Skip to main content
Journal of Translational Medicine logoLink to Journal of Translational Medicine
. 2025 Jun 11;23:647. doi: 10.1186/s12967-025-06677-y

The SOX18-OTUB1-YAP1 axis: a new endometriosis target

Ying Feng 1,, Jiamei Yue 1, Si Fan 1, Jiayan Wu 1
PMCID: PMC12160126  PMID: 40500704

Abstract

Background

EMS (Endometriosis) is characterized by the presence of functional endometrial tissue outside the uterus and is one of the most common gynecological disorders. SOX18 (SYR-related high-mobility group box 18) is a transcription factor whose expression is higher in ectopic endometrial tissues than in eutopic endometrial tissues. However, its role in EMS has not been confirmed.

Methods

Here, immunohistochemistry (IHC) staining was used to analyze the expression pattern of SOX18 in EMS. Next, the effects of SOX18 on cell viability, migration and invasion were investigated. Dual-luciferase reporter assay, chromatin-immunoprecipitation (ch-IP) and DNA pull-down were employed to verify SOX18 binding to the OTUB1 (OTU domain-containing ubiquitin aldehyde binding protein 1) promoter. In addition, co-immunoprecipitation (co-IP) was used to analyze the binding of OTUB1 to YAP1 (Yes-associated protein 1). Allograft mouse model of EMS was established to explore the role of SOX18 in vivo.

Results

In vitro results demonstrated that upregulation of SOX18 promoted the proliferation, migration and invasion of Ishikawa cells and induced the EMT process, while knockdown of SOX18 showed the opposite effect. In vivo results also confirmed that SOX18 overexpression led to the deterioration of EMS, as reflected by significant pathological changes in mice. Mechanistically, our data proved that SOX18 directly bound to the OTUB1 promoter region and activated its transcription. Further investigation demonstrated that OTUB1 deubiquitinated YAP1 and enhanced its protein stability. Rescue experiments suggested that SOX18 modulated YAP1 expression through upregulating OTUB1, indicating the role of SOX18-OTUB1-YAP1 axis in EMS.

Conclusions

These discoveries underscore that SOX18 contributes to the pathogenesis of EMS through promoting OTUB1 transcription and activating Hippo/YAP1 signaling pathway, which may provide a new therapeutic target for EMS.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12967-025-06677-y.

Keywords: Endometriosis, SOX18, Hippo/YAP1, OTUB1

Introduction

EMS (Endometriosis) is a common, chronic, inflammatory, and hormone-dependent gynecological disorder that is usually characterized by ectopia outside the uterine cavity, the presence and growth of endometrioid tissue. It predominantly affects about 10% of women of reproductive age [1, 2]. EMS is associated with multiple symptoms, such as pelvic pain, dysmenorrhea, dyspareunia, urinary dysfunction, and related fertility problems [3]. Although it is benign, this chronic and multifactorial disease exhibits tumor-like biological behavior and affects the physical and mental health of the affected women [4]. Current treatments include surgical resection of the lesion and drug therapy, but conventional treatment is limited by the high rate of postoperative recurrence and the side effects of drugs [5]. Therefore, understanding the molecular mechanisms driving EMS progression is crucial for identifying diagnostic biomarkers and developing effective therapies.

SOX18 (SYR-related high-mobility group box 18) is a member of the SOX transcription factor family and is involved in a variety of biological processes, including cardiovascular development, cell-fate determination, and tissue homeostasis [6]. An increasing number of studies demonstrated that SOX18 was highly expressed in tumor tissues and exacerbated their development, such as hepatocellular carcinoma [7], bladder cancer [8], gastric cancer [9], clear cell renal cell carcinoma [10] and prostate cancer [11]. In addition, SOX18 promoted TNF-α-induced airway smooth muscle cell proliferation and migration via regulating Notch1 signaling pathway, thus aggravating the progression of childhood asthma [12]. By analyzing the GSE11691 chip of GEO database, it was found that SOX18 expression was significantly upregulated in ectopic endometrial tissues compared with eutopic endometrial tissues, but its role in EMS was unknown.

Hippo signaling pathway plays an important role in a variety of biological processes such as organ size control, tissue homeostasis, cancer genesis, and immune response [13]. As the main downstream target of Hippo pathway, YAP1 (Yes-associated protein 1) is involved in the occurrence and development of multiple cancers. For example, YAP1 initiated gastric tumorigenesis through upregulation of MYC [14]. YAP1 also facilitated invasion, metastasis, and epithelial-mesenchymal transformation (EMT) of non-small cell lung cancer cells [15]. In addition, a previous study certified that activation of the Hippo/YAP1 pathway promoted ectopic endometrial stromal cell proliferation and anti-apoptosis [16].

OTUB1 (OTU domain-containing ubiquitin aldehyde binding protein 1) is a deubiquitinating enzyme that blocks ubiquitination, resulting in protein stabilization [17]. OTUB1 has been identified to drive the progression of a variety of tumors. For instance, OTUB1 instigated cancer cell immunosuppression by stabilizing PD-L1 [18]. OTUB1 fostered breast cancer progression via blocking MYC protein degradation [19]. Noteworthily, OTUB1 promoted the pathogenesis of EMS through upregulating HSF119 [20]. Through the analysis of Jaspar database, we noticed there were potential binding sites for SOX18 on the promoter of OTUB1. Accordingly, it was speculated that SOX18 may play a key role in EMS by regulating OTUB1 transcription. In addition, hitpredict database indicated a possible combination of OTUB1 and YAP1. Remarkably, Yan et al. demonstrated that OTUB1 aggravated gastric cancer progression by stabilizing YAP1 [21]. However, whether OTUB1-YAP1 axis affects the role of SOX18 in EMS remains to be explored.

In this study, we aimed to investigate the role of SOX18 in EMS and the molecular mechanism of the SOX18-OTUB1-YAP1 axis. Our results may contribute to the development of appropriate therapeutic strategies.

