Skip to main content
NCBI home page
Journal of Cancer Research and Clinical Oncology logoLink to Journal of Cancer Research and Clinical Oncology
. 2004 Aug 31;130(12):719–727. doi: 10.1007/s00432-004-0595-2

KIAA0008 gene is associated with invasive phenotype of human hepatocellular carcinoma—a functional analysis

Lei Zhao 1, Lun-Xiu Qin 1, Qing-Hai Ye 1, Xiao-Qun Zhu 1, Hui Zhang 1, Xin Wu 1, Jie Chen 1, Yin-Kun Liu 1, Zhao-You Tang 1,✉
PMCID: PMC12161794  PMID: 15340842

Abstract

Purpose

To investigate the function of the KIAA0008 gene, one of the leading genes in the signature associated with hepatocellular carcinoma (HCC) metastasis selected by cDNA microarray, and especially its possible roles in invasion and metastasis of hepatocellular carcinoma.

Methods

Expression levels of KIAA0008 in 27 primary tumors and 23 matched non-tumor liver tissues from HCC patients, and four HCC cell lines with different metastatic potentials were detected by semi-quantitative RT-PCR and real-time RT-PCR. Recombinant expression plasmid vectors of the KIAA0008 gene were constructed and transfected into HCC cells. The subcellular localization of the KIAA0008 gene product and in vitro effects of KIAA0008 overexpression on proliferation and invasion of HCC cell line were also investigated.

Results

Expression levels of KIAA0008 in HCC tissues were statistically higher than those of paired non-tumorous liver tissues (P<0.001, paired Wilcoxon test), and in HCCs with high invasiveness these were statistically higher than those with low invasiveness (P=0.002, Mann-Whitney test). In the four HCC cell lines with an identical genetic background and stepwise higher invasiveness potentials, its expression was consistent with their invasiveness potential. The KIAA0008 gene product was concentrated on the nucleus and cell membrane of HCC cells, without any distribution in the cytoplasm. Overexpression of KIAA0008 in the MHCC97L cell line resulted in increased cell proliferation, colony formation, and invasion.

Conclusions

KIAA0008 expression is associated with invasiveness of HCC; overexpression of KIAA0008 leads to a more invasive phenotype of HCC cell lines.

Keywords: Hepatocellular carcinoma (HCC), KIAA0008 gene, Invasion, Metastasis

Introduction

Human hepatocellular carcinoma (HCC) is a common and aggressive neoplasm with high prevalence in Asia and Africa (Parkin et al. 2001), and recent studies show that its incidence has increased remarkably in males in countries such as Japan, Italy, France, Switzerland, the United States of America, and the United Kingdom (Tominaga et al. 1998; Taylor-Robinson et al. 1997; El-Serag and Mason 1999). Only a small subset of HCC patients have the possibility of being cured by curative resection. Despite diverse para-operative treatment and the clinical progress achieved in recent years, the overall outcome of HCC remains dismal, which is largely the result of a high rate of recurrence or metastasis after operations (Cance et al. 2000; Zhou et al. 2001; Tang 2001). Therefore, the invasiveness of HCC has become a major obstacle to better prognosis and a major target for researchers. More attention has been paid to the study of genes associated with the invasiveness of HCC.

With the application of high-throughput gene analysis techniques, such as cDNA microarray, serial analysis of gene expression (SAGE), etc., it has become possible to screen the genes of interest and help to elucidate the molecular mechanism of invasion and metastasis of cancers, including HCC. Our institute collaborated with the NCI and NIH of the United States. Using a cDNA array of 9,180 genes, we identified 153 candidate genes when HCC specimens with and without metastasis were compared and the KIAA0008 gene was one of the leading genes (Ye et al. 2003). Up to now, the function of this gene, particularly in the development and progression of cancer, has remained unknown (Bassal et al. 2001). To address this issue, we examined the expression of KIAA0008 mRNA in the resected HCC specimens with different invasiveness potentials, and in a series of HCC cell lines with identical genetic background but different invasiveness potential. Then we constructed two kinds of recombinant plasmid vectors that contain a full length KIAA0008 gene, and studied their effects on the invasion and proliferation of HCC cells in vitro through gene transfection.

