Tangeretin suppresses RANKL-induced osteoclastogenesis and alleviates postmenopausal osteoporosis by inhibiting Notch signaling

Abstract

Background

Postmenopausal osteoporosis is characterized by osteoclast differentiation and bone loss. Tangeretin (TGN) is a natural product that possesses multiple pharmacological properties. However, its specific function in postmenopausal osteoporosis deserves further exploration.

Methods

The in vitro and in vivo models of postmenopausal osteoporosis were established by using BMMs stimulated with M-CSF and RANKL and mice receiving ovariectomized (OVX) operation. Osteoclast-specific gene expression was determined by RT-qPCR. The protein level was detected by Western blotting. H&E staining was performed to observe the pathological changes in murine distal femurs.

Results

For in vitro study, TGN did not affect cell viability but downregulated RANKL-stimulated osteoclast-specific gene expression. For in vivo study, TGN not only alleviated OVX-triggered pathological alterations of femur tissue, but also effectively inhibited proteoglycan loss and cartilage injury induced by OVX in the femurs of mice. Additionally, TGN prevented osteoclastogenesis in OVX mice by downregulating TRAP activity and osteoclast-specific gene expression. Mechanistically, TGN significantly inhibited the activation of Notch signaling via the downregulation of Notch-1, Notch-2, Notch-3, Jagged1, Hes-1, and Hey-1 protein levels in vitro and in vivo.

Conclusion

TGN represses RANKL-induced osteoclastogenesis and alleviates postmenopausal osteoporosis by inhibiting Notch signaling.

1. Introduction

Osteoporosis refers to a systemic skeletal disorder clinically manifested as deterioration of bone microstructure, decreased bone mineral density, and downregulated bone mass, ultimately leading to bone fragility [1]. In 2020, this disease afflicted approximately 160 million Chinese people [2]. Bone homeostasis modulated by osteoblasts and osteoclasts plays a pivotal role in osteoporosis [3]. The imbalance between bone formation mediated by osteoblasts and bone resorption mediated by osteoclasts is the primary cause of osteoporosis [4]. In general, women are more likely to develop osteoporosis than men, especially older postmenopausal women. Postmenopausal estrogen deficiency is a contributing factor to postmenopausal osteoporosis [5].

Osteoclasts are multinucleated giant cells that derived from hematopoietic monocyte/macrophage precursors and play pivotal roles in bone resorption [6]. Macrophage colony-stimulating factor (M-CSF) and receptor activator for nuclear factor-kappa B (NF-κB) ligand (RANKL) are important regulators that can induce osteoclastogenesis. Adaptor molecules called tumour necrosis factor receptor-associated factors (TRAFs) are recruited by the binding of RANKL to its receptor RANK, which leads to the activation of mitogen-activated protein kinase (MAPK) and NF-κB pathways [7]. Subsequently, nuclear factor of activated T cells c1 (NFATc1) and c-Fos, two key transcription factors related to osteoclastogenesis, are also activated [8,9]. The activation of NFATc1 and c-Fos elevates the expression of osteoclast-specific genes, including calcitonin receptor (CTR), cathepsin K (CTSK), dendritic cell-specific transmembrane protein (DC-STAMP), and tartrate-resistant acid phosphatase (TRAP), which contributes to mature osteoclast formation [10,11]. Subsequently, proteolytic enzymes and acids are secreted into a tight sealing zone that is formed due to structural alternations and polarization of mature osteoclasts, ultimately inducing the degradation and dissolution of underlying bone [12,13].

Tangeretin (TGN, C₂₀H₂₀O₇), also known as 5,6,7,8,4′-pentamethoxy flavone, is a polymethoxylated flavone extracted from the peal of Citrus reticulata (mandarian oranges) [14,15]. Multiple studies have shown that TGN had a series of bioactive properties including neuroprotective, hepatoprotective, anti-inflammatory, and antioxidant activities [[16], [17], [18], [19]]. To be specific, TGN suppresses inflammatory response and extracellular matrix (ECM) degradation via the inactivation of Nrf2/NF-κB and MAPK/NF-κB signaling pathways in osteoarthritis [16]. Moreover, TGN was proven to inhibit bone loss and bone resorption in periodontitis [20]. However, the role of TGN in RANKL-induced osteoclast differentiation and ovariectomized (OVX)-induced postmenopausal osteoporosis mouse model has not been investigated.

