunogenicity of pyroptosis is driven by multiple mechanisms, such as improving the immune environment through the release of cytokines post-pyroptosis, the production of ROS—acting as DAMPs and PAMPs—can further stimulate surrounding cells, potentially inducing pyroptosis in additional cells. Additionally, pyroptosis led to the release of IL-1β and IL-18, which inhibit CTL apoptosis in tumours, increase effector CD8+ T cells,reduce CD4+CD25+Foxp3+ T cells in the tumour microenvironment [34,35]. Bioinformatics analyses support these findings, demonstrating that pyroptosis induces tumour cell death and may reshape the peri-tumour immune environment in OSCC by releasing intracellular inflammatory factors, thereby enhancing immunotherapy outcomes.

Oral squamous cell carcinomais the most prevalent malignancy in the head and neck region, characterized by high rates of metastasis and recurrence [36,37]. Although treatment modalities have advanced significantly in recent years, particularly with the introduction of immune checkpoint inhibitors (ICIs), challenges such as low clinical response rates and acquired drug resistance have limited their efficacy [38,39]. These limitations have spurred efforts to enhance treatment outcomes by modulating the tumour immune microenvironment. In OSCC, the poor response to immunotherapy is often attributed to its classification as a “cold tumour,” which exhibits minimal T-cell infiltration [40,41]. Strategies to enhance T-cell infiltration within the tumour may therefore improve the efficacy of ICIs and broaden the applicability of immunotherapy. Studies have demonstrated that immunotherapy can increase T-cell infiltration in the tumour periphery, with the level of CD8+ T-cell infiltration being a critical determinant of survival in head and neck squamous carcinoma patients [42]. Furthermore, promoting T-cell infiltration and immune responses in solid tumours has been shown to significantly influence treatment outcomes [43,44]. Inducing pyroptosis in tumour cells releases inflammatory mediators into the tumour microenvironment, activating innate immune responses and remodelling the immune landscape to facilitate T-cell-mediated anti-tumour immunity. Therefore, pyroptosis may synergize with tumour immunotherapy to enhance therapeutic efficacy

Recent studies have shown that pyroptosis is involved in cancer development and progression, yet its role and mechanism in OSCC remains unclear. Cleavage of the GSDM family is central to pyroptosis. We investigated the molecular mechanisms underlying CuB-induced pyroptosis. We found that CuB may not regulate the expression of GSDMD protein. Therefore, we conclude that CuB does not induce pyroptosis through the caspase-1/GSDMD pathway. Meanwhile, we discovered that CuB induces pyroptosis by regulating the expression of GSDME, we proceeded to investigate how CuB affects GSDME. Through bioinformatics analysis, we identified STAT3 as a common target in OSCC, pyroptosis, and CuB. Molecular docking further supported STAT3 as a potential target for CuB-induced pyroptosis. Whether STAT3 can induce pyroptosis by regulating the expression of GSDME remains unconfirmed. Our study demonstrates that CuB functions as a STAT3 inhibitor, inducing pyroptosis and inhibiting OSCC progression.

We observed that the previously suppressive expressions of GSDME and pro-caspase-3 were partially reversed when STAT3 was overexpressed. This finding demonstrates that STAT3 can modulate the expression of GSDME and pro-caspase-3, and further supports the notion that STAT3 is positioned upstream of the caspase-3/GSDME signaling pathway. Concurrently, we noted that CuB-induced pyroptosis was not fully suppressed by STAT3 overexpression. We hypothesize that CuB may induce pyroptosis in OSCC through alternative pathways, including caspase/GSDME and NLRP3 activation, and that cytokine release during pyroptosis amplifies the signaling, leading to the observed outcome.

In GSDME-expressing cancers, inflammatory signals induced by GSDME promote the infiltration of NK and CD8+ T cells into the TME, thereby inhibiting tumour growth and enhancing anti-tumour immunity through the modulation of immune cell recruitment and function [45,46]. STAT3 plays a role in pyroptosis across various tumours. For instance, ginsenoside Rh3 induces pyroptosis in colorectal cancer cells via the STAT3/p53/NRF2 axis [47], and the bio-nanomedicine STAT3 inhibitor MPNP synergizes with lysosomal viruses to activate pyroptosis in tumour cells and enhance anti-tumour immunity [48].

