Skip to main content
Wiley Open Access Collection logoLink to Wiley Open Access Collection
. 2025 Jun 30;177(4):e70365. doi: 10.1111/ppl.70365

The Mp ANT‐Auxin Loop Modulates Marchantia polymorpha Development

Dipp‐Álvarez Melissa 1, Lorenzo‐Manzanarez J Luis 1, Flores‐Sandoval Eduardo 2, Espinal‐Centeno Annie 1, Méndez‐Álvarez Domingo 1, Fisher J Tom 2, León‐Ruiz Jesús 1, Olvera‐Martínez Fernando 1, Bowman L John 2, Arteaga‐Vázquez A Mario 3, Alfredo Cruz‐Ramírez 1,
PMCID: PMC12207571  PMID: 40583831

ABSTRACT

AINTEGUMENTA‐LIKE/PLETHORA/BABYBOOM (APB) genes are considered part of the ancestral developmental toolkit in land plants. In Arabidopsis thaliana , these transcription factors are induced by auxin and are primarily expressed in tissues with actively dividing cells, where they play essential roles in organ development. Marchantia polymorpha , a liverwort that diverged from A. thaliana early in embryophyte evolution, possesses a single APB ortholog, MpAINTEGUMENTA (MpANT), encoded in its genome. In this study, we aimed to characterize the function of MpANT. Analysis of a transcriptional fusion line indicates that MpANT is predominantly expressed in the meristematic region. We report that the MpANT promoter region contains several cis‐acting Auxin Responsive Elements (AREs) and demonstrate that its expression, which occurs predominantly in meristematic regions, is significantly altered by the addition of exogenous auxin and inhibition of auxin transport. These findings indicate that MpANT acts downstream of Auxin Response Factors (ARFs) and auxin signaling. Analyses of loss‐ and gain‐of‐function MpANT alleles highlight the importance of this transcription factor in meristem maintenance and cell proliferation. Additionally, we found that MpANT acts upstream of the auxin transporter MpPIN1 by influencing auxin distribution. Taken together, our findings reveal a feedforward regulatory loop involving auxin, MpANT, and MpPIN1 that is important for Marchantia development.

Keywords: ABP proteins, auxin, EvoDevo, Marchantia, PLETHORA

1. Introduction

The evolution of the land plant body, from the few cells of their zygnematal ancestors to the intricate three‐dimensional structures of contemporary plants, was a key component in the radiation of land plants (Kenrick and Crane 1997; Dolan 2009; Donoghue and Paps 2020; Bowman 2022). Recent studies have shown that members of early‐diverging lineages of streptophytes share with derived angiosperms a set of conserved regulatory gene families and transcription factors (TFs). These TF families mainly evolved before land plant diversification, suggesting that a conserved core of regulatory genes was already present in the common ancestor of land plants (Catarino et al. 2016; Bowman et al. 2017; Lehti‐Shiu et al. 2017; Wilhelmsson et al. 2017; Hirakawa 2022).

AINTEGUMENTA‐LIKE/PLETHORA/BABYBOOM (APB) genes are considered one of these key developmental gene families in land plants (Floyd and Bowman 2007). APB proteins contain two AP2 domains separated by a linker region of approximately 25 amino acids (Riechmann and Meyerowitz 1998; Dipp‐Álvarez and Cruz‐Ramírez 2019). In Arabidopsis thaliana , this family includes eight genes: AINTEGUMENTA (ANT), AINTEGUMENTA‐LIKE 1 (AIL1), BABY BOOM (BBM), and the PLETHORAs (PLT1, PLT2, PLT3, PLT5, and PLT7), which are considered master regulators of diverse developmental processes (Reviewed in Horstman et al. 2014) and are mainly expressed in dividing tissues, where they regulate the maintenance of stem cell niches, the correct development of the embryo, and the formation of root and shoot organs (Aida et al. 2004; Galinha et al. 2007).

The liverwort Marchantia polymorpha L. ssp. ruderalis is a member of the bryophyte lineage and has benefited plant biology since the 18th century through its use as a model species for developmental, genetic, and physiological studies (Bowman et al. 2022; Kohchi et al. 2021). In addition to the molecular and genomic tools developed for this plant model species, M. polymorpha has low genetic redundancy due to the lack of whole‐genome duplications (WGDs) (Bowman et al. 2017). These features make it an ideal model for studying the evolution of genetic systems that underlie major changes in land plant morphology and physiology (Delaux et al. 2019; Ishizaki 2017; Bowman et al. 2022).