This report determined the possible efficacy of TGN in alleviating bone loss in mice with OVX-induced postmenopausal osteoporosis and reducing osteoclast formation induced by RANKL, which may help us understand the pharmacological effects of TGN and the underlying mechanisms in osteoporosis better.

2. Methods and materials

2.1. Cell culture and treatment

Primary bone marrow monocytes were extracted from the femoral bone marrow of 6-week-old C57BL/6 mice as previously delineated [21] and were differentiated into bone marrow-derived macrophages (BMMs) in α-MEM supplemented with 10 % FBS, 100 μg/mL streptomycin, 100 U/mL penicillin and 25 ng/mL M-CSF for 5 days in a humidified incubator with 5 % CO₂ at 37 °C. Subsequently, BMMs were cultured with 25 ng/mL M-CSF and 50 ng/mL RANKL for 5 days, followed by treatment with TGN at different concentrations (0, 5, 10, 20, or 40 μM). The chemical structure of TGN was provided in Fig. 1A.

Fig. 1.

The effect of TGN on cell viability in vitro. (A) The chemical structure of TGN was presented. (B) CCK-8 assays for detecting the cytotoxic effects of TGN at different concentrations (0, 5, 10, 20, or 40 μM) on BMMs. ∗p < 0.05.

2.2. CKK-8 assay

After indicated treatments, BMMs were plated to 96-well plates (3 × 10⁴ cells/well) and cultured for indicated time. Then, the plates were supplemented with 10 μL Cell Counting Kit-8 (CCK-8) solution (Dojindo, Tokyo, Japan) followed by incubation for another 4 h at room temperature. Then, the optical density was measured utilizing a microplate reader (BMG Labtech, Germany) at 450 nm wavelength.

2.3. RT-qPCR

Total RNA extraction from BMMs and bilateral femurs was achieved utilizing TRIzol reagent (Invitrogen). Subsequently, RNA was processed with DNase to remove DNA and the SuperScript First Strand cDNA System (Invitrogen) was employed to reverse transcribe RNA into cDNA. Subsequently, the NovoStart SYBR qPCR SuperMix Plus kit (novoprotein, Shanghai, China) was utilized to perform qRT-PCR. With the employment of the 2^−ΔΔCT method, TBRG4 expression was calculated. GAPDH served as the normalization for TBRG4 expression. The sequences of the primers were synthesized by BGI (Shenzhen, China) and listed in Table 1.

Table 1.

The information of primer sequence.

Gene	Sequence (5′→3′)
DC-STAMP forward	TGAAACTACGTGGAGAGAAGCAA
DC-STAMP reverse	TGAAACTACGTGGAGAGAAGCAA
V-ATPased2 forward	AAGCCTTTGTTTGACGCTGT
V-ATPased2 reverse	TTCGATGCCTCTGTGAGATG
Atp6v0d2 forward	TGCGGCAGGCTCTATCCAGAGG
Atp6v0d2 reverse	CCACTGCCACCGACAGCGTC
Ctsk forward	CTTCCAATACGTGCAGCAGA
Ctsk reverse	TCTTCAGGGCTTTCTCGTTC
Mmp9 forward	GTCCAGACCAAGGGTACAG
Mmp9 reverse	ATACAGCGGGTACATGAGC
GAPDH forward	AGGTCGGTGTGAACGGATTTG
GAPDH reverse	GGGGTCGTTGATGGCAACA

2.4. Western blot

Protein samples were extracted from BMMs or femur tissues and prepared using homogenization. Total protein was subjected to electrophoresis through a 10 % SDS-PAGE gel. The proteins were transferred electrically to polyvinylidene difluoride (PVDF) membranes. The PVDF membranes were blocked using 5 % skim milk in TBST (20 mM Tris–HCl, 0.15 M NaCl, 0.05 % Tween-20, pH 7.5) for 1 h at room temperature. Hereafter, the membranes were incubated with a series of primary antibodies overnight at 4 °C, and then incubated with secondary antibody for 1 h at room temperature. The protein bands were visualized using an infrared laser imaging system (LI-COR, USA) and quantified using Odyssey software. Detailed information of primary antibodies was provided in Table 2.