Materials and methods

Clinical samples

The clinical study was approved by the Medical Ethics Committee of the Second Affiliated Hospital of Nanchang University and conducted in accordance with the Declaration of Helsinki. All subjects provided written informed consent prior to participation. Nine ectopic endometrium samples (28–46 years old, n = 4 proliferative and n = 5 secretory) with laparoscopically and histopathologically confirmed endometriosis (EMS) and 18 eutopic endometrium samples (28–54 years old, n = 11 proliferative and n = 7 secretory) without evidence of EMS by laparoscopy were included in this study. All patients had regular menstrual cycles and none of them had received hormonal treatment for at least 3 months prior to the surgery. Eutopic endometrial biopsy specimens were collected using endometrial aspiration catheters. Endometriotic cyst walls were collected and ectopic endometrial tissues were carefully stripped from the lining inner cyst wall. Paraffin-embedded eutopic endometrium and ectopic endometrium samples were used for immunohistochemistry (IHC) staining to detect SOX18 expression.

Differential gene analysis

GSE11691 (containing ectopic endometrium (n = 9) samples and eutopic endometrium (n = 9) samples) gene expression profile was downloaded from the GEO database (https://www.ncbi.nlm.nih.gov/geo/). The filtering conditions for differentially expressed genes (DEGs) between ectopic and eutopic endometrial tissue samples were:|log2FC|>1, p < 0.01. At last, GO and KEGG enrichment analyses were performed to explore important pathways.

Allograft mouse model of EMS

The animal experiments were in lined with Guide for the Care and Use of Laboratory Animals, and approved by Ethics Committee of the Nanchang University. EMS was induced by a previously described method [22]. Eight-week-old female C57BL/6J mice were used for modeling. One week before EMS induction surgery, mice were subcutaneously injected with estradiol valerate (0.2 mg/ mouse). The donor mice were then killed, the uterine horns removed and placed in a dish containing sterile saline. After stripping the serosa and myometrium, the endometrium-rich fragments were shredded. Processed fragments are always smaller than 1 mm3. Fragments suspended in sterile saline were intraperitoneally injected into recipient mice. Fragments of endometrial tissue obtained from one mouse were injected into two mice. Mice in sham group were injected with the same volume of normal saline intraperitoneally. One week after transplantation of donor endometrial fragments, recipient mice were intraperitoneally injected with SOX18 overexpression or control adenovirus (1 × 109 pfu, volume no more than 1 ml). Three weeks later, a second injection of adenovirus was administered. The recipient mice were sacrificed 42 days after transplantation of donor endometrial fragments, and the recipient mice were dissected to obtain ectopic endometrial tissues, and endometrial tissues of the sham group were also collected.

Histology and IHC staining

H&E staining was used to detect the pathological changes of ectopic endometrium in recipient mice. Tissues were embedded in paraffin and cut into 5 μm-thick sections. Sections were deparaffinized in xylene and dehydrated with graded ethanol. Afterwards, sections stained with hematoxylin (Solarbio, Beijing, China) for 5 min and eosin (Sangon Biotech, Shanghai, China) for 3 min. Finally, the staining was observed under a DP73 microscope (Olympus, Japan).

For IHC staining, paraffin-embedded sections were deparaffinized and rehydrated, and the endogenous peroxidase was blocked with 3% H2O2. Primary antibodies (anti-SOX18, bs-17135R, 1: 100, BIOSS, Changzhou, China; anti-OTUB1, GTX101973, 1: 100, GeneTex, USA; anti-Vimentin, A19607, 1: 100, ABclonal, Shanghai, China) were added and incubated overnight at 4 °C, followed by incubation with HRP-conjugated secondary antibody (31460, 1: 500, ThermoFisher, USA) at 37 °C for 30 min. Subsequently, sections were incubated with DAB (MXB® Biotechnology, Fuzhou, China), stained with hematoxylin and finally pictured under a DP73 microscope.

Cell culture and transfection

Ishikawa cells were purchased from iCell Bioscience Inc (Shanghai, China) and cultured in MEM medium (Solarbio, Beijing, China) containing 15% fetal bovine serum at 37℃ and 5% CO2.

To overexpress SOX18 and OTUB1, we amplified the cDNA of SOX18 or OTUB1 and subcloned them into pcDNA3.1. For the knockdown of SOX18, OTUB1 and YAP1, we synthesized shRNA targeting these genes and subcloned them into pRNAH1.1 with the following sequences:

shSOX18#1: GAGTTCGACCAGTACCTCAATTCAAGAGATTGAGGTACTGGTC

GAACTTTTTT.

shSOX18#2: GGGGCAAAGGACGAGCGCAATTCAAGAGATTGCGCTCGTCCT

TTGCCCTTTTT.

shOTUB1:

GCCGACTACCTTGTGGTCTATTCAAGAGATAGACCACAAGGTAG

TCGGTTTTT.

shYAP1:

GGGTCAGAGATACTTCTTAATTCAAGAGATTAAGAAGTATCTCTGA

CCTTTTT.

Ishikawa cells were transfected with the overexpression plasmids or shRNA plasmids using Lipofectamine 3000 (Invitrogen, USA) according to the manufacturer’s protocols.

Cell viability

CCK-8 kit (Solarbio) was employed to detect cell viability at 0, 24, 48 and 72 h after transfection. Optical density (OD) values were measured at 450 nm with microplate reader 800TS (BioTek, USA).

Cell invasion and migration

Transwell assays were used to evaluate cell migration and invasion. Briefly, 200 µl cell suspension was added to the upper chamber and precoated with/without Matrigel gel (Corning, USA). Medium supplemented with 10% FBS was added to the lower chamber. Afterwards, cells were allowed to migrate or invade into the lower chamber. After washing with PBS, cells were fixed with 4% polyformaldehyde for 20 min and stained with 0.5% crystal violet (Amresco, USA) for 5 min. Finally, cells were counterstained and photographed with a DP73 microscope.

Immunofluorescence double staining

Cells were fixed with 4% paraformaldehyde and incubated with 0.1% tritonX-100 (Beyotime, Shanghai, China) at room temperature for 30 min. After blocking with 1% BSA, cells were incubated with primary antibodies (anti-OTUB1, 1: 100, ab270959, Abcam, UK and anti-YAP1, 1: 50, sc-271134, Santa Cruz Biotechnology, USA) at 4 °C overnight, followed by incubation with secondary antibodies (FITC-labeled goat anti-rabbit IgG, ab6717, 1: 200, Abcam) or (Cy3-labeled goat anti-mouse IgG, ab97035, 1: 200, Abcam) at room temperature for 1 h. After that, sections were treated with DAPI (Aladdin, Shanghai, China), and the staining was observed under DP73 microscope.