Materials and methods

Tumor specimens and cells lines

Twenty-seven primary HCC tissues, 23 paired surrounding non-tumor liver tissues, and five metastatic HCC tissues (intrahepatic spreading or tumor thrombosis in the portal vein) were obtained from 27 patients [age, 49.9±11.3 years (mean±SD)] who received surgical resection at the Liver Cancer Institute and Zhongshan Hospital of Fudan University (former Shanghai Medical University, Shanghai, China) from June 2002 to December 2002. In these patients, 92.6% (25/27) were males, 40.7% (11/27) showed positive α-fetoprotein, 92.6% (25/27) showed positive HBsAg, and 85.2% (23/27) were accompanied by liver cirrhosis. All of them were pathologically diagnosed as having HCC. Among these, 11 cases were of low invasiveness (localized tumors without any intrahepatic spreading or vessel invasion, neither gross nor microscopic; tumor size ≤ 5 cm in diameter) and eight cases of were of high invasiveness (tumor with multiple intrahepatic spreading and/or tumor thrombosis in the main trunk of the portal vein; tumor size >5 cm in diameter). The remaining eight cases were of median invasiveness. Tumors and non-tumor tissues were grossly dissected, snap-frozen in liquid nitrogen immediately after removal, and stored at −75 °C till use.

Serial HCC cell lines, MHCC97L, MHCC97H, HCCLM3, and HCCLM6, were established and maintained in the authors’ institute. They were subcloned from the same parent MHCC97 cell line with stepwise increasing metastatic potentials and identical genetic background. From MHCC97L to HCCLM6, the pulmonary metastatic rates were 40%, 100%, 100%, and 100%, respectively. Compared with MHCC97H, HCCLM3 and HCCLM6 showed a more aggressive potential of abdominal wall, intra-abdominal cavity, diaphragm, and intrahepatic metastasis (Sun et al. 1996; Tian et al. 1999; Li et al. 2001; Li et al. 2003; Li et al. 2004). They were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco BRL, N.Y., USA) supplemented with 10% (v/v) fetal calf serum (Hyclone, Utah, USA) at 37 °C in a humidified incubator containing 5% CO2.

RNA extraction

Total RNA was extracted from clinical samples or cultured HCC cell lines using Trizol reagent (Life Technologies, Gaithersburg, Md., USA) according to the manufacturer’s instructions. Briefly, approximately 100 mg of each sample or 106 of cultured cells was homogenized in 1 ml of Trizol, centrifuged after adding chloroform to separate different phases, then RNA was precipitated by isopropanol, washed with and stored in 75% ethanol at −75 °C till further examination. RNA quality was evaluated by spectrophotometry and then electrophoresis on a 1% denaturing formaldehyde-agarose gel.

Semi-quantitative RT-PCR

One microgram of total RNA was reverse-transcribed in a reaction volume of 20 μl using RevertAid H Minus M-MuLV Reverse Transcriptase (MBI Fermentas) following the manufacturer’s instructions. The primers for KIAA0008 were designed as 5’ -AGGCTATTCCATCTTCTGTA-3’ (sense) and 5’-CTTGTTGCATTAGTTTGTG-3’ (antisense) to generate a 406 bp PCR product. The β-actin gene was amplified in parallel to serve as an internal control. Aliquots of 2 μl of the reserve-transcribed cDNA samples were added to a 50-μl reaction mixture which contained 5 μl of 10× buffer, 2 μl of 10 mM dNTPs mix, 4 μl of 25 mM mgCl2, 2.5 μl Taq DNA Polymerase (MBI, Fermentas), and 1 μl of each 10 μM primer. PCR conditions were optimized by adjusting the annealing temperature, and a prior PCR cycle optimization was done to ensure that all the reactions remained in the linear region. The PCR was performed for 1 cycle of 95 °C for 3 min, followed by 26 cycles of denaturation at 94 °C for 45 s, annealing at 51 °C for 45 s, and elongation at 72 °C for 45 s, with a final elongation at 72 °C for 10 min.

The PCR products were electrophoresed in 1% agarose gels containing ethidium bromide together with DNA markers, visualized under UV, and analyzed by densitometric scanning (ImagineMaster VDS, Pharmacia Biotech) using ImagineMaster VDS Software (version 2.0).

