KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| PE/Cyanine7 anti-mouse CD45 (Clone 30-F11) | Biolegend | AB_103114 |
| FITC anti-mouse/human CD11b (Clone M1/70) | Biolegend | AB_101206 |
| PE anti-mouse Ly-6C (Clone HK 1.4) | Biolegend | AB_128008 |
| APC anti-mouse Ly-6G (Clone 1A8) | Biolegend | AB_127614 |
| (1–3)-beta-glucan-directed monoclonal antibody | Biosupplies Australia PTY LTD | AB_400–2 |
| Concanavalin A | Invitrogen | AB_C11252 |
| Goat Anti-Mouse IgG, Human ads- PE | Southern Biotech | AB_1030–09S |
| Goat Anti-mouse IgG AF647 | Abcam | AB_Ab150115 |
| Experimental models: organisms/strains | ||
| Candida albicans SC5314 | ATCC | MYA-2876 |
| Candida albicans ece1ΔΔ | Bernhard Hube (Leibniz Institute for Natural Product Research and Infection Biology- Hans Knoll Institute, Germany) | N/A |
| Candida albicans ECE1 revertant ece1ΔΔ + ECE1 | ||
| Candida albicans CAF2–1-dTomato | Michail Lionakis (NIH, Bethesda)70 | |
| Mouse: Hepcidin KO mice (Hamp−/−) | Sophie Vaulont (Institut Cochin, France) | N/A |
| Mouse: Inducible hepcidin KO mice (iHamp−/−) | Alexander Drakesmith (Oxford University, UK) | N/A |
| Chemicals, peptides, and recombinant proteins | ||
| Yeast Peptone Dextrose agar | Difco | DF0427-17-6 |
| YNB Broth w/o ammonium sulfate, w/o copper sulfate, w/o copper sulfate, w/o ferric chloride | MP Biomedicals | 4027112 |
| Yeast Peptone Dextrose Broth | Difco | DF0428-17-5 |
| Copper sulfate, Pentahydrate | LabCHem | LC134051 |
| Ferric Ammonium Citrate | Sigma | F5879 |
| Ammonium sulfate | Fisher chemical | A702–500 |
| Glucose | Sigma | G7021–100G |
| CSM (Powder) | MP Biomedicals | 4500012 |
| Penicillin/Streptomycin | Gibco | 15140122 |
| Ketamine | UF ACS | N/A |
| Xylazine | UF ACS | N/A |
| 10% Formalin | Fisher Brand | 245–684 |
| Tamoxifen | Sigma | T5648 |
| Triton X-100 | Sigma Aldrich | 50-178-1841 |
| Trizol | Ambion | 15596018 |
| Chloroform | Sigma-Aldrich | 319988 |
| CCl4- Carbon Tetrachloride | Sigma | 289116 |
| Keratinocyte serum-free medium | Gibco | 17005042 |
| Bovine pituitary extract | Gibco | 13028–014 |
| Human recombinant epidermal growth factor | Gibco | 10450–013 |
| Renal epithelial cell growth basal medium 2 | PromoCell | C-26235 |
| Supplement Pack Renal Epithelial Cell GM2 | PromoCell | C-39605 |
| PR-73 mini hepcidin | Kind gift from Elizabeta Nemeth, UCLA, USA | N/A |
| ProLong Gold antifade agent with DAPI | Invitrogen | P36962 |
| ProLong Gold antifade agent without DAPI | Invitrogen | P36961 |
| Nuclear Fast Red | Sigma | N3020 |
| Collagenase (Type IV) | Worthington | LS004188 |
| DNase | Roshe | 04536282001 |
| Critical commercial assays | ||
| Creatinine Assay (Enzymatic) | Diazyme | DZ072B |
| Urea Nitrogen (BUN) colorimetric assay | Arbor assays | K024-H |
| RNeasy Plus mini kit | Qiagen | 74104 |
| IL-8 Human ELISA kit | Invitrogen | KHC0082 |
| Grocott Methenamine Silver Stain (GMS) for Fungus and PCP | Polysciences | 25087–1 |
| Hepcidin IDx ELISA Kit (human) | Intrinsic Lifesciences | ICE-007 |
| MycoFluor Mycoplasma Detection Kit | ThermoFisher Scientific | M7006 |
| Experimental models: Cell lines | ||
| HK-2 Cells | ATCC | CRL-22 |
| Oligonucleotides | ||
| Human: HAMP | Bio-Rad | qHsaCID0020626 |
| Human: GAPDH | Bio-Rad | qHsaCIP0029958 |
| Mouse: Ppia | Bio-Rad | qMmuCED0041303 |
| Mouse: Tnfα | Bio-Rad | qMmuCED0004141 |
| Mouse: IL-1β | Bio-Rad | qMmuCID0005641 |
| Mouse: IL-6 | Bio-Rad | qMmuCEDD0045760 |
| Mouse: Gsdmd | Bio-Rad | qMmuCED0003802 |
| Mouse: Mlkl | Bio-Rad | qMmuCED0044462 |
| Mouse: Csf3 | Bio-Rad | qMmuCED0004279 |
| Mouse: Ccl2 | Bio-Rad | qMmuCED0003785 |
| Mouse: Cxcl11 | Ori-gene | MP202411 |
| Fungus: ECE1 forward | Integrated DNA technologies | atcgaaaatgccaagagag |
| Fungus: ECE1 Reverse | Integrated DNA technologies | agcattttcaataccgacag |
| Fungus: TDH3 Forward | Integrated DNA technologies | atcccacaaggactggaga |
| Fungus: TDH3 Reverse | Integrated DNA technologies | gcagaagctttagcaacgtg |
| Software and algorithms | ||
| FlowJo™ Software | BD Life Sciences | V10.8 |
| GraphPad software | GraphPad Software, LLC. Boston, Massachusetts, USA | www.graphpad.com |
| Microsoft Excel | Microsoft | https://www.microsoft.com/en-us/microsoft-365 |