Real-time PCR

Total RNA was extracted by TRIpure (BioTeke, Beijing, China). cDNA was obtained by All-in-One First-Strand SuperMix (Magen, Guangzhou, China). Real-time PCR was performed using 2×Fast Taq plus PCR Master Mix (Biosharp, Hefei, China) and SYBR Green (Solarbio) in Pangaea 3 fluorescence quantifier (Aperbio, Suzhou, China). The expression of targeted genes was analyzed with a 2−ΔΔCt method. GAPDH was used as an internal control. Primers used are shown in Table 1.

Table 1.

Primers used for real-time PCR assay

Gene Primer sequences (5’-3’) Product size (bp)
homo SOX18 F GGCAAAGCGTGGAAGGAG 101
homo SOX18 R TTGTAGTTGGGGTGGTCGC
homo CTGF F AAATCTCCAAGCCTATCAAGTT 124
homo CTGF R GGCAGGGTGGTGGTTCT
homo YAP1 F TGACCCTCGTTTTGCCATGA 125
homo YAP1 R GTTGCTGCTGGTTGGAGTTG
homo OTUB1 F CTGTTTCTATCGGGCTTTC 235
homo OTUB1 R GGAGGTGCTCTGGTCATT
homo ChIP-OTUB1 F GTGAAGCATACACCAGGAT 187
homo ChIP-OTUB1 R AGCCACCACTAAAGCAG
mus SOX18 F CGTTTCCCAATCCTCTGTC 150
mus SOX18 R TAGTGGCATCCGGTCGA
mus OTUB1 F TAGCGACTCCGAAGGTG 231
mus OTUB1 R AAGCAGTTGCCATCAGG

Western blot

Tissue and cell lysates were prepared with RIPA buffer (Solarbio) containing 10% PMSF (Solarbio). Next, protein concentrations were quantified using a BCA kit (Solarbio). Samples were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis on a 10% gel (Solarbio) and transferred to a polyvinylidene fluoride membrane (Millipore, USA). Membranes were incubated with primary antibodies at 4 °C overnight and goat anti-rabbit HRP-conjugated IgG (SE134, 1: 3000, Solarbio) or goat anti-mouse HRP-conjugated IgG (SE131, 1: 3000, Solarbio) at 37 °C for 1 h. Next, membranes were developed with electrochemiluminescence regent (Beyotime) for 5 min and visualized by Tanon Image (Shanghai, China).

Primary antibodies used are as follows: anti-SOX18 (R381018, 1: 500, Zen-bioscience, Chengdu, China), anti-YAP1 (sc-271134, 1:300; Santa Cruz), anti-OTUB1 (ab270959, 1: 1000, Abcam), anti-PCNA (200947-2E1, 1: 1000, Zen-bioscience), anti-E-cadherin (340341, 1:500, Zen-bioscience), anti-N-cadherin (240010, 1: 1000, Zen-bioscience), and anti-Vimentin (R22775, 1: 500, Zen-bioscience).

Dual-luciferase reporter assay

To determine the transcription activity of OTUB1, pGL3 luciferase reporter vector containing the OTUB1 promoter sequence was constructed and transfected into Ishikawa cells with SOX18 overexpression plasmid. pRL-TK was used as control plasmid. After 48 h of transfection, cells were harvested, and luciferase activity was measured by the kit (Keygen Biotech, Nanjing, China).

Chromatin-immunoprecipitation (Ch-IP)

Ch-IP was performed using the kit (Beyotime) according to the manufacturers’ instructions. In brief, cells were cross-linked with 1% formaldehyde for 10 min at 37 °C and then broken down by ultrasonic treatment. After centrifugation, 70 µl Protein A/G beads were added and left for 30 min at 4 °C, and 20 µl sample was used as input. Afterwards, the mixture of DNA and protein was then incubated with 1 µg antibodies at 4 °C overnight. Samples were de-crosslinked with 20 µl 5 M NaCl at 65 °C for 4 h, and purified DNA fragments were extracted with phenol and chloroform for PCR.

Co-immunoprecipitation (Co-IP)

Cells were lysed in RIPA lysis buffer containing 10% PMSF (Solarbio), and protein was isolated. Antibodies were immobilized, and immunoprecipitation was then carried out using the co-IP kit (Pierce, USA) following the manufacturer’s protocol. Briefly, 200 µl IP cross-linking buffer was used to wash AminoLink conjugated resin. Next, lysates were added to the corresponding resin in which the corresponding antibodies had been cured. After elution, samples were applied for western blot.

To evaluate ubiquitination of YAP1, Ishikawa treated with a 20 µM proteasome inhibitor MG132 for 8 h. Western blot was used to detect the ubiquitination levels of YAP1. Antibodies used are as follows: anti-YAP1 (sc-271134, 1: 300, Santa Cruz Biotechnology), anti-OTUB1 (ab270959, 1: 1000, Abcam, UK), flag (R24091, 1: 5000, Zen-bioscience), myc (250112, 1: 5000, Zen-bioscience), and ubiquitin (381080, 1: 1000, Zen-bioscience).

Protein stability

Ishikawa cells were treated with 100 µg/ml CHX (Aladdin) for 0, 2, 4, 6 and 8 h. The residual rate of YAP1 protein was calculated.

DNA pull-down

DNA pull-down was conducted with Sufficient reagents for 40 DNA pull down assay kit (BersinBio, Guangzhou, China) according to the manufacturer’s protocol. Briefly, nuclear protein was extracted, and 40 µl Agarose beads were added to the protein samples at 4 °C for 30 min. After centrifugation, protein samples were added with 500 µl binding buffer, 5 µl poly (dI·dC), 5 µl protease inhibitor, 5 µl DTT, 9 µl EDTA, 4.5 µl EGTA, and then added to the probe-magnetic bead complex. After incubation at 4 °C for 1 h, magnetic beads were collected. Finally, 15 µl protein samples were employed for western blot analysis.

Statistical analysis

GraphPad Prism 8 was utilized for data analysis. Differences between the two groups were evaluated using Student’s t test. Comparisons among three or more groups were made using one-way ANOVA and Tukey’s post hoc tests. Pearson correlation analysis was used to evaluate the correlation between SOX18 and OTUB1. p < 0.05 was considered statistically significant.