Previous studies show thatinflammasome activation generates mitochondrial ROS and induces pyroptosis, while pyroptosis accelerates mitochondrial membrane permeabilization, enhancing pyroptosis [[49], [50], [51]]. Our study demonstrates that CuB also causes ROS production [52], corroborating this conclusion. Therefore, we believe CuB-induced ROS production may be involved in pyroptosis, which was further confirmed using the ROS inhibitor NAC.

In this study, an animal model of OSCC was induced using the 4NQO drinking method, which is a recognized protocol for inducing animal models of OSCC [53]. In our research, after 16 weeks, the tongue showed visible swelling, and its dorsum was rough with proliferation, resembling cauliflower pattern, histopathologically identified as severe epithelial anomalous hyperplasia, with invasive tumour growth in individual cases. Intraperitoneal injection of CuB at 0.25 mg/kg and 0.5 mg/kg inhibited tumour progression in both cases. Based on the clinical and pathological manifestations of the tongue, CuB at 0.5 mg/kg had a better inhibitory effect on OSCC than the 0.25 mg/kg concentration group. Weight loss is considered to be an important manifestation of the cachexia stage of tumours, leading to death in patients with terminal stages of cancer [54]. The use of CuB delays the trend of weight loss in animals and is expected to prolong the survival of tumour-bearing animals. Our study found that CuB had good anticancer activity without significant toxicity to organs such as the heart, liver, spleen, lungs, and kidneys, making it a safe and potential drug for treating OSCC. Based on the analysis of the ratio of the area of the tumour to the area of the tongue, we found that CuB could significantly reduce the area of the tumour, demonstrating a good anti-tumour effect.

By observing the level of infiltrated T-cells around the tumour, CuB increased the number of CD3 and CD8+ T-cells around the tumour in mice, potentially changing the TIME of OSCC and exerting a robust anti-tumour effect. With this study as a basis, in future studies, we will be able to visualize the recruitment of CuB in tumours and its effects more intuitively through better and more precise dosing.

Many natural compounds exhibit immunomodulatory properties [55]; however, the potential of CuB to modulate immune function in OSCC remains unexplored. Our study demonstrates that CuB inhibits OSCC progression by inducing pyroptosis, enhancing peritumoural T-cell infiltration, and improving the peritumoural immune microenvironment, while showing no significant toxicity to normal organs. These findings not only fill a critical gap but also provide a foundation for future exploration of the immunomodulatory effects of other natural compounds.

Through cellular and animal experiments combined with bioinformatic analyses, we have elucidated the mechanism of CuB-induced pyroptosis in OSCC and its impact on peritumoural infiltrating CD8+ T cells. Future research could focus on the roles of inflammatory mediators and cytokines in the TIME following CuB-induced pyroptosis, as well as the potential synergy between pyroptosis and immunotherapy in tumour suppression. Notably, recent studies have highlighted the use of nanomaterials, oncolytic viruses, carbon dots, and other carriers to induce pyroptosis and enhance anti-tumour immunity [56,57]. Pyroptosis thus serves as a bridge connecting chemotherapeutic drugs, emerging materials, viruses, radiotherapy, and tumour immunotherapy, expanding the scope of immunotherapy and offering new avenues for improving its efficacy and identifying novel therapeutic targets.

Conclusion

This study demonstrates that CuB inhibits tumour progression and activates pyroptosis both in vitro and in vivo, leading to increased infiltration of CD8+ T cells in the peritumoural region. Through bioinformatics analysis, we further revealed that CuB induces pyroptosis via the STAT3/caspase-3/GSDME pathway in OSCC. These findings not only elucidate the mechanism of CuB-induced pyroptosis but also provide a novel conceptual framework for enhancing the efficacy of tumour immunotherapy.