There is a single APB ortholog encoded in the genome of M. polymorpha , which we named MpANT (Mp8g11450; Dipp‐Álvarez and Cruz‐Ramírez 2019). Studies on Arabidopsis APB TFs have uncovered a relationship with the phytohormone auxin, which controls key aspects of plant development (Reviewed in Horstman et al. 2014). In Marchantia, Flores‐Sandoval, Eklund, et al. (2018) explored TFs that co‐express with hormonal signaling pathway genes at various developmental stages of the life cycle. In the 96‐h sporeling, a mild expression of MpANT was detected. MpANT belonged to a co‐expression cluster with auxin signaling, biosynthesis and transport genes MpARF1 (Flores‐Sandoval, Romani, et al. 2018; Kato et al. 2017), MpARF2 (Kato et al. 2020), MpIAA (Kato et al. 2015; Flores‐Sandoval et al. 2015), MpYUC2 (Eklund et al. 2015), MpPIN1 (Fisher et al. 2023), MpSHI, and MpGRF, indicating that it could be associated with the auxin signaling pathway in Marchantia. Furthermore, MpANT expression is highly enriched in the apical cell tissue, like the expression observed in A. thaliana (Flores‐Sandoval, Eklund, et al. 2018). This led us to investigate whether the single APB transcription factor MpANT could have a conserved function in meristem maintenance and plant development and to evaluate the potential role of auxin signaling in its function. Auxin‐mediated meristem establishment is partially controlled by long PIN intercellular auxin exporters in Marchantia, as Mppin1ge mutants are delayed in meristem formation relative to wild type in the sporeling to thallus developmental transition (Fisher et al. 2023). Two recently published findings parallel ours regarding the role of MpAPB in meristem maintenance during early gemma development (Fu et al. 2024; Liu et al. 2024). However, here, we provide novel evidence showing that MpANT forms a positive feedforward loop with auxin distribution and transport, defining not only its meristematic function but also its influence on the overall development of Marchantia.

2. Methods

2.1. Marchantia polymorpha Growth Conditions and Treatments

The Takaragaike‐1 (Tak‐1; Japanese male accession) was used as M. polymorpha wild‐type in this study. The plants were cultured on half‐strength Gamborg's B5 (PhytoTechnology Laboratories) containing 0.5 g/L MES, 1% sucrose, and 1.3% phytoagar (PhytoTechnology Laboratories) (pH 5.7) and grown under continuous light (50–60 μmol photons m−2 s−1) at 22°C. For treatments, the gemmaelings were grown on half‐strength Gamborg's B5 with 10 μM 2,4‐D (Sigma‐Aldrich), an auxin analogue (Flores‐Sandoval et al. 2015) and 10 μM NPA (N‐1‐naphthylphthalamic acid), an inhibitor of directional (polar) transport of the hormone auxin (Abas et al. 2020).

2.2. Genetic Constructs and Agrobacterium‐Mediated Plant Transformation

The MpANT coding sequence without stop codon was amplified from a pCRII plasmid generated by Eduardo Flores‐Sandoval at John Bowman's Laboratory (School of Biological Sciences, Monash University), with primers that contain attB1 and attB2 sequences for Gateway Cloning System. The MpANT promoter (pMpANT) was cloned from Marchantia polymorpha Tak‐1 DNA using primers designed with attB1 and attB2 tails for the Gateway Cloning System, the forward primer aligns with a sequence 2.5 kb upstream of MpANT start codon while the reverse primer hybridizes just before the start codon. Both sequences were amplified using polymerase chain reaction (PCR) with Accuprime High Fidelity polymerase. The MpANT:GFP expression vector was constructed by LR‐recombining the 2.5 kb pMpANT fragment in pKGWFS7 binary destination vector. The 35S:MpANT‐CITRINE expression vector for constitutive expression was constructed by recombining the CDS of MpANT without a stop codon in the pMpGWB206 binary destination vector. For gene editing via CRISPR‐Cas9 of MpANT, a guide RNA (5′ GTTGGACGGGGCGCTACGAGG 3′) was designed to target a 21 bp sequence in the second intron–third exon boundary of the MpANT genomic region. The gRNA was cloned under the MpU6 promoter into the GE010 plasmid (Sugano et al. 2014), which also carries the Cas9 coding sequence. All plasmids were transformed into wild‐type (WT) M. polymorpha plants of the Tak1 background through regenerating thalli transformation (Kubota et al. 2013). The regenerating plants were transferred to half‐strength Gamborg's B5 (PhytoTechnology Laboratories) containing 0.5 g/L MES, 1% sucrose, 1.3% phytoagar (PhytoTechnology Laboratories) (pH 5.7), cefotaxime, and the appropriate selection antibiotics. Resistant transgenic plants from the CRISPR‐Cas9 edition were genotyped and sequenced to confirm the nature of the edition. Two independent MpANT:GFP transformant lines were obtained and analyzed for overall MpANT transcriptional pattern, while only MpANT:GFP‐A was used in auxin treatments. Two independent 35S:MpANT‐CITRINE lines with similar phenotype were obtained and further analyses were carried out with 35S:MpANT‐CITRINE‐A. One CRISPR‐Cas9 edited line showed phenotypic alterations and successful editions that resulted in a frameshift causing a premature stop codon that leads to the translation of a 415 AA protein instead of the 825 AA wild‐type MpANT protein (Figure S1).