Results

The expression of SOX18 was significantly upregulated in GEO database and clinical samples of EMS

In order to explore the potential factors of EMS, we first analyzed the GEO public database and obtained the expression data of GSE11691 chip. As revealed in volcano plot, 575 genes were significantly upregulated and 292 genes were significantly downregulated in ectopic endometrium compared with eutopic endometrium (Fig. 1A). To shed light on the biological function of DEGs, GO and KEGG pathway analysis was performed. The results displayed that DEGs associated with GO annotation were enriched in regulation of cell-cell adhesion, cell chemotaxis, cell growth, positive regulation of Hippo signaling, and DNA-binding transcription factor binding (Fig. 1B). DEGs enriched KEGG pathways were cell adhesion molecules, ECM-receptor interaction and cytokine-cytokine receptor interaction (Fig. 1B). The above enriched pathways indicated the pathogenic mechanism of EMS and provide possible directions for further study.

Fig. 1.

Fig. 1

The expression of SOX18 was significantly upregulated in GEO database and clinical samples of EMS. The data of GSE11691 gene expression profile were collected, and the DEGs screening criteria was │log2FC│>1, p < 0.01 for bioinformatics analysis. (A) Volcano plot of GSE11691 microarray data was used to display gene expression. (B) GO and KEGG analysis were performed on the selected DEGs. (C) The heat map showed the expression of all SOX family members in GSE11691 chip. (D) The expression of SOX18 in human endometrial tissues based on the data of GSE11691 microarray. (E) IHC staining was used to detect the expression of SOX18 in eutopic and ectopic endometrium of patients with EMS, and the staining results were analyzed by H-score. Scale bar: 50 μm. *, p < 0.05. ***, p < 0.001. Data are presented as mean ± SD

SOX transcription factor family is involved in many biological processes, including cell proliferation, migration and invasion. The role of members of the family of the SOX in EMS aroused our great interest. Therefore, we presented the expression of SOX family members in the GSE11691 chip by heat map (Fig. 1C). Among them, three SOX family members were identified as DEGs, including SOX18, SOX10 and SOX11. SOX18 and SOX10 were upregulated genes, and SOX11 was downregulated genes. By querying the function of these DEGs, SOX18 was selected as a potential molecular target for follow-up study. As presented in Fig. 1D-E, SOX18 was highly expressed in ectopic endometrial tissues based on the data of GSE11691 microarray and IHC staining. These findings indicated that SOX18 may play a key role in the development of EMS.

SOX18 overexpression promoted the proliferation of Ishikawa cells

To further determine the potential function of SOX18 in EMS, we conducted a series of validation tests by overexpressing or silencing SOX18 in Ishikawa cells, respectively. SOX18 expression was downregulated by transfection with shRNA plasmid targeting SOX18, and its expression was upregulated by transfection with overexpression plasmid (Supplementary Fig. 1A). Subsequently, the impact of SOX18 on cell proliferation was detected. Findings from CCK-8 assay indicated that overexpression of SOX18 resulted in a noteworthy increase in OD450 values, while knockdown of SOX18 reduced cell viability (Fig. 2A). In addition, our data presented that SOX18 overexpression elevated PCNA and SOX18 expression, while SOX18 knockdown showed the opposite effect (Fig. 2B). These observations illustrated that SOX18 potentiated the proliferation of Ishikawa cells.

Fig. 2.

Fig. 2

SOX18 overexpression promoted the proliferation of Ishikawa cells. (A) Cell viability was measured by CCK8 assay. (B) The expression of PCNA and SOX18 in the cells was detected by western blot. *, p < 0.05. ***, p < 0.001. ****, p < 0.0001. Data are presented as mean ± SD

SOX18 overexpression facilitated the migration, invasion and EMT of Ishikawa cells

The influence of SOX18 on the migration and invasion of Ishikawa cells was investigated through Transwell assays with or without Matrigel-precoat. Overexpression of SOX18 significantly enhanced the migratory and invasive capabilities of cells, while silencing SOX18 had a significant effect on reversing migration characteristics and reducing invasiveness of cells (Fig. 3A). To further examine whether SOX18 facilitates migration and invasion of cells by promoting EMT process, western blot analysis was employed to detect the expression of EMT markers. As shown in Fig. 3B, the levels of epithelial markers (E-cadherin) were decreased, whereas, the levels of mesenchymal markers (N-cadherin and vimentin) were obviously elevated in SOX18-overexpressed cells. Conversely, the levels of EMT marker showed the opposite change in response to SOX18 knockdown (Fig. 3B). To sum up, our results demonstrated that SOX18 was involved in cell migration, invasion and EMT, thus leading to the process of EMS.

Fig. 3.

Fig. 3

SOX18 overexpression facilitated the migration, invasion and EMT of Ishikawa cells. (A) Transwell assay was used to determine cell migration and invasion. Scale bar: 100 μm. (B) The expression of E-cadherin, N-cadherin and Vimentin was examined by western blot. ***, p < 0.001. ****, p < 0.0001. Data are presented as mean ± SD

SOX18 overexpression enhanced the Hippo/YAP1 signaling pathway in Ishikawa cells

Previous GO enrichment analysis revealed that DEGs was enriched in regulation of Hippo signaling. Therefore, we characterized the mechanism by which SOX18 influences the Hippo/YAP1 pathway. For western blot assay, SOX18 overexpression upregulated YAP1 expression, while SOX18 knockdown inhibited its expression (Fig. 4A). Furthermore, the influence of SOX18 on the downstream factor of Hippo/YAP1 signaling pathway was examined. Of note, SOX18 overexpression enhanced the expression of CTGF, while SOX18 knockdown showed the opposite function (Fig. 4B). To gain a deeper understanding of the functional changes induced by SOX18, Ishikawa cells were transfected with shRNA plasmid targeting YAP1. After 48 h, the transfection efficiency of YAP1 was verified by real-time PCR and western blot (Fig. 4C). Next, cells were co-transfected with shRNA plasmid targeting YAP1 and SOX18 overexpression plasmid. As observed, YAP1 knockdown inhibited cell viability enhanced by SOX18 (Fig. 4D). Transwell assay also confirmed that SOX18 overexpression promoted cell invasion, but this effect was nullified by YAP1 knockdown (Fig. 4E). In addition, YAP1 knockdown weakened the effect of SOX18 overexpression on EMT process, accompanied by increased E-cadherin and decreased N-cadherin and vimentin (Fig. 4F). Together, these findings suggested that SOX18 promoted the development of EMS by enhancing the Hippo/YAP1 signaling pathway.