Ethicsapproval and consent to participate

All animal experiments were conducted according to protocols approved by the Animal Ethics Committee of Shanxi Medical University (Ethics Serial No.2023-050). All human experiments were approved by the Medical Ethics Committee of the Stomatological Hospital of Shanxi Medical University (Ethics Serial No. 20125LL006).

Consent for publication

All authors of the manuscript have read and agreed to its content and are accountable for all aspects of the accuracy and integrity of the manuscript in accordance with ICMJE criteria.

Funding

This work was supported by the Fundamental Research Program of Shanxi Province (Grant No. 202203021212379) and Shanxi Chinese Medicine Administration (Grant No. 2024ZYYC072) and the Shanxi Provincial Basic Research Program (Grant No. 202403021221153).

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

CRediT authorship contribution statement

Xin Chen: Writing – review & editing, Writing – original draft, Investigation, Formal analysis, Conceptualization. Mengyuan Yang: Writing – review & editing, Investigation, Formal analysis, Conceptualization. Heng Zhang: Writing – original draft, Investigation, Formal analysis. Yajun Wang: Methodology. Wenpeng Yan: Funding acquisition. Chen Cheng: Methodology. Rongrong Guo: Writing – review & editing. Jiawei Chai: Methodology. YaHsin Zheng: Writing – review & editing. Fang Zhang: Supervision, Resources, Funding acquisition.

Declaration of competing interest

The authors declare the following financial interests/personal relationships which may be considered as potential competing interests:

Fang Zhang reports financial support was provided by Shanxi Chinese Medicine Administration. Wenpeng Yan reports financial support was provided by the Fundamental Research Program of Shanxi Province. If there are other authors, they declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgments

We appreciate all the patients for their outstanding contribution.

Footnotes

Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.tranon.2025.102422.

Appendix. Supplementary materials

mmc1.docx (344.2KB, docx)
mmc2.docx (1.2MB, docx)
mmc3.docx (257.7KB, docx)
mmc4.docx (188KB, docx)
mmc5.docx (154.8KB, docx)
mmc6.xls (212KB, xls)