2.3. In Silico Genome‐Wide APB DNA‐Binding Motif Search

For the genome‐wide APB DNA‐binding motif search, a Motif Discovery software for UNIX operating systems called HOMER (Heinz et al. 2010) was used. The tools seq2profile.pl. and scanMotifGenomeWide.pl. were used to make a motif file for the consensus APB DNA‐binding sequence (CNTNGNNNNNNGTGC) reported by Santuari et al. (2016), and with this motif file, the whole M. polymorpha genome was scanned for motif occurrences. Once a motif coordinate output was generated, the motifs were annotated to a chromosome, the closest genome feature, and its gene ID, using UROPA (Kondili et al. 2017). The config file to run UROPA included instructions to only annotate motifs located up to 2500 bp upstream of a genome feature identified as exon or CDS. The output table contains the ID of the closest gene and was explored, filtered, and complemented with the M. polymorpha genome V6.1 (Iwasaki et al. 2021) information using the dplyr package in RStudio. Also, PlantPan2.0 (Chow et al. 2016) was used to scan the promoter region for auxin response elements in MpANT promoter region (Figure 1B).

FIGURE 1.

FIGURE 1

MpANT transcription is responsive to fluctuating auxin. (A) Conserved domain organization and euANT‐specific motif of A. thaliana and M. polymorpha euANT clade members. (B) Gene model for MpANT with AREs elements demarcated in its promoter region (pink dots) and the target region for editing with CRISPR‐Cas9 (arrowhead). (C) Expression analysis of MpANT:GFP M. polymorpha line. Confocal images show the expression patterns of 4‐day‐old wild‐type gemmae grown in Gamborg's B5 media (mock), or Gamborg media supplemented with either 2,4‐D (10 μM), NPA (10 μM), and NPA + 2,4‐D. Green fluorescence corresponds to GFP signal, purple fluorescence corresponds to Propidium Iodine signal. Insets in all panels are magnifications of the apical notch. Scale bars = 100 μm.

A Gene Ontology (GO) term analysis was conducted to find which biological processes are associated with the putative transcriptional targets of MpANT. For this, the list of genes with 1 or more MpANT binding sites was submitted to the GO Term Enrichment tool in PlantRegMap (http://plantregmap.gao‐lab.org/go.php), selecting M. polymorpha as the input species. The p‐value threshold was set to ≦ 0.05. The significantly enriched GO categories were visualized with the REVIGO web server (Supek et al. 2011).

For co‐expression analyses of MpANT and its putative targets, a hierarchical clustering heatmap was generated using a list of putative MpANT targets related to auxin and development to see the TPM value of such genes in different M. polymorpha tissues. This analysis and heatmap were generated using the MBEX platform (mbex.marchantia.info/clustergram; Kawamura et al. 2022).

2.4. RT‐qPCR Methodology

Total RNA was extracted from wild type (Tak‐1) and Mpant 0 and 3 days post germination (dpg) gemmae, as well as from Wt and mutant thalli at 7 and 14 days post‐plated (dpp) using the TRIzol method (Life Technologies). cDNA was synthesized in optimized conditions from the RNA samples with the SuperScript II (Thermo Fisher Scientific) using 2.5 μg of RNA in a 20 μL reaction volume utilizing Oligo dT (Sigma). Specific mRNA expression levels were determined by RT‐qPCR utilizing the PCR SYBR Green master mix (Thermo Fisher Scientific) in a reaction volume of 20 μL. Three biological pools were used with three technical replicates per analyzed condition; the oligonucleotide efficiency was included in the calculations. Calculations were normalized with the expression level of the control gene MpACT7. The relative expression was calculated with the 2(−ΔCт) method (Livak and Schmittgen 2001). Primers used for RT‐qPCR analyses are listed in Table S2.

2.5. In Silico Analysis of MpPIN1 for the Use of the Antibody Raised Against AtPIN1

The antibody against AtPIN1 (aP‐20, Santa Cruz Biotechnology, sc‐27163) was designed to bind to the hydrophilic internal region of AtPIN1. To assess the potential of