Fig. 4.

Fig. 4

SOX18 overexpression enhanced the Hippo/YAP1 signaling pathway in Ishikawa cells. (A) The expression of YAP1 in the cells was tested by western blot. (B) The expression of CTGF in the cells was detected by real-time PCR. (C) Ishikawa cells were transfected with shRNA plasmid targeting YAP1. After 48 h, the transfection efficiency of YAP1 was analyzed by real-time PCR and western blot. (D) Cell viability was examined by CCK8 assay. (E) Transwell assay was used to test cell invasion. Scale bar: 100 μm. (F) The expression of E-cadherin, N-cadherin and Vimentin was detected by western blot. **, p < 0.01. ***, p < 0.001. ****, p < 0.0001. Data are presented as mean ± SD

SOX18 transcriptionally upregulated the expression of OTUB1

A previous study verified that OTUB1 promoted the occurrence and development of EMS [20]. Jaspar data revealed potential SOX18 binding sites on the OTUB1 promoter, suggesting that SOX18 may be involved in the progression of EMS through transcriptional regulation of OTUB1. Therefore, we further elucidated the regulatory mechanism of SOX18 and OTUB1. Firstly, IHC staining results indicated that the expression of OTUB1 was increased in ectopic endometrial tissues compared with eutopic endometrial tissues (Fig. 5A). Next, the correlation between SOX18 and OTUB1 in clinical samples was analyzed according to H-score. The results showed a positive correlation between SOX18 and OTUB1 (Fig. 5B). Furthermore, we discovered that SOX18 overexpression upregulated the levels of OTUB1, while SOX18 knockdown downregulated its levels (Fig. 5C). The effect of SOX18 on the transcription of OTUB1 was evaluated by dual luciferase reporter assay. The results presented a significant increase in OTUB1 promoter activity as a result of SOX18 overexpression compared with vector, implying that SOX18 was required to facilitate the transcription of OTUB1 (Fig. 5D). The binding of SOX18 to the OTUB1 promoter was also verified by Ch-IP assay (Fig. 5E). In addition, as demonstrated by DNA pull-down, SOX18 wild-type bound to the promoter of OTUB1, but the SOX18 mutant did not bind to OTUB1 (Fig. 5F). Totally, our data confirmed that SOX18 bound to the OTUB1 promoter and transcriptionally upregulated OTUB1.

Fig. 5.

Fig. 5

SOX18 transcriptionally upregulated the expression of OTUB1. (A) IHC staining was employed to test the expression of OTUB1 in eutopic and ectopic endometrium of patients with EMS, and the staining results were analyzed by H-score. Scale bar: 50 μm. (B) Correlation between SOX18 and OTUB1 in clinical samples of EMS. (C) The expression of OTUB1 in the cells was verified by real-time PCR and western blot. (D) The luciferase reporter vector containing OTUB1 promoter sequence was co-transferred into Ishikawa cells with SOX18 overexpression plasmid. After 48 h, luciferase activity was detected by the kit. (E) The binding of the exogenous SOX18 and OTUB1 promoter was examined by Ch-IP, and the PCR products were detected by agarose gel electrophoresis. (F) DNA pull-down analysis of SOX18 and OTUB1 promoter binding in Ishikawa cells. **, p < 0.01. ****, p < 0.0001. Data are presented as mean ± SD

OTUB1 interacted with YAP1 and enhanced its protein stability

Our previous results demonstrated that SOX18 transcriptionally activated OTUB1 and promoted the Hippo/YAP1 signaling pathway. Notably, hitpredict analysis revealed the binding of OTUB1 to YAP1. Accordingly, we further clarified the molecular mechanism of OTUB1 and YAP1. Co-localization of OTUB1 and YAP1 in Ishikawa cells was detected by immunofluorescence double staining. The results showed that OTUB1 and YAP1 were mainly colocalized in cytoplasm (Fig. 6A). Co-IP also used to verify the interaction of OTUB1 to YAP1 in cells (Fig. 6B). To further explore the binding region of the two proteins, HEK-293T was co-transfected with an overexpression plasmid of different protein domains of OTUB1 (with a flag tag) and an overexpression plasmid of YAP1 (with a myc tag). The data certified that the OTU domain of OTUB1 combined with YAP1 (Fig. 6C). Furthermore, OTUB1 overexpression increased YAP1 levels, while OTUB1 knockdown showed the opposite effect (Fig. 6D). We further asked whether OTUB1 upregulates YAP1 expression through the proteasome pathway. To this end, Ishikawa cells were treated with 20 µM protease inhibitor MG132 for 8 h, and YAP1 expression was tested by western blot. The results indicated that the levels of YAP1 were upregulated after the addition of MG132 to OTUB1 knockdown cells (Fig. 6E). Subsequently, the effect of OTUB1 on the half-life of YAP1 protein was investigated, and the results displayed that overexpression of OTUB1 inhibited its protein degradation (Fig. 6F). Notably, further assay suggested that OTUB1 overexpression mediated deubiquitination of YAP1 (Fig. 6G). Based on the above findings, we proved that OTUB1 deubiquitinated YAP1 and enhanced its protein stability.

Fig. 6.

Fig. 6

OTUB1 interacted with YAP1 and enhanced its protein stability. (A) The co-localization of OTUB1 and YAP1 in Ishikawa cells was detected by immunofluorescence double staining. Scale bar: 50 μm. (B) Co-IP was used to verify the binding of OTUB1 to YAP1 in Ishikawa cells. (C) Overexpression plasmids of different protein domains of OTUB1 (with a flag tag) were co-transfected with YAP1 overexpression plasmid (with a myc tag) to HEK-293T. After 48 h, the binding of OTUB1 to YAP1 in the cells was determined by Co-IP. (D) Ishikawa cells were transfected with shRNA plasmid targeting OTUB1 or OTUB1 overexpressed plasmid. After 48 h, the expression of OTUB1 and YAP1 were detected by western blot. (E) The expression of YAP1 in Ishikawa cells was examined by western blot after 20 µM MG132 treatment for 8 h. (F) Ishikawa cells were treated with 100 µg/ml CHX for 0, 2, 4, 6 and 8 h. The expression of YAP1 was detected by western blot, and the residual rate of YAP1 protein was calculated. (G) After Ishikawa cells were treated with 20 µM MG132 for 8 h, the levels of ubiquitination in the cells were measured by co-IP. ****, p < 0.0001. Data are presented as mean ± SD