References

  • 1.Shi J., Zhao Y., Wang K., Shi X., Wang Y., Huang H., Zhuang Y., Cai T., Wang F., Shao F. Cleavage of GSDMD by inflammatory caspases determines pyroptotic cell death. Nature[J] 2015;526(7575):660–665. doi: 10.1038/nature15514. [DOI] [PubMed] [Google Scholar]
  • 2.Wang Y., Gao W., Shi X., Ding J., Liu W., He H., Wang K., Shao F. Chemotherapy drugs induce pyroptosis through caspase-3 cleavage of a gasdermin. Nature[J] 2017;547(7661):99–103. doi: 10.1038/nature22393. [DOI] [PubMed] [Google Scholar]
  • 3.Loveless R., Bloomquist R., Teng Y. Pyroptosis at the forefront of anticancer immunity. J. Exp. Clin. Cancer Res.[J] 2021;40(1):264. doi: 10.1186/s13046-021-02065-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Wang Q., Wang Y., Ding J., Wang C., Zhou X., Gao W., Huang H., Shao F., Liu Z. A bioorthogonal system reveals antitumour immune function of pyroptosis. Nature[J] 2020;579(7799):421–426. doi: 10.1038/s41586-020-2079-1. [DOI] [PubMed] [Google Scholar]
  • 5.Mohanty A., Mohapatra A., Yang W., Choi S., Sundaram A., Jeong Y.Y., Lee C.M., Seo J., Park I.K. Programable prodrug nanomodulator targets tumor redox homeostasis imbalance to amplify disulfidptosis and immunogenic pyroptosis for Breast tumor immunotherapy. Adv. Heal. Mater.[J] 2025 doi: 10.1002/adhm.202500272. e2500272. [DOI] [PubMed] [Google Scholar]
  • 6.Liu Y.T., Sun Z.J. Turning cold tumors into hot tumors by improving T-cell infiltration. Theranostics[J] 2021;11(11):5365–5386. doi: 10.7150/thno.58390. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Siegel R.L., Miller K.D., Wagle N.S., Jemal A. Cancer statistics, 2023. CA Cancer J. Clin.[J] 2023;73(1):17–48. doi: 10.3322/caac.21763. [DOI] [PubMed] [Google Scholar]
  • 8.Guha N., Warnakulasuriya S., Vlaanderen J., Straif K. Betel quid chewing and the risk of oral and oropharyngeal cancers: a meta-analysis with implications for cancer control. Int. J. Cancer[J] 2014;135(6):1433–1443. doi: 10.1002/ijc.28643. [DOI] [PubMed] [Google Scholar]
  • 9.Cooper J.S., Pajak T.F., Forastiere A.A., Jacobs J., Campbell B.H., Saxman S.B., Kish J.A., Kim H.E., Cmelak A.J., Rotman M., Machtay M., Ensley J.F., Chao K.S.C., Schultz C.J., Lee N., Fu K.K. Postoperative concurrent radiotherapy and chemotherapy for high-risk squamous-cell carcinoma of the head and neck. N. Engl. J. Med. 2004;350(19):1937–1944. doi: 10.1056/NEJMoa032646. [DOI] [PubMed] [Google Scholar]
  • 10.Bauml J., Seiwert T.Y., Pfister D.G., Worden F., Liu S.V., Gilbert J., Saba N.F., Weiss J., Wirth L., Sukari A., Kang H., Gibson M.K., Massarelli E., Powell S., Meister A., Shu X., Cheng J.D., Haddad R. Pembrolizumab for platinum- and Cetuximab-refractory head and neck cancer: results from a single-arm, phase II study. J. Clin. Oncol.[J] 2017;35(14):1542–1549. doi: 10.1200/jco.2016.70.1524. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Lynch C., Pitroda S.P., Weichselbaum R.R. Radiotherapy, immunity, and immune checkpoint inhibitors. Lancet Oncol. [J] 2024;25(8):e352–e362. doi: 10.1016/s1470-2045(24)00075-5. [DOI] [PubMed] [Google Scholar]
  • 12.Yang P.W., Lu Z.Y., Pan Q., Chen T.T., Feng X.J., Wang S.M., Pan Y.C., Zhu M.H., Zhang S.H. MicroRNA-6809-5p mediates luteolin-induced anticancer effects against hepatoma by targeting flotillin 1. Phytomedicine[J] 2019;57:18–29. doi: 10.1016/j.phymed.2018.10.027. [DOI] [PubMed] [Google Scholar]