Real-time RT-PCR

To quantitatively determine the expression level of KIAA0008 mRNA in the HCC tissue samples and cell lines, real-time quantitative RT-PCR analyses were performed using the DNA Engine Opticon system, Opticon Monitor software (Version 1.02) (MJ Research, Reno, Nev., USA) and QuantiTect SYBR Green RT-PCR kit (Qiagen). The GAPDH mRNA was detected at the same time to serve as internal reference. Primers sequences used for KIAA0008 were: 5’-CATCTGGAATGTCCAATTCAAG-3’ (sense) and 5’-ATGAAGGTCGAATTGCTCAG-3’ (antisense); primers sequences used for GAPDH were: 5’-ATGACCCCTTCATTGACC-3’ (sense) and 5’-GAAGATGGTGATGGGATTTC-3’ (antisense). Recombinant plasmid pEGFP-C3-KIAA0008, whose molecular copies had been calculated, was tenfold diluted from 1×108 to 1×104 to generate the standard curve of KIAA0008. Similarly, the standard curve of GAPDH was generated by a commercially provided cloning vector, in which a fragment of the GAPDH sequence had been inserted. The 20-μl reaction mixture containing 10 μl 2× QuantiTect SYBR Green RT-PCR Master Mix, 0.2 μl of each 10 mM primers, 0.2 μl of QuantiTect RT Mix, 250 ng of template RNA, and RNase-free water, was incubated at 50 °C for 30 min for reverse transcription, then at 95 °C for 15 min to activate HotStarTaq DNA Polymerase, deactivate Omniscript and Sensiscript Reverse Transcriptases, and denature template cDNA. PCR was performed for 45 cycles of denaturation at 94 °C for 15 s, annealing at 56 °C for 30 s, and extension at 72 °C for 30 s. Data acquisition was performed after each cycle. When all cycles were complete, a melting curve analysis was performed to verify the specificity and identity of the RT-PCR products. The molecular copy numbers of KIAA0008 and GAPDH mRNA were calculated based on the standard curves, and the ratio of the KIAA0008 mRNA copy number to GAPDH was used to indicate the expression level of KIAA0008.

Construction of expression plasmid of KIAA0008 gene and in vitro transfection

Full-length cDNA of KIAA0008 was amplified by PCR (High Fidelity PCR Enzyme Mix; MBI, Fermentas) from recombinant plasmid vector pBC SK+ in which the full-length KIAA0008 cDNA had been inserted (kindly provided by Prof. Takahiro Nagase, Kazusa DNA Research Institute, Japan), and then cloned into two types of expression vectors for further functional analyses. First, the full-length KIAA0008 sequence was cloned into expression plasmid vector pEGFP-C3 (Clontech, Palo Alto, Calif., USA) to construct pEGFP-C3-KIAA0008. In this recombinant plasmid vector, the KIAA0008 gene was fused with the enhanced green fluorescent protein gene (EGFP), so that the distribution of the KIAA0008 gene product could be visualized under fluorescence microscope. This kind of recombinant vector was transfected into HCCLM3 cell lines. The second recombinant plasmid vector was constructed by using pIRES2-EGFP (Clontech) to promote high-level expression of KIAA0008; this kind of recombinant plasmid vector was used to transfect MHCC97L cell lines, which originally showed a relatively lower level of KIAA0008 expression, and then subjected to in vitro functional studies. In both cases, cell lines transfected with corresponding empty plasmid vectors served as controls. In order to make sure that KIAA0008 had expressed in the transfected cells, total RNA was extracted and KIAA0008 detected by real-time RT-PCR. Two artificial restriction endonuclease sites were introduced into both sides of the KIAA0008 sequence via primers designing (Table 1). Then both the PCR products and the expression plasmid vectors were double-digested by proper restriction endonucleases and purified by agarose gel electrophoresis and extraction (QIAquick Gel Extraction Kit, Qiagen). The digested KIAA0008 sequence was ligated into linear pEGFP-C3 and pIRES2-EGFP plasmid vectors using T4 DNA ligase (MBI, Fermentas) following the manufacturer’s protocol. Transformation products were added into 1 ml SOC medium and incubated at room temperature with gentle rotation for 1 h, then 50 μl SOC was plated onto selective LB agar medium to screen for the positive clones. Plasmid DNA was then extracted from bacteria amplified from the single positive clones and tested by double restriction endonucleases digestion and DNA sequencing, to make sure that the KIAA0008 gene had been inserted into the plasmid vectors correctly. The recombinant plasmids were named pEGFP-C3-KIAA0008 and pIRES2-EGFP-KIA0008, respectively.

Table 1.