OTUB1 knockdown abolished the effect of SOX18 overexpression on EMS procession

We further verified whether OTUB1 mediates the role of SOX18 in the regulation of EMS progression and Hippo/YAP1 signaling pathway. Ishikawa cells were transfected with shRNA plasmid targeting OTUB1 and SOX18 overexpression plasmid. CCK8 experiment suggested that SOX18 overexpression promoted cell viability, while this effect was abolished OTUB1 knockdown (Fig. 7A). Furthermore, overexpression of SOX18 promoted cell invasion and EMT, whereas, knockdown of OTUB1 showed the opposite effect (Fig. 7B-C). SOX18 enhanced the Hippo/YAP1 signaling pathway, which was also counteracted by OTUB1 knockdown (Fig. 7D). Collectively, these findings indicated that OTUB1 knockdown abrogated the impact of SOX18 overexpression on Ishikawa cells, implying that SOX18-OTUB1-YAP1 axis played a vital role during EMS.

Fig. 7.

Fig. 7

OTUB1 knockdown abolished the effect of SOX18 overexpression on Ishikawa cells. (A) Cell viability was tested by CCK8 assay. (B) Cell invasion was detected by Transwell assay. Scale bar: 100 μm. (C) The expression of E-cadherin, N-cadherin and Vimentin was determined by western blot. (D) The expression of YAP1 in the cells was measured by western blot. **, p < 0.01. ****, p < 0.0001. Data are presented as mean ± SD

SOX18 overexpression worsened the progression of EMS in an animal model

Our in vitro experiments demonstrated that SOX18 fostered the proliferation, migration, invasion and EMT. We next asked whether SOX18 affects the development of EMS in vivo. To test this hypothesis, we established allograft mouse model of EMS. In the therapeutic model, endometriotic-like lesions were observed. The results suggested that the EMS mice had obvious endometriotic-like lesions, and the lesions were more severe after SOX18 overexpression (Fig. 8A). Meanwhile, H&E staining revealed successful formation of cystic endometriotic lesions with epithelial and stromal cells in EMS mice overexpressing SOX18 (Fig. 8B). Overexpression of SOX18 increased the levels of Vimentin in the ectopic endometrial tissues of recipient mice (Fig. 8C). Furthermore, the expression of SOX18, and YAP1 and OTUB1 in the ectopic endometrial tissues of recipient mice was also upregulated in response to SOX18 overexpression (Fig. 8D-E). Following on these results, we emphasized that SOX18 overexpression worsened the progression of EMS in vivo.

Fig. 8.

Fig. 8

SOX18 overexpression worsened the progression of EMS in an animal model. (A) Photographs of endometriotic lesions in recipient mice. (B) H&E staining was used to detect the histopathological changes of ectopic endometrium in recipient mice. Scale bar: 100 μm. (C) The expression of Vimentin in ectopic endometrial tissues of recipient mice was measured by IHC staining. (D) Real-time PCR or western blot were used to examine the expression of SOX18 and YAP1 in ectopic endometrial tissues of recipient mice. Scale bar: 50 μm. (E) The expression of OTUB1 in ectopic endometrial tissues of recipient mice was tested by real-time PCR and IHC staining. Scale bar: 50 μm. *, p < 0.05. ****, p < 0.0001. Data are presented as mean ± SD

Discussion

EMS is one of the most common causes of chronic pelvic pain and infertility [23]. EMT is a special biological process in which immotile epithelial cells are transformed into highly motile mesenchymal cells with migratory and invasive properties during EMS [24, 25]. This study investigated the effect of SOX18 on the EMS development and the possible underlying molecular mechanism in Ishikawa cells and a surgically induced mouse EMS model.

SOX18, a member of the SOX transcription factor family, is involved in a variety of biological processes. Increasing evidence suggested that SOX18 promoted the progression of many cancers. For example, SOX18 exacerbated gastric cancer metastasis via transactivating MCAM and CCL7 [9]. Overexpression of SOX18 also promoted cell metastasis in hepatocellular carcinoma [26]. Downregulation of SOX18 suppressed the proliferation, migration and invasion of laryngeal cancer cells via regulation of JAK2/STAT3 signaling pathway [27]. Upregulation of SOX18 in colorectal cancer cells also significantly elicited proliferation and inhibited apoptosis [28]. In this work, bioinformatics analysis showed a significant increase in SOX18 expression in ectopic endometrial tissues compared to ectopic endometrial tissues. The above results were also confirmed by IHC staining of clinical samples. Ishikawa, a human endometrial adenocarcinoma cell line, is usually selected as a cell model to study the transformation of endometrial glandular epithelial cells from non-receptive state to receptive state [29]. In the present study, cell function experiments suggested that SOX18 overexpression played an important role in maintaining proliferation, migration and invasion of Ishikawa cells, whereas downregulation of SOX18 inhibited these cellular bioactivities. Concomitantly, upregulation of SOX18 increased the expression of N-cadherin and vimentin, as well as decreased the expression of E-cadherin, indicating that SOX18 enhanced EMT procession. Therefore, SOX18 may exhibit oncogene-like properties in EMS by triggering the EMT process. In allograft mouse model of EMS, our results ascertained that SOX18 overexpression led to the worsening of EMS, manifested by increased lesions and histological changes in mice. These data substantiated that SOX18 participated in the development of EMS. Nevertheless, further investigation is warranted to elucidate the underlying molecular mechanism.

YAP1 is a downstream effector of Hippo pathway. When activated, YAP1 localizes to the nucleus and binds to transcription factors such as TEA domain DNA binding family of transcription factors (TEAD) [30]. Next, YAP1 instigates tumor growth, metastasis of cancer cells and induces EMT in a variety of tumors. For example, YAP1 regulated the transcription of Slug by interacting with TEAD to induce EMT in non-small cell lung cancer [31]. In addition, elevated YAP1 expression facilitated proliferation and blocked apoptosis in endometrial stromal cells [16]. Herein, we further explored whether SOX18 plays a role in EMS by regulating Hippo/YAP1 signaling pathway. As demonstrated, SOX18 upregulated the levels of YAP1 and its downstream factor CTGF, suggesting that SOX18 enhanced the Hippo/YAP1 signaling pathway. Functional rescue experiments corroborated that YAP1 knockdown eliminated the influence of SOX18 on EMS progression, indicating that SOX18 promoted EMS progression through regulating the Hippo/YAP1 signaling pathway.