  • 13.Yue E., Tuguzbaeva G., Chen X., Qin Y., Li A., Sun X., Dong C., Liu Y., Yu Y., Zahra S.M., Shan Q., Jiang Y., Du Z., Bai Y. Anthocyanin is involved in the activation of pyroptosis in oral squamous cell carcinoma. Phytomedicine[J] 2019;56:286–294. doi: 10.1016/j.phymed.2018.09.223. [DOI] [PubMed] [Google Scholar]
  • 14.Jayaprakasam B., Seeram N.P., Nair M.G. Anticancer and antiinflammatory activities of cucurbitacins from Cucurbita andreana. Cancer Lett. [J] 2003;189(1):11–16. doi: 10.1016/s0304-3835(02)00497-4. [DOI] [PubMed] [Google Scholar]
  • 15.Chen J.C., Chiu M.H., Nie R.L., Cordell G.A., Qiu S.X. Cucurbitacins and cucurbitane glycosides: structures and biological activities. Nat. Prod. Rep.[J] 2005;22(3):386–399. doi: 10.1039/b418841c. [DOI] [PubMed] [Google Scholar]
  • 16.Wei J., Chen X., Li Y., Li R., Bao K., Liao L., Xie Y., Yang T., Zhu J., Mao F., Ni S., Jia R., Xu X., Li J. Cucurbitacin B-induced G2/M cell cycle arrest of conjunctival melanoma cells mediated by GRP78-FOXM1-KIF20A pathway. Acta Pharm. Sin. B[J] 2022;12(10):3861–3876. doi: 10.1016/j.apsb.2022.05.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Li Q.Z., Chen Y.Y., Liu Q.P., Feng Z.H., Zhang L., Zhang H. Cucurbitacin B suppresses hepatocellular carcinoma progression through inducing DNA damage-dependent cell cycle arrest. Phytomedicine[J] 2024;126 doi: 10.1016/j.phymed.2023.155177. [DOI] [PubMed] [Google Scholar]
  • 18.Yuan R., Zhao W., Wang Q.Q., He J., Han S., Gao H., Feng Y., Yang S. Cucurbitacin B inhibits non-small cell lung cancer in vivo and in vitro by triggering TLR4/NLRP3/GSDMD-dependent pyroptosis. Pharmacol. Res. 2021;170 doi: 10.1016/j.phrs.2021.105748. [DOI] [PubMed] [Google Scholar]
  • 19.Pospich S., Merino F., Raunser S. Structural effects and functional implications of phalloidin and jasplakinolide binding to Actin Filaments. Structure[J] 2020;28(4):437–449. doi: 10.1016/j.str.2020.01.014. e435. [DOI] [PubMed] [Google Scholar]
  • 20.Davis M.A., Fairgrieve M.R., Den Hartigh A., Yakovenko O., Duvvuri B., Lood C., Thomas W.E., Fink S.L., Gale M., Jr. Calpain drives pyroptotic vimentin cleavage, intermediate filament loss, and cell rupture that mediates immunostimulation. Proc. Natl. Acad. Sci. U. S. A.[J] 2019;116(11):5061–5070. doi: 10.1073/pnas.1818598116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Salinas R.E., Ogohara C., Thomas M.I., Shukla K.P., Miller S.I., Ko D.C. A cellular genome-wide association study reveals human variation in microtubule stability and a role in inflammatory cell death. Mol. Biol. Cell.[J] 2014;25(1):76–86. doi: 10.1091/mbc.E13-06-0294. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Nguyen K.A., DePledge L.N., Bian L., Ke Y., Samedi V., Berning A.A., Owens P., Wang X.J., Young C.D. Polymorphonuclear myeloid-derived suppressor cells and phosphatidylinositol-3 kinase gamma are critical to tobacco-mimicking oral carcinogenesis in mice. J. Immunother. Cancer[J] 2023;11(9) doi: 10.1136/jitc-2023-007110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Kujan O., van Schaijik B., Farah C.S. Immune checkpoint inhibitors in oral cavity squamous cell carcinoma and oral potentially malignant disorders: A systematic review. Cancers. 2020;12(7) doi: 10.3390/cancers12071937. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Nature MedicineWei J., Chen X., Li Y., Li R., Bao K., Liao L., Xie Y., Yang T., Zhu J., Mao F., Ni S., Jia R., Xu X., Li J. Cucurbitacin B-induced G2/M cell cycle arrest of conjunctival melanoma cells mediated by GRP78-FOXM1-KIF20A pathway. Acta Pharm. Sin. B. 2022;12(10):3861–3876. doi: 10.1016/j.apsb.2022.05.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Shang F.F., Lu Q., Lin T., Pu M., Xiao R., Liu W., Deng H., Guo H., Quan Z.S., Ding C., Shen Q.K. Discovery of Triazolyl derivatives of cucurbitacin B targeting IGF2BP1 against non-small cell lung cancer. J. Med. Chem. 2023;66(18):12931–12949. doi: 10.1021/acs.jmedchem.3c00872. [DOI] [PubMed] [Google Scholar]