Table 2.

Primary antibody information.

Antibody	Dilution	Number	Source
Notch1	1: 1000	ab52627	Abcam
Notch2	1: 1000	ab8926	Abcam
Notch3	1: 1000	ab23426	Abcam
Jagged1	1: 1000	ab109536	Abcam
Hey1	1: 1000	ab154077	Abcam
Hes1	1: 1000	ab108937	Abcam
β-tubulin	1: 1000	ab7291	Abcam

2.5. Animal models

A total of 60 female C57BL/6 mice (8–10 weeks old) were donated by Tongji hospital. All animals were raised in specific pathogen-free environments of the Experimental Animal Center of Tongji University and received water and food ad libitum. A mouse model with postmenopausal osteoporosis induce by Ovariectomy (OVX) was established as per the previously delineated method [22]. Briefly, to remove ovaries OVX group mice received bilateral ovariectomy after anesthesia. Sham-operated mice underwent similar surgery without the removement of ovaries. All the experimental protocols were approved by the Animal Ethics Committee of Wuhan Myhalic Biotechnology Co., Ltd (approval number: HLK-202304299; approval date: April 18, 2024), and the experimental procedures were performed according to the recommendations and guidelines of the National Institutes of Health. The mice were used and randomly divided into four groups (n = 15/group) and received treatment as follows: 1. OVX + TGN: mice received 40 mg/kg of TGN dissolved in dimethylsulfoxide (DMSO) by gavage, followed by OVX surgery. 2. OVX + DMSO: mice were orally administrated with equivalent amount of DMSO, followed by OVX surgery. 3. Sham + TGN: mice received 40 mg/kg of TGN dissolved in dimethylsulfoxide (DMSO) by gavage and then were subjected to sham operation. 4. Sham + DMSO: mice were orally administrated with equivalent amount of DMSO, followed by sham operation. The dose of TGN administrated in the animal experiments were based on previous description [23]. The body weight of each group was recorded after OVX surgery using an electronic weigher (Hirp Trading Co., Ltd, Shanghai, China). One week after OVX operation, mice of each group were euthanized by CO₂ inhalation. After that, the bilateral femurs were harvested.

2.6. Histology

The same portion of murine bilateral femur tissue samples were paraffin-embedded, sliced into 5-μm-thick sections (in thickness), dewaxed, and rehydrated in gradient ethanol. Afterwards, the sections were stained with hematoxylin for 15 min, treated with 5 % acetic acid and rinsed in distilled water followed by staining with eosin (Sigma–Aldrich) for 10 min. After dehydrated with graded ethanol, washed with xylene and sealed with Canada balsam (Sigma–Aldrich), the bilateral femur tissues were observed under a light microscope (Olympus). The bone mineral density (BMD) was measured by dual energy X-ray absorptiometry. Besides, tartrate-resistant acid phosphatas (TRAP) staining was carried out to observe osteoclast with a TRAP Kit (Sigma–Aldrich, Merck, Darmstadt, Germany) according to manufacturer's instructions. Moreover, these sections were also subjected to Safranin O-Fast Green staining following the manufacturer's protocols. TRAcP staining kits were utilized to determine TRAP activity according to the standard procedure [24,25].

2.7. Statistical analysis

SPSS 18.0 software (SPSS Inc., USA) was used for the analyzation of the statistics. Experimental data obtained from at least triplicate trails was displayed as the Mean ± Standard Error of the Mean (SEM). Differences between groups were tested using independent sample t test and multigroup comparisons were achieved via one-way analysis of variance, followed by Tukey's post hoc test. P value less than 0.05 was set as the threshold for statistical significance.

3. Results

3.1. The effect of TGN on cell viability in vitro

To evaluate the effect of TGN on BMMCs, cells were treated with TGN at different concentrations (0, 5, 10, 20, or 40 μM) for 24 h. CCK-8 assays were performed to evaluate the cytotoxic effects of TGN in BMMCs. As manifested by Fig. 1B, no significant changes were observed in the viability of BMMCs under the treatment of TGN at 0, 5, 10, or 20 μM (Fig. 1B). However, 40 μM of TGN treatment contributed to a remarkable reduction in BMM cell viability (Fig. 1B). Therefore, TGN at the concentrations of 5, 10, or 20 μM was selected for the following experiments.