In order to further explore the potential mechanism of SOX18 and Hippo/YAP1 signaling pathway, we analyzed the potential downstream factors of SOX18. Analysis of Jaspar database revealed that the binding sites of SOX18 existed in the promoter region of OTUB1, suggesting that OTUB1 may be regulated by SOX18. OTUB1 is a deubiquitinating enzyme that blocks ubiquitination. A previous study unraveled that OTUB1 contributed to the pathogenesis of EMS by stabilizing HSF1 [20]. Our series of experiments verified that SOX18 bound to the OTUB1 promoter region and promoted its transcription. Based on these results, we postulated that SOX18 instigated the development of EMS through transcriptional activation of OTUB1.

Of note, OTUB1 led to gastric cancer progression by stabilizing YAP1 and regulating Hippo/YAP1 signaling [21]. Accordingly, we also identified the regulatory relationship between OTUB1 and YAP1. Co-IP verified the combination of OTUB1 and YAP1. Additionally, our data confirmed that OTUB1 deubiquitinated YAP1 and promoted its protein stabilization. We further emphasized whether OTUB1 mediates the impact of SOX18 on EMS progression and the Hippo/YAP1 signaling pathway. Rescue experiment results demonstrated that knocking down OTUB1 abrogated the effect of SOX18 overexpression, suggesting that the SOX18-OTUB1-YAP1 axis played a vital role during EMS.

However, there are some limitations to this study. First, the results of this study are expected to provide a new theoretical basis and a new target for the early detection, diagnosis, and clinical treatment of EMS. However, further validation of additional EMS patient samples is needed to confirm the clinical value of SOX18. In addition, we performed functional experiments using Ishikawa cells instead of primary endometrial epithelial cells, which may lead to unreliable conclusions. Finally, EMS may involve other pathogenic mechanisms. For example, SOX18 may also affect the progression of EMS by regulating NF-kappa B signaling pathway and PI3K-Akt signaling pathway. Thus, the deeper mechanism of SOX18 also need to be further studied.

Conclusions

According to these findings, our study provides in vitro and in vivo evidence to shed light on the role of SOX18 in EMS and reveal its potential molecular mechanism (Fig. 9). Targeting the SOX18-OTUB1-YAP1 axis may be a promising treatment strategy for EMS.

Fig. 9.

Fig. 9

Schematic illustration showing the mechanism of SOX18-OTUB1-YAP1 axis in promoting EMS progression

Electronic Supplementary Material

Below is the link to the electronic supplementary material.

Supplementary Material 1 (70.6KB, docx)

Acknowledgements

We thank the staff of Second Affiliated Hospital of Nanchang University for their efforts in clinical sample collection.

Author contributions

Ying Feng did experiments, wrote and revised the manuscript. Jiamei Yue, Si Fan and Jiayan Wu collected data, performed data analysis and summarized the results. All authors reviewed and approved the final version of the manuscript.

Funding

This work was supported by the Natural Science Foundation of Jiangxi Province (Grant No. 20232BAB206027).

Data availability

All data generated or analyzed during this study are available from the corresponding author upon reasonable request.

Declarations

Ethics approval

The clinical study was approved by the Medical Ethics Committee of the Second Affiliated Hospital of Nanchang University and conducted in accordance with the Declaration of Helsinki. The animal experiments were in lined with Guide for the Care and Use of Laboratory Animals, and approved by Ethics Committee of the Nanchang University.

Consent for publication

All authors approved the final manuscript and the submission to this journal.