  • 26.Tan Y., Xiang J., Huang Z., Wang L., Huang Y. Trichosanthin inhibits cell growth and metastasis by promoting pyroptosis in non-small cell lung cancer. J. Thorac. Dis. 2022;14(4):1193–1202. doi: 10.21037/jtd-22-282. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Teng J.F., Mei Q.B., Zhou X.G., Tang Y., Xiong R., Qiu W.Q., Pan R., Law B.Y., Wong V.K., Yu C.L., Long H.A., Xiao X.L., Zhang F., Wu J.M., Qin D.L., Wu A.G. Polyphyllin VI induces caspase-1-mediated pyroptosis via the induction of ROS/NF-κB/NLRP3/GSDMD signal axis in non-small cell lung cancer. Cancers. 2020;12(1) doi: 10.3390/cancers12010193. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Cai J., Yi M., Tan Y., Li X., Li G., Zeng Z., Xiong W., Xiang B. Natural product triptolide induces GSDME-mediated pyroptosis in head and neck cancer through suppressing mitochondrial hexokinase-ΙΙ. J. Exp. Clin. Cancer Res.[J] 2021;40(1):190. doi: 10.1186/s13046-021-01995-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Wakimoto N., Yin D., O’Kelly J., Haritunians T., Karlan B., Said J., Xing H., Koeffler H.P. Cucurbitacin B has a potent antiproliferative effect on breast cancer cells in vitro and in vivo. Cancer Sci. 2008;99(9):1793–1797. doi: 10.1111/j.1349-7006.2008.00899.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Yu P., Zhang X., Liu N., Tang L., Peng C., Chen X. Pyroptosis: mechanisms and diseases. Signal. Transduct. Target. Ther. 2021;6(1) doi: 10.1038/s41392-021-00507-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Wei X., Xie F., Zhou X., Wu Y., Yan H., Liu T., Huang J., Wang F., Zhou F., Zhang L. Role of pyroptosis in inflammation and cancer. Cell Mol. Immunol. 2022;19(9):971–992. doi: 10.1038/s41423-022-00905-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Gao W., Wang X., Zhou Y., Wang X., Yu Y. Autophagy, ferroptosis, pyroptosis, and necroptosis in tumor immunotherapy. Signal Transduct. Target. Ther.[J] 2022;7(1):196. doi: 10.1038/s41392-022-01046-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Hsu S.K., Li C.Y., Lin I.L., Syue W.J., Chen Y.F., Cheng K.C., Teng Y.N., Lin Y.H., Yen C.H., Chiu C.C. Inflammation-related pyroptosis, a novel programmed cell death pathway, and its crosstalk with immune therapy in cancer treatment. Theranostics[J] 2021;11(18):8813–8835. doi: 10.7150/thno.62521. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Palma G., Barbieri A., Bimonte S., Palla M., Zappavigna S., Caraglia M., Ascierto P.A., Ciliberto G., Arra C. Interleukin 18: friend or foe in cancer. Biochim. Biophys. Acta[J] 2013;1836(2):296–303. doi: 10.1016/j.bbcan.2013.09.001. [DOI] [PubMed] [Google Scholar]
  • 35.Ma Z., Li W., Yoshiya S., Xu Y., Hata M., El-Darawish Y., Markova T., Yamanishi K., Yamanishi H., Tahara H., Tanaka Y., Okamura H. Augmentation of Immune checkpoint cancer immunotherapy with IL18. Clin Cancer Res.[J] 2016;22(12):2969–2980. doi: 10.1158/1078-0432.CCR-15-1655. [DOI] [PubMed] [Google Scholar]
  • 36.Ernani V., Saba N.F. Oral cavity cancer: risk factors, pathology, and management. Oncology[J] 2015;89(4):187–195. doi: 10.1159/000398801. [DOI] [PubMed] [Google Scholar]