Multiple cloning sites (MCS) and primers used for two expression plasmids. Primers used to amplify full-length KIAA0008 by PCR. Proper artificial restriction endonuclease sites were introduced by sequence design

Plasmid MCS Primers for PCR Restriction sites introduced
pEGFP-C3 tactcagatctcgagctcaagcttcgaattctgcagtcgacggtaccgcgggcccgggatccaccggatctagataactgatca 5’-atgcaagcttttcgttcctgcttcggagtc-3’ HindIII
5’-ccggggatcccaaggcacagtacattttttattctgtg-3’ BamHI
pIRES2-EGFP gctagcgctaccggactcagatctcgagctcaagcttcgaattctgcagtcgacggtaccgcgggcccgggatcc 5’-gctggctagcttcgttcctgcttcggagtc-3’ NheI
5’-ccggggatcccaaggcacagtacattttttattctgtg-3’ BamHI
Open in a new tab

The recombinant plasmids were transfected into the different HCC cell lines using lipofectamine 2000 according to the instructions from the manufacturer (Invitrogen), with the empty plasmid transfection as controls. Briefly, plasmid DNA (8 μg) and lipofectamine 2000 reagent (20 μl) were diluted in 500 μl of Opti-MEMI Reduced Serum Medium, respectively, then mixed together, incubated at room temperature for 20 min, and added into cultured HCC cells. After incubation at 37 °C for 10 h, the medium was removed and cells refreshed with fresh complete medium and maintained for an additional 12–48 h ready for fluorescence observation and transfection efficiency analysis.

Subcellular localization of KIAA0008 by confocal microscopy

HCCLM3 cells were plated into 35-mm cell culture dishes on which a piece of aseptic coverglass was placed and incubated at 37 °C. When cells were attached to the coverglass, they were transfected by plasmids of pEGFP-C3 and pEGFP-C3-KIAA0008, respectively, as described above. Forty-eight hours after transfection, cells were washed three times with PBS and then fixed in 4% paraformaldehyde in 0.1 M phosphate buffer, pH 7.4, at 4 °C for 30 min, sealed by 50% glycerol and then examined by confocal microscopy (Zeiss, Oberkochen, Germany).

Cell proliferation assay

Cell proliferation assays were performed by using Cell Counting Kit-8 (Dojindo, Kumamoto, Japan). MHCC97L cells were transfected by plasmid vectors of pIRES2-EGFP and pIRES2-EGFP-KIAA0008, respectively, as described above. Twenty-four hours after transfection, the cells were trypsinized and harvested, then resuspended and plated in 96-well plates at 1×103 per well in 100 μl cell culture medium and maintained at 37 °C in a humidified incubator containing 5% CO2. At the indicated time points, 10 μl of the CCK-8 solution was added into the triplicate wells and incubated for 3 h, then absorbance at 450 nm was measured to calculate the numbers of vital cells in each well. The absorbance at 630 nm was measured at the same time to serve as the reference.

Colony formation assay

The colony formation assay was performed to measure growth promotion by KIAA0008 gene transfection on MHCC97L cells according to the previously reported protocol (Zhang et al. 2003) with some modifications. Twenty-four hours after transient transfection by control (pIRES2-EGFP) and recombinant (pIRES2-EGFP-KIAA0008) plasmid vectors, respectively, the transfected cells were trypsinized and harvested, washed, and resuspended in complete medium containing 400 μg/ml G418. Identical numbers of empty or recombinant plasmid-transfected cells were plated in 6-well tissue culture plates to allow resistant cells to form colonies. After 10 days incubation at 37 °C in a humidified CO2 incubator, cells were stained with Giemsa stain, and the cut-off point for colony size was ≥ 20 cells/colony. The number of colonies was counted within a field at ×200 under a light microscope. For each test, a total of five fields were selected at random, and the numbers were averaged. The assay was triply repeated with 0.5×104, 1×104, and 2×104 of the cells seeded, respectively.

In vitro matrigel invasion assay

In vitro invasion assay were performed as previously described by Giannelli et al. (Giannelli et al. 2002) with modifications. Briefly, 100 μl of serum-free DMEM-diluted matrigel (0.8 mg/ml) (BD Biosciences, San Jose, Calif., USA) was added to the Transwell filters (8.0-μm pore size; Corning, N.Y., USA) of a Boyden chamber and incubated at 37 °C for 2 h to form matrix gels. MHCC97L cells (1×105) transfected with pIRES2-EGFP-KIAA0008 vector or pIRES2-EGFP vector were suspended in 100 μl serum-free DMEM and added to the top of the gels in the triplicate chambers; a mixture of 200 μl DMEM with 10% fetal calf serum, 200 μl supernatant of MHCC97L cell culture, and 200 μl supernatant of NIH/3T3 cell culture was added to the lower chamber to serve as the chemoattractant. After 48 h of incubation at 37 °C, the upper surface of the filters was carefully wiped with a cotton-tipped applicator, and the filters were fixed with 4% paraformaldehyde in PBS and stained with Giemsa stain. Cells invaded across the matrigel and passed through the Transwell filter pores toward the lower surface of the filters, and these were counted in five nonoverlapping ×200 fields under a light microscope.