3.2. The effect of TGN on osteoclastogenesis in vitro

In addition to identifying the impact of TGN on osteoclast formation in OVX mice, its role in regulating osteoclastogenesis at the cellular level was also evaluated. During osteoclast formation, BMMs can be induced by M-CSF to differentiate into pre-osteoclasts, which fuse to multinucleated osteoclasts under the induction of RANKL [26]. Herein, BMMs were treated with M-CSF and RANKL to induce osteoclastogenesis, followed by TGN (5, 10, or 20 μM) treatment. To delve into the influence of TGN on osteoclastogenesis in vitro, the mRNA levels of osteoclast-related genes (V-ATPased2, DC-STAMP, TRAP, Atp6v0d2, CTsk and Mmp9) in BMMCs were assessed using RT-qPCR. The outcome demonstrated that the mRNA expression of these osteoclastogenesis-related genes was significantly higher in the RANKL group than that in the Blank group (Fig. 2A–F). In contrast, the promotive effects of M-CSF and RANKL stimulation on the mRNA levels of these osteoclast-related genes were suppressed by TGN in a concentration-dependent manner (Fig. 2A–F). In summary, TGN prevents RANKL-induced expression of osteoclast-specific genes in vitro.

Fig. 2.

The effect of TGN on osteoclastogenesis in vitro. (A–F) RT-qPCR for assessing the mRNA levels of osteoclast-specific genes (V-ATPased2, DC-STAMP, TRAP, Atp6v0d2, CTsk and Mmp9) in the Blank, RANKL, TGN (5 μM), TGN (10 μM) and TGN (20 μM) groups. ^###p < 0.001 vs. Blank group. ∗p < 0.05, ∗∗p < 0.01 vs. RANKL group.

3.3. The effect of TGN on Notch signaling in vitro

Emerging study demonstrated that TGN served as an inhibitor of Notch signaling in various diseases [27,28]. Hence, we also evaluate the effect of TGN on Notch signaling in vitro. According to Western blot, the protein level of Notch-1, Notch-2, Notch-3, Jagged1, Hes-1, and Hey-1 was upregulated in RANKL-induced BMMs, and then gradually reduced by TGN treatment in a dose dependent manner (Fig. 3A). These results validated that TGN significantly inhibited the activation of Notch signaling.

Fig. 3.

The effect of TGN on Notch signaling in vitro. (A) Notch-1, Notch-2, Notch-3, Jagged1, Hes-1, and Hey-1 proteins in the Blank, RANKL, TGN (5 μM), TGN (10 μM) and TGN (20 μM) groups. ∗∗∗p < 0.001 vs. Blank group. ^#p < 0.05, ^##p < 0.01, ^###p < 0.001 vs. RANKL group.

3.4. The effect of TGN on histology changes in OVX-operated mice

Next, H&E staining was conducted to delve into the impact of TGN on the pathological changes in murine distal femurs. As illustrated by Fig. 3A, the Sham + DMSO and the Sham + TGN groups displayed complete and orderly arranged trabeculae. OVX operation in mice contributed to increased space and decreased trabeculae in density, number and thickness (Fig. 4A). However, these abnormalities of trabeculae induced by OVX surgery were mitigated by TGN treatment (Fig. 4A). Moreover, the BMD was measured by dual energy X-ray absorptiometry. Compared with the Sham + DMSO or Sham + TGN group, the significant decrease of BMD was observed in OVX + DMSO group. Conversely, administration of TGN partially offset OVX-indued suppressive impact on BMD (Fig. 4B). Additionally, TRAP staining demonstrated that the increase of TRAP⁺ cells in OVX mice was neutralized by TGN administration (Fig. 4C). Moreover, Safranin O-Fast Green staining revealed that significant proteoglycan loss and cartilage injury were observed in OVX mice, and TGN treatment improved this pathological change (Fig. 4D). To sum up, TGN alleviates OVX-triggered pathological alterations of femur tissues and trabeculae bone loss.

Fig. 4.