  • 37.Ng J.H., Iyer N.G., Tan M.H., Edgren G. Changing epidemiology of oral squamous cell carcinoma of the tongue: a global study. Head Neck[J] 2017;39(2):297–304. doi: 10.1002/hed.24589. [DOI] [PubMed] [Google Scholar]
  • 38.Bagchi S., Yuan R., Engleman E.G. Immune checkpoint inhibitors for the treatment of cancer: clinical impact and mechanisms of response and resistance. Annu. Rev. Pathol.[J] 2021;16:223–249. doi: 10.1146/annurev-pathol-042020-042741. [DOI] [PubMed] [Google Scholar]
  • 39.Cramer J.D., Burtness B., Le Q.T., Ferris R.L. The changing therapeutic landscape of head and neck cancer. Nat. Rev. Clin. Oncol.[J] 2019;16(11):669–683. doi: 10.1038/s41571-019-0227-z. [DOI] [PubMed] [Google Scholar]
  • 40.Herbst R.S., Soria J.C., Kowanetz M., Fine G.D., Hamid O., Gordon M.S., Sosman J.A., McDermott D.F., Powderly J.D., Gettinger S.N., Kohrt H.E., Horn L., Lawrence D.P., Rost S., Leabman M., Xiao Y., Mokatrin A., Koeppen H., Hegde P.S., Mellman I., Chen D.S., Hodi F.S. Predictive correlates of response to the anti-PD-L1 antibody MPDL3280A in cancer patients. Nature[J] 2014;515(7528):563–567. doi: 10.1038/nature14011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Mandal R., Şenbabaoğlu Y., Desrichard A., Havel J.J., Dalin M.G., Riaz N., Lee K.W., Ganly I., Hakimi A.A., Chan T.A., Morris L.G. The head and neck cancer immune landscape and its immunotherapeutic implications. JCI Insight[J] 2016;1(17) doi: 10.1172/jci.insight.89829. e89829. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Peltanova B., Raudenska M., Masarik M. Effect of tumor microenvironment on pathogenesis of the head and neck squamous cell carcinoma: a systematic review. Mol. Cancer[J] 2019;18(1):63. doi: 10.1186/s12943-019-0983-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Rosenberg S.A., Restifo N.P. Adoptive cell transfer as personalized immunotherapy for human cancer. Science[J] 2015;348(6230):62–68. doi: 10.1126/science.aaa4967. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Anderson K.G., Stromnes I.M., Greenberg P.D. Obstacles posed by the tumor microenvironment to T cell activity: A case for synergistic therapies. Cancer Cell[J] 2017;31(3):311–325. doi: 10.1016/j.ccell.2017.02.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Zhang Z., Zhang Y., Xia S., Kong Q., Li S., Liu X., Junqueira C., Meza-Sosa K.F., Mok T.M.Y., Ansara J., Sengupta S., Yao Y., Wu H., Lieberman J. Gasdermin E suppresses tumour growth by activating anti-tumour immunity. Nature[J] 2020;579(7799):415–420. doi: 10.1038/s41586-020-2071-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Shen C., Pandey A., Man S.M. Gasdermins deliver a deadly punch to cancer. Cell Res. 2020;30(6):463–464. doi: 10.1038/s41422-020-0316-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Wu Y., Pi D., Zhou S., Yi Z., Dong Y., Wang W., Ye H., Chen Y., Zuo Q., Ouyang M. Ginsenoside Rh3 induces pyroptosis and ferroptosis through the Stat3/p53/NRF2 axis in colorectal cancer cells. Acta Biochim. Biophys. Sin. (Shanghai)[J] 2023;55(4):587–600. doi: 10.3724/abbs.2023068. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Su W., Qiu W., Li S.J., Wang S., Xie J., Yang Q.C., Xu J., Zhang J., Xu Z., Sun Z.J. A dual-responsive STAT3 inhibitor nanoprodrug combined with oncolytic virus elicits synergistic antitumor immune responses by igniting pyroptosis. Adv. Mater.[J] 2023;35(11) doi: 10.1002/adma.202209379. e2209379. [DOI] [PubMed] [Google Scholar]