Statistical analysis

Statistical analyses were performed with software from SPSS 10.0 for Windows, (Chicago, Ill., USA). Results of real-time RT-PCR were evaluated by paired Wilcoxon tests for two paired groups, Mann-Whitney tests for two independent groups, and one-way ANOVA for multiple independent groups with the homogeneity of variances test as reference. The results of the cell proliferation assay, colony formation assay, and in vitro invasion assay were evaluated by Student’s t-tests. A P value <0.05 was taken as the level of significance.

Results

Expression of KIAA0008 mRNA in highly invasive human HCC tissue and cell lines

The expression levels of KIAA0008 mRNA were detected in 27 HCC patients using both RT-PCR and real-time RT-PCR. First, with RT-PCR, KIAA0008 was found to be overexpressed in HCC tissues, compared with the paired non-tumor liver tissues, and its expression was significantly higher in the invasive HCC tissues than those in the low invasiveness group (Fig. 1A).

Fig. 1A–C.

Fig. 1A–C

Open in a new tab

Expression of KIAA0008 in surgical specimens of HCC patients and cell lines. T primary HCC tissues, N- non-tumor liver tissues, M- metastatic HCC tissues (intrahepatic spreading or tumor thrombosis). A Detection of KIAA0008 in HCCs specimens by semi-quantitative RT-PCR. A1 Two HCCs of low invasiveness, A3 two HCCs of high invasiveness, and A2 two HCCs of median invasiveness. β-actin served as the internal control; B Expression level of KIAA0008 in clinical specimens by real-time RT-PCR. A1–8 cases of low invasiveness HCC, A2–11 cases of median invasiveness HCC, A3–8 cases of high invasiveness HCC; C Expression level of KIAA0008 in four HCC cell lines by real-time RT-PCR

Quantitative and more accurate results were then obtained by using real-time RT-PCR. The expression levels of KIAA0008 in 23 cases of HCC were found to be significantly higher than those of the paired non-tumorous liver tissue (1.05E-3 vs 3.97E-4, medians, Z = −3.83, P<0.001, paired Wilcoxon test) (Fig. 1B). The expression levels of KIAA0008 in HCCs with high invasiveness were significantly higher than those of low invasiveness (1.29E-3 vs 1.62E-4, medians, Z = −3.14, P=0.002, Mann-Whitney test).

It was found (Fig. 1C) that, from MHCC97L to HCCLM3, the increase of invasion and metastatic potentials increased consistently with the expression levels of KIAA0008. The highest level of the KIAA0008 gene was found in the HCCLM3 cells. The KIAA0008 level in HCCLM6 cells was slightly lower than that in HCCLM3; however, it was still much higher than that in MHCC97L and MHCC97H cells.

Construction and transient transfection of recombinant plasmid vectors

Two kinds of recombinant expression plasmids, pEGFG-C3-KIAA0008 and pIRES2-EGFP-KIAA0008, were constructed successfully, and transfected HCC cell lines of HCCLM3 and MHCC97L, respectively. The results show that in both recombinant plasmids, transfection efficiency was similar to the corresponding empty plasmid. Compared with the control, the expression level of KIAA0008 increased dramatically in the MHCC97L cell line after being transfected by pIRES2-EGFP-KIAA0008 (Fig. 2).

Fig. 2A,B.

Fig. 2A,B

Open in a new tab

Transient transfection of HCCLM3 or MHCC97L cell lines. A1–A2 Light and fluorescent microscopic photographs of HCCLM3 transfected with pEGFP-C3-KIAA0008; B1–B2 Light and fluorescent microscopic photographs of MHCC97L transfected with pIRES2-EGFP-KIAA0008; B3–B4 Expression levels of KIAA0008 were detected by real-time RT-PCR. KIAA0008 expression levels were significantly higher in MHCC97L transfected with pIRES2-EGFP-KIAA0008 (B4) compared with that transfected with pIRES2-EGFP (B3)

Subcellular localization of gene product of KIAA0008 in HCCLM3 cells

In HCCLM3 cells transfected by pEGFP-C3, the EGFP signal was found to distribute evenly in the whole cell. However, in the HCCLM3 cells transfected by pEGFP-C3-KIAA0008, EGFP-KIAA0008 fusion protein was found to concentrate in the nucleus and cell membrane, without any distribution in the cytoplasm (Fig. 3).

Fig. 3A,B.