The effect of TGN on histology changes in OVX-operated mice. (A) H&E staining for observing the pathological changes in murine distal femurs of the Sham + DMSO, Sham + TGN, OVX + TGN and OVX + DMSO groups. (B) The measurement of BMD Sham + DMSO, Sham + TGN, OVX + TGN and OVX + DMSO groups. (C) The representative images of TRAP staining and Safranin O-Fast Green staining. ∗∗p < 0.001 vs. Sham + DMSO. ^##p < 0.01 vs. OVX + DMSO.

3.5. The effect of TGN on TRAP activity and osteoclast-specific gene expression in vivo

To probe into the influence of TGN on osteoclast formation in vivo, the activity of TRAP (an osteoclast marker) in the murine serum were evaluated using a specific commercial kit. As denoted by Fig. 3A, the Sham + DMSO group and the Sham + TGN group showed almost identical activity of TRAP. The activity of TRAP was significantly higher in the OVX + DMSO group than that in the Sham + DMSO group (Fig. 5A). In contrast, TGN supplement antagonized the promotive effect of OVX operation on TRAP activity in the murine serum (Fig. 5A). In addition, the serum levels of osteoclast-related genes (DC-STAMP, V-ATPased2, Atp6v0d2, Ctsk and Mmp9) were assessed via RT-qPCR analysis. As a result, there was little difference in the levels of these genes between the Sham + DMSO group and the Sham + TGN group (Fig. 5B–F), demonstrating that TGN exerts no significant impact on osteoclast-specific gene expression in normal mice. OVX operation contributed to upregulation of DC-STAMP, V-ATPased2, Atp6v0d2, Ctsk and Mmp9 levels in the murine serum, whereas the facilitation caused by OVX surgery on the expression of these genes was counteracted by TGN (Fig. 5B–F). The above findings denoted that TGN may prevent osteoclastogenesis in OVX mice by downregulating TRAP activity and osteoclast-specific gene expression.

Fig. 5.

The effect of TGN on TRAP activity and osteoclast-specific gene expression in vivo. (A–F) A specific commercial kit for detecting TRAP activity in the murine serum of the Sham + DMSO, Sham + TGN, OVX + DMSO and OVX + TGN groups. (B–F) RT-qPCR for assessing the mRNA levels of osteoclast-related genes (DC-STAMP, V-ATPased2, Atp6v0d2, Ctsk and Mmp9) in the murine serum of the Sham + DMSO, Sham + TGN, OVX + DMSO and OVX + TGN groups. ∗∗p < 0.001 vs. Sham + DMSO. ^##p < 0.01 vs. OVX + DMSO.

3.6. The effect of TGN on Notch signaling in vivo

We then explored the impact of TGN on Notch signaling in vivo. The Notch-1, Notch-2, Notch-3, Jagged1, Hes-1, and Hey-1 protein levels in femur tissues were detected by Western blot. The results demonstrated that Notch-1, Notch-2, Notch-3, Jagged1, Hes-1, and Hey-1 proteins were upregulated in OVX + DMSO group compared to Sham + DMSO group, and TGN treatment inhibited these protein levels in both Sham-operated mice and OVX-treated mice (Fig. 6A), implying that TGN inactivated the Notch signaling in vivo.

Fig. 6.

The effect of TGN on Notch signaling in vivo. (A) Notch-1, Notch-2, Notch-3, Jagged1, Hes-1, and Hey-1 proteins in Sham + DMSO, Sham + TGN, OVX + DMSO and OVX + TGN groups. ^##p < 0.01 vs. OVX + DMSO, and ∗∗p < 0.01 vs. Sham + DMSO.

4. Discussion

Osteoporosis is a bone disorder featured with increased risk of fracture and impaired bone quality, which increases social burden and reduces the life quality the elderly [29]. bone formation and bone resorption play pivotal roles in dynamic bone remodeling. Abnormality in osteoclast activities may induce disruption of bone remodeling, resulting in osteopenia [30]. Hence, finding agents that can inhibit abnormal osteoclast activity may be a good therapeutic strategy for preventing osteoporosis.