  • 49.Li N., Jiang X., Zhang R., Ye N., Tang M., Cai X., Su K., Peng J., Zhang X., Zhao M., Wu W., Ye H. Discovery of triazinone derivatives as novel, specific, and direct NLRP3 inflammasome inhibitors for the treatment of DSS-induced ulcerative colitis. J. Med. Chem.[J] 2023;66(19):13428–13451. doi: 10.1021/acs.jmedchem.3c00696. [DOI] [PubMed] [Google Scholar]
  • 50.Huang C.F., Chen L., Li Y.C., Wu L., Yu G.T., Zhang W.F., Sun Z.J. NLRP3 inflammasome activation promotes inflammation-induced carcinogenesis in head and neck squamous cell carcinoma. J. Exp. Clin. Cancer Res.[J] 2017;36(1):116. doi: 10.1186/s13046-017-0589-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Miao R., Jiang C., Chang W.Y., Zhang H., An J., Ho F., Chen P., Zhang H., Junqueira C., Amgalan D., Liang F.G., Zhang J., Evavold C.L., Hafner-Bratkovič I., Zhang Z., Fontana P., Xia S., Waldeck-Weiermair M., Pan Y., Michel T., Bar-Peled L., Wu H., Kagan J.C., Kitsis R.N., Zhang P., Liu X., Lieberman J. Gasdermin D permeabilization of mitochondrial inner and outer membranes accelerates and enhances pyroptosis. Immunity[J] 2023 doi: 10.1016/j.immuni.2023.10.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Zhang T., Li Y., Park K.A., Byun H.S., Won M., Jeon J., Lee Y., Seok J.H., Choi S.W., Lee S.H., Kim J.Man, Lee J.H., Son C.G., Lee Z.W., Shen H.M., Hur G.M. Cucurbitacin induces autophagy through mitochondrial ROS production which counteracts to limit caspase-dependent apoptosis. Autophagy[J] 2012;8(4):559–576. doi: 10.4161/auto.18867. [DOI] [PubMed] [Google Scholar]
  • 53.Li W., Zeng Q., Wang B., Lv C., He H., Yang X., Cheng B., Tao X. Oxidative stress promotes oral carcinogenesis via Thbs1-mediated M1-like tumor-associated macrophages polarization. Redox Biol.[J] 2024;76 doi: 10.1016/j.redox.2024.103335. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Argilés J.M., Busquets S., Stemmler B., López-Soriano F.J. Cancer cachexia: understanding the molecular basis. Nat. Rev. Cancer[J] 2014;14(11):754–762. doi: 10.1038/nrc3829. [DOI] [PubMed] [Google Scholar]
  • 55.Lu B., Li C., Jing L., Zhuang F., Xiang H., Chen Y., Huang B. Rosmarinic acid nanomedicine for rheumatoid arthritis therapy: targeted RONS scavenging and macrophage repolarization. J. Control. Release[J] 2023;362:631–646. doi: 10.1016/j.jconrel.2023.09.012. [DOI] [PubMed] [Google Scholar]
  • 56.Xiao L., Chen B., Wang W., Tian T., Qian H., Li X., Yu Y. Multifunctional Au@AgBiS(2) nanoparticles as high-efficiency radiosensitizers to induce pyroptosis for cancer radioimmunotherapy. Adv. Sci. (Weinh)[J] 2023 doi: 10.1002/advs.202302141. e2302141. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Lin J., Sun S., Zhao K., Gao F., Wang R., Li Q., Zhou Y., Zhang J., Li Y., Wang X., Du L., Wang S., Li Z., Lu H., Lan Y., Song D., Guo W., Chen Y., Gao F., Zhao Y., Fan R., Guan J., He W. Oncolytic parapoxvirus induces Gasdermin E-mediated pyroptosis and activates antitumor immunity. Nat. Commun.[J] 2023;14(1):224. doi: 10.1038/s41467-023-35917-2. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

mmc1.docx (344.2KB, docx)
mmc2.docx (1.2MB, docx)
mmc3.docx (257.7KB, docx)
mmc4.docx (188KB, docx)
mmc5.docx (154.8KB, docx)
mmc6.xls (212KB, xls)

Data Availability Statement

All data generated or analyzed during this study are included in this published article.


Articles from Translational Oncology are provided here courtesy of Neoplasia Press

RESOURCES