Fig. 3A,B

Open in a new tab

Subcellular localization of gene product of KIAA0008 in HCCLM3 cells. A HCCLM3 cells transfected by pEGFP-C3, fluorescence was found to distribute evenly in whole cell; B HCCLM3 cells transfected by pEGFP-C3-KIAA0008, and fluorescence was found to concentrate in the nucleus and cell membrane, without distribution in cytoplasm

In vitro effect of KIAA0008 overexpression on MHCC97L cell lines

As shown in Fig. 4, compared with the control cells with pIRES2-EGFP transfection, overexpression of KIAA0008 promoted the proliferation of MHCC97L cells. On day 4, absorbance at 450 nm in the group with recombinant vector transfection was significantly higher than that in the control (1.79±0.06 vs 0.96±0.10, mean±SD, P<0.001). In all of the three groups, recombinant vector-transfected cells formed more colonies than the control, but the statistically significant difference was only observed in the group of 2×104 cells (14.4±3.97 vs 8.6±2.40, mean±SD, P=0.024) (Fig. 5).

Fig. 4.

Fig. 4

Open in a new tab

Cell proliferation assay of MHCC97L cells. Absorbance at 450 nm was measured in triplicate wells to stand for the numbers of vital cells, and absorbance at 630 nm served as the reference. *On day 4: E.Vec vs R.Vec: 1.79±0.10 vs 0.96±0.06; means±SD. P<0.001. E.Vec Cells transfected by empty pIRES2-EGFP plasmids, R.Vec Cells transfected by recombinant pIRES2-EGFP-KIAA0008 plasmids

Fig. 5A–C.

Fig. 5A–C

Open in a new tab

Colony formation assay (2×104 cells). A MHCC97L cells transfected by pIRES2-EGFP; B MHCC97L cells transfected by pIRES2-EGFP-KIAA0008; C Results showed that in all three groups, colonies formed in the recombinant vector-transfected cells were more than those in the cells transfected with empty vector, while a significant (14.4±3.97 vs 8.6±2.40 mean±SD P=0.024) difference was only observed in the group of 2×104 cells

In the group with recombinant vectors transfection, the mean number of cells invading through the Transwell filter pores was significantly higher than that of the control group (18.8±5.31 vs 11.8±3.34, mean±SD, P=0.037) (Fig. 6), indicating that overexpression of KIAA0008 could promote the invasion of MHCC97L cells.

Fig. 6A–B.

Fig. 6A–B

Open in a new tab

In vitro matrigel invasion assay. MHCC97L cells transfected with pIRES2-EGFP-KIAA0008 showed higher invasiveness than the control. (18.8±5.31 vs 11.8±3.34, mean±SD, P=0.037). A MHCC97L cells transfected by pIRES2-EGFP; B MHCC97L cells transfected by pIRES2-EGFP-KIAA0008

Discussion

Tumor invasion is an important issue for understanding tumor biology and further improving the prognosis of patients with carcinomas, including HCC. This is a very complex process with multiple promoters or suppressor genes involved. Understanding the genes responsible for either enhancing or suppressing this process would enable novel diagnostic, therapeutic, and prognostic applications to evolve and thus improve the clinical outcome of HCC patients. In this field—gene microarray—the high-throughput gene analysis technique is becoming more and more widely used and fruitful. By using this technique, many invasiveness-related genes have been found in different kinds of tumors (MacDonald et al. 2001; Yu et al. 2004; Wang and Chen 2002; Gildea 2002).

Using a cDNA array of 9,180 genes, we identified 153 candidate genes at a significance level of P<0.001 when HCC specimens with and without metastasis were compared. With thesese 153 genes, a molecular predicting model was generated for the first time, which can be used to predict whether an HCC has the potential to metastasize. All these results confirm the feasibility of gene microarray to explore invasiveness-related genes, and that the validation of the results from gene microarray is essential.

The KIAA0008 gene was one of the clusters of genes related to the metastasis of HCC. This suggested that overexpression of KIAA0008 gene might play some role in HCC invasion and metastasis (Ye et al. 2003).

Together with other 39 new genes, KIAA0008 was first cloned and reported in 1994 (Nomura et al. 1995). Until 2001, there was no report about the functional analysis and possible roles of this gene in physiological/pathophysiological processes. In 2001, Bassal et al. (Bassal et al. 2001) found that KIAA008 located at chromosome 14q22-q23, and that its expression began during the S-phase and was maintained throughout the G2- and M-phases of Hela cells; its transcript levels were abundant in highly proliferative tissues such as thymus, testis, and colon. KIAA0008 was also found to be expressed in approximately 10% of breast and colon tumors, as compared with insignificant detection rates in normal specimens.

To explore the possible role of the KIAA0008 gene in the invasion and metastasis of HCC, in this study its transcriptional levels were investigated in the matched tumor tissues and non-tumor liver tissues. We found that KIAA0008 was overexpressed in HCC tissues, whereas it was either down-regulated or lost in many paired non-tumorous tissues; its expression level was significantly higher in primary tumors with high invasiveness as well as matched metastatic HCC tissue than that in primary tumors with lower invasiveness. This further validated the previous results of the cDNA microarray study, suggesting that expression of KIAA0008 might be associated with invasion and metastasis of HCC (Ye et al. 2003). This was further confirmed by the results obtained from HCC cell lines with an identical genetic background and different metastatic potentials. To our knowledge, this is the first report about the association of KIAA0008 and invasion and metastasis of HCC as well as other malignant tumors.

To further evaluate the functional significance of the overexpression of KIAA0008 in HCC, we constructed recombinant plasmid vectors and transfected it into HCC cell lines. In this regard, the ideal candidate HCC cell line should be the one that originally shows low invasiveness and low-level expression of the KIAA0008 gene, so that the effects of overexpression would be observed more clearly. Among our serial HCC cell lines, MHCC97L—which showed a relatively lower pulmonary metastatic rate of 40% and the lowest KIAA0008 expression level among these four HCC cell lines—became the best choice. We found that overexpression of KIAA0008 in transfected MHCC97L cell line could promote cell proliferation, colony formation, and invasion. This provided direct evidence that KIAA0008 expression is related to the invasiveness of HCC.

To explore the possible mechanisms of KIAA0008 on tumor invasion, we visualized the subcellular localization of the KIAA0008 gene product, and found that it was mainly concentrated in the nucleus and cell membrane, without any distribution in the cytoplasm. This distribution pattern was consistent with its possible role in cell cycle regulation (Bassal et al. 2001) and cell proliferation, communication, or invasion. Further validation of its function in cell cycle regulation is suggested, to study whether its expression is cell cycle-related, and whether it regulates or is regulated by other cell cycles or checkpoint regulators.

In summary, from the transcriptional analysis of clinical and cellular samples, and in vitro gene transfection studies, we have documented a strong association between KIAA0008 expression levels and the invasion and metastasis of HCCs. Overexpression of KIAA0008 leads to a more invasive phenotype of HCC. Further studies on the possible mechanisms of the KIAA0008 effect on invasion and metastasis of HCC are suggested.

Footnotes

This work was supported in part by the National Foundation for the Excellent Younger Researcher of China (30325041), the “863” R & D High-tech Key Project (2002BA711A02–4), the “973” State Key Basic Research Program Grant of China (G1998051211), the Fund for the Innovative Research Group in Shanghai, and the Fund for Outstanding Scholars of the New Era of the Ministry of Education in China (2003)

References

  1. Bassal S, Nomura N, Venter D, Brand K, McKay MJ, van der Spek PJ (2001) Characterization of a novel human cell-cycle-regulated homologue of Drosophila dlg1. Genomics 77:5–7 [DOI] [PubMed] [Google Scholar]
  2. Cance WG, Stewart AK, Menck HR (2000) The national cancer data base report on treatment patterns for hepatocellular carcinomas: improved survival of surgically resected patients, 1985–1996. Cancer 88:912–920 [DOI] [PubMed] [Google Scholar]
  3. El-Serag HB, Mason AC (1999) Rising incidence of hepatocellular carcinoma in the United States. N Engl J Med. 340:745–750 [DOI] [PubMed] [Google Scholar]
  4. Giannelli G, Fransvea E, Marinosci F, Bergamini C, Colucci S, Schiraldi O, Antonaci S (2002)Transforming growth factor-beta1 triggers hepatocellular carcinoma invasiveness via alpha3beta1 integrin. Am J Pathol 161:183–193 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Gildea JJ, Seraj MJ, Oxford G, Harding MA, Hampton GM, Moskaluk CA, Frierson HF, Conaway MR, Theodorescu D (2002) RhoGDI2 is an invasion and metastasis suppressor gene in human cancer. Cancer Res 62:6418–6423 [PubMed] [Google Scholar]
  6. Li Y, Tang ZY, Ye SL, Liu YK, Chen J, Xue Q, Chen J, Gao DM, Bao WH (2001) Establishment of cell clones with different metastatic potential from the metastatic hepatocellular carcinoma cell line MHCC97. World J Gastroenterol 7:630–636 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Li Y, Tang Y, Ye L, Liu B, Liu K, Chen J, Xue Q (2003) Establishment of a hepatocellular carcinoma cell line with unique metastatic characteristics through in vivo selection and screening for metastasis-related genes through cDNA microarray. J Cancer Res Clin Oncol 129:43–51 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Li Y, Tian B, Yang J, Zhao L, Wu X, Ye SL, Liu YK, Tang ZY (2004) Stepwise metastatic human hepatocellular carcinoma cell model system with multiple metastatic potentials established through consecutive in vivo selection and studies on metastatic characteristics. J Cancer Res Clin Oncol (In press) [DOI] [PMC free article] [PubMed]
  9. MacDonald TJ, Brown KM, LaFleur B, Peterson K, Lawlor C, Chen Y, Packer RJ, Cogen P, Stephan DA (2001) Expression profiling of medulloblastoma: PDGFRA and the RAS/MAPK pathway as therapeutic targets for metastatic disease. Nat Genet 29:143–152 [DOI] [PubMed] [Google Scholar]
  10. Nomura N, Miyajima N, Sazuka T, Tanaka A, Kawarabayasi Y, Sato S, Nagase T, Seki N, Ishikawa K, Tabata S (1995) Prediction of the coding sequences of unidentified human genes. I. The coding sequences of 40 new genes (KIAA0001-KIAA0040) deduced by analysis of randomly sampled cDNA clones from human immature myeloid cell line KG-1. DNA Res 1:27–35 [DOI] [PubMed] [Google Scholar]
  11. Parkin DM, Bray F, Ferlay J, Pisani P (2001) Estimating the world cancer burden: Globocan 2000. Int J Cancer 94:153–156 [DOI] [PubMed] [Google Scholar]
  12. Sun FX, Tang ZY, Liu KD, Ye SL, Xue Q, Gao DM, Ma ZC (1996) Establishment of a metastatic model of human hepatocellular carcinoma in nude mice via orthotopic implantation of histologically intact tissues. Int J Cancer 66:239–243 [DOI] [PubMed] [Google Scholar]
  13. Tang ZY (2001) Hepatocellular carcinoma--cause, treatment and metastasis. World J Gastroenterol 7:445–454 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Taylor-Robinson SD, Foster GR, Arora S, Hargreaves S, Thomas HC (1997) Increase in primary liver cancer in the UK, 1979–94. Lancet 350:1142–1143 [DOI] [PubMed] [Google Scholar]
  15. Tian J, Tang ZY, Ye SL, Liu YK, Lin ZY, Chen J, Xue Q (1999) New human hepatocellular carcinoma (HCC) cell line with highly metastatic potential (MHCC97) and its expressions of the factors associated with metastasis. Br J Cancer 81:814–821 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Tominaga S, Kuroishi T, Aoki S (1998) (UICC) (eds) Cancer mortality statistics in 33 countries 1953–1992. Roppo Shupan, Nagoya, pp 69
  17. Wang J, Chen S (2002) Screening and identification of gastric adenocarcinoma metastasis-related genes using cDNA microarray coupled to FDD-PCR. J Cancer Res Clin Oncol 128:547–553 [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  18. Ye QH, Qin LX, Forgues M, He P, Kim JW, Peng AC, Simon R, Li Y, Robles AI, Chen Y, Ma ZC, Wu ZQ, Ye SL, Liu YK, Tang ZY, Wang XW (2003) Predicting hepatitis B virus-positive metastatic hepatocellular carcinomas using gene expression profiling and supervised machine learning. Nat Med 9:416–423 [DOI] [PubMed] [Google Scholar]
  19. Yu Y, Khan J, Khanna C, Helman L, Meltzer PS, Merlino G (2004) Expression profiling identifies the cytoskeletal organizer ezrin and the developmental homeoprotein Six-1 as key metastatic regulators. Nat Med 10:175–181 [DOI] [PubMed] [Google Scholar]
  20. Zhang Z, Futamura M, Vikis HG, Wang M, Li J, Wang Y, Guan KL, You M (2003) Positional cloning of the major quantitative trait locus underlying lung tumor susceptibility in mice. Proc Natl Acad Sci USA 100:12642–12647 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Zhou XD, Tang ZY, Yang BH, Lin ZY, Ma ZC, Ye SL, Wu ZQ, Fan J, Qin LX, Zheng BH (2001) Experience of 1000 patients who underwent hepatectomy for small hepatocellular carcinoma. Cancer 91:1479–1486 [DOI] [PubMed] [Google Scholar]

Articles from Journal of Cancer Research and Clinical Oncology are provided here courtesy of Springer

RESOURCES