Competing interests

The authors state that there are no conflicts of interest.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Zondervan KT, Becker CM, Koga K, Missmer SA, Taylor RN. Vigano P: endometriosis. Nat Rev Dis Primers. 2018;4:9. [DOI] [PubMed] [Google Scholar]
  • 2.Malvezzi H, Marengo EB, Podgaec S, Piccinato CA. Endometriosis: current challenges in modeling a multifactorial disease of unknown etiology. J Transl Med. 2020;18:311. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Gruber TM, Mechsner S. Pathogenesis of endometriosis: the origin of pain and subfertility. Cells. 2021;10. [DOI] [PMC free article] [PubMed]
  • 4.Matias-Guiu X, Stewart CJR. Endometriosis-associated ovarian neoplasia. Pathology. 2018;50:190–204. [DOI] [PubMed] [Google Scholar]
  • 5.Falcone T, Flyckt R. Clinical management of endometriosis. Obstet Gynecol. 2018;131:557–71. [DOI] [PubMed] [Google Scholar]
  • 6.Grimm D, Bauer J, Wise P, Kruger M, Simonsen U, Wehland M, Infanger M, Corydon TJ. The role of SOX family members in solid tumours and metastasis. Semin Cancer Biol. 2020;67:122–53. [DOI] [PubMed] [Google Scholar]
  • 7.Chen J, Feng W, Sun M, Huang W, Wang G, Chen X, Yin Y, Chen X, Zhang B, Nie Y, et al. TGF-beta1-Induced SOX18 elevation promotes hepatocellular carcinoma progression and metastasis through transcriptionally upregulating PD-L1 and CXCL12. Gastroenterology. 2024;167:264–80. [DOI] [PubMed] [Google Scholar]
  • 8.Huaqi Y, Caipeng Q, Qiang W, Yiqing D, Tao X. The role of SOX18 in bladder cancer and its underlying mechanism in mediating cellular functions. Life Sci. 2019;232:116614. [DOI] [PubMed] [Google Scholar]
  • 9.Chen J, Dang Y, Feng W, Qiao C, Liu D, Zhang T, Wang Y, Tian D, Fan D, Nie Y, et al. SOX18 promotes gastric cancer metastasis through transactivating MCAM and CCL7. Oncogene. 2020;39:5536–52. [DOI] [PubMed] [Google Scholar]
  • 10.Huaqi Y, Caipeng Q, Qiang W, Yiqing D, Xiang D, Xu T, Xiaowei Z, Qing L, Shijun L, Tao X. Transcription factor SOX18 promotes clear cell renal cell carcinoma progression and alleviates Cabozantinib-Mediated inhibitory effects. Mol Cancer Ther. 2019;18:2433–45. [DOI] [PubMed] [Google Scholar]
  • 11.Yin H, Sheng Z, Zhang X, Du Y, Qin C, Liu H, Dun Y, Wang Q, Jin C, Zhao Y, Xu T. Overexpression of SOX18 promotes prostate cancer progression via the regulation of TCF1, c-Myc, Cyclin D1 and MMP-7. Oncol Rep. 2017;37:1045–51. [DOI] [PubMed] [Google Scholar]
  • 12.Jiang T, Li Z, Zhao D, Hui B, Zheng Z. SOX18 enhances the proliferation and migration of airway smooth muscle cells induced by tumor necrosis factor-alpha via the regulation of Notch1 signaling. Int Immunopharmacol. 2021;96:107746. [DOI] [PubMed] [Google Scholar]
  • 13.Zhao B, Tumaneng K, Guan KL. The Hippo pathway in organ size control, tissue regeneration and stem cell self-renewal. Nat Cell Biol. 2011;13:877–83. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Zhao W, Wang M, Cai M, Zhang C, Qiu Y, Wang X, Zhang T, Zhou H, Wang J, Zhao W, Shao R. Transcriptional co-activators YAP/TAZ: potential therapeutic targets for metastatic breast cancer. Biomed Pharmacother. 2021;133:110956. [DOI] [PubMed] [Google Scholar]
  • 15.Mui CW, Chan WN, Chen B, Cheung AH, Yu J, Lo KW, Ke H, Kang W, To KF. Targeting YAP1/TAZ in nonsmall-cell lung carcinoma: from molecular mechanisms to precision medicine. Int J Cancer. 2023;152:558–71. [DOI] [PubMed] [Google Scholar]
  • 16.Song Y, Fu J, Zhou M, Xiao L, Feng X, Chen H, Huang W. Activated Hippo/Yes-Associated protein pathway promotes cell proliferation and Anti-apoptosis in endometrial stromal cells of endometriosis. J Clin Endocrinol Metab. 2016;101:1552–61. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Herhaus L, Al-Salihi M, Macartney T, Weidlich S, Sapkota GP. OTUB1 enhances TGFbeta signalling by inhibiting the ubiquitylation and degradation of active SMAD2/3. Nat Commun. 2013;4:2519. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Zhu D, Xu R, Huang X, Tang Z, Tian Y, Zhang J, Zheng X. Deubiquitinating enzyme OTUB1 promotes cancer cell immunosuppression via preventing ER-associated degradation of immune checkpoint protein PD-L1. Cell Death Differ. 2021;28:1773–89. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Han X, Ren C, Lu C, Qiao P, Yang T, Yu Z. Deubiquitination of MYC by OTUB1 contributes to HK2 mediated Glycolysis and breast tumorigenesis. Cell Death Differ. 2022;29:1864–73. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Ling X, Lu J, Wang X, Liu L, Liu L, Wang Y, Sun Y, Ren C, Lu C, Yu Z. Ovarian tumorB1-mediated heat shock transcription factor 1 deubiquitination is critical for Glycolysis and development of endometriosis. iScience. 2022;25:105363. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Yan C, Yang H, Su P, Li X, Li Z, Wang D, Zang Y, Wang T, Liu Z, Bao Z, et al. OTUB1 suppresses Hippo signaling via modulating YAP protein in gastric cancer. Oncogene. 2022;41:5186–98. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Zhang Z, Wang J, Chen Y, Suo L, Chen H, Zhu L, Wan G, Han X. Activin a promotes myofibroblast differentiation of endometrial mesenchymal stem cells via STAT3-dependent smad/ctgf pathway. Cell Commun Signal. 2019;17:45. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Giudice LC. Clinical practice. Endometriosis. N Engl J Med. 2010;362:2389–98. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Xiong W, Zhang L, Liu H, Li N, Du Y, He H, Zhang Z, Liu Y. E(2) -mediated EMT by activation of beta-catenin/Snail signalling during the development of ovarian endometriosis. J Cell Mol Med. 2019;23:8035–45. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Ruan J, Tian Q, Li S, Zhou X, Sun Q, Wang Y, Xiao Y, Li M, Chang K, Yi X. The IL-33-ST2 axis plays a vital role in endometriosis via promoting epithelial-mesenchymal transition by phosphorylating beta-catenin. Cell Commun Signal. 2024;22:318. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Chen J, Du F, Dang Y, Li X, Qian M, Feng W, Qiao C, Fan D, Nie Y, Wu K, Xia L. Fibroblast growth factor 19-Mediated Up-regulation of SYR-Related High-Mobility group box 18 promotes hepatocellular carcinoma metastasis by transactivating fibroblast growth factor receptor 4 and Fms-Related tyrosine kinase 4. Hepatology. 2020;71:1712–31. [DOI] [PubMed] [Google Scholar]
  • 27.Xu Y, Zhang Q, Zhou J, Li Z, Guo J, Wang W, Wang W. Down-regulation of SOX18 inhibits laryngeal carcinoma cell proliferation, migration, and invasion through JAK2/STAT3 signaling. Biosci Rep. 2019;39. [DOI] [PMC free article] [PubMed]
  • 28.Miao Z, Deng X, Shuai P, Zeng J. Upregulation of SOX18 in colorectal cancer cells promotes proliferation and correlates with colorectal cancer risk. Onco Targets Ther. 2018;11:8481–90. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Huang Y, Wang Z, Li B, Ke L, Xiong Y, Zhang Y. Loss of KLF15 impairs endometrial receptivity by inhibiting EMT in endometriosis. J Endocrinol. 2024;261. [DOI] [PMC free article] [PubMed]
  • 30.Akrida I, Makrygianni M, Nikou S, Mulita F, Bravou V, Papadaki H. Hippo pathway effectors YAP, TAZ and TEAD are associated with EMT master regulators ZEB, snail and with aggressive phenotype in phyllodes breast tumors. Pathol Res Pract. 2024;262:155551. [DOI] [PubMed] [Google Scholar]
  • 31.Yu M, Chen Y, Li X, Yang R, Zhang L, Huangfu L, Zheng N, Zhao X, Lv L, Hong Y, et al. YAP1 contributes to NSCLC invasion and migration by promoting slug transcription via the transcription co-factor TEAD. Cell Death Dis. 2018;9:464. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material 1 (70.6KB, docx)

Data Availability Statement

All data generated or analyzed during this study are available from the corresponding author upon reasonable request.


Articles from Journal of Translational Medicine are provided here courtesy of BMC

RESOURCES