Haematopoietic stem cells is major source of osteoclasts [31] Osteoclasts ultimately form from monocytes/macrophages and fuse to produce multinucleated cells after stimulation of macrophage colony-stimulating factor (M-CSF) and receptor activator of nuclear factor kappa B (NF-κB) ligand (RANKL) [32]. The binding between colony-stimulating factor-1 receptor (cFMS) and M-CSF play a decisive role in monocytes/macrophages activation and the proliferation of preosteoclasts or mature osteoclasts [33]. Osteoclast precursor cell differentiation is highly dependent on RANKL stimulation. The activation of calcium signaling, mitogen-activated protein kinase (MAPK), and NF-κB pathways is induced by the recruitment of adaptor molecules such as TNF receptor-associated factor (TRAF6) when RANKL binds with receptor activator of nuclear factor kappa B on the membranes of a preosteoclasts, thereby promoting the formation and differentiation of osteoclasts [34,35]. Subsequently, NFATc1 and AP-1, the transcription factors in osteoclast differentiation, are provoked to induce preosteoclast maturation and upregulate the expression of osteoclast related genes [36,37]. Therefore, development and administration of novel drugs that possess efficacies to suppress RANKL-induced osteoclastogenesis may be a great therapeutic strategy for osteoporosis treatment. In this report, we constructed the in vitro model by using RANKL and M-CSF to stimulate BMMs. Our results manifested that TGN prevented RANKL-induced production osteoclast-specific markers, including V-ATPased2, TRAP, Atp6v0d2, CTsk, Mmp9, and DC-STAMP, implying the inhibitive effect of TGN on osteoclastogenesis.

OVX operation enhances bone resorption rate and reduces bone formation rate to induce osteoporosis, which is similar to postmenopausal osteoporosis characterized by decreased trabecular bone strength and quality [38,39]. Based on these facts, OVX surgery has been widely utilized for establishing animal models of postmenopausal osteoporosis [40]. In our study, to determine the in vivo effect of TGN in osteoporosis, an OVX-induced postmenopausal osteoporosis mouse model was constructed. As a result, TGN significantly improved pathological changes and attenuated bone calcification in trabecular bones triggered by OVX. Moreover, TGN also reduced BMD in OVX-induced mice. Additionally, TGN attenuated OVX-induced osteoclastogenesis by reducing the levels of osteoclast-related genes (Mmp9, CTsk, Atp6v0d2, TRAP, DC-STAMP, and V-ATPased2) in mice. Therefore, TGN represses bone loss in OVX-treated mice.

Mechanistically, TGN has been confirmed to regulate several signaling pathways including Nrf2, NF-κB, MAPK, JAK/STAT3, PI3K, and Noch signaling pathways in diverse pathologies [15,16,[41], [42], [43]]. Particularly, TGN was widely reported to serve as a Notch-1 inhibitor in allergic rhinitis and gastric cancer [27,28]. Therefore, we anticipated that TGN also inhibited the activation of Notch signaling in our study. As expected, the protein level of Notch-1, Notch-2, Notch-3, Jagged1, Hes-1, and Hey-1 was downregulated by TGN treatment in vitro and in vivo, suggesting that TGN effectively inactivated the Notch signaling.

In conclusion, TGN protects against osteoporosis by attenuating OVX-induced bone loss in vivo and repressing osteoclast synthesis in vitro. Our study further confirmed the therapeutical potential of TGN for osteoporosis treatment. However, some shortages in this report should be corrected. First, the side effects or adverse effects of TGN to clinical patients still need further exploration. Additionally, other signaling pathways associated with TGN in osteoporosis deserve further investigation.

Ethical approval

All the experimental protocols were approved by the Animal Ethics Committee of Wuhan Myhalic Biotechnology Co., Ltd (approval number: HLK-202304299; approval date: April 18, 2024).

Authors’ contributions

Tengfei Wu conceived and designed the experiments. Tengfei Wu, Fang Wang, Changqing Ai, Li Li and Fan Wu carried out the experiments. Tengfei Wu, Fang Wang, Changqing Ai, Li Li and Fan Wu analyzed the data. Tengfei Wu and Fang Wang drafted the manuscript. All authors agreed to be accountable for all aspects of the work. All authors have read and approved the final manuscript.

Data availability statement

The datasets used or analyzed during the current study are available from the corresponding author on reasonable request.

Funding

This research received no specific grant from any funding agency in the public, commercial, or not-for-profit sectors.

Declaration of competing interest

The authors declare that they have no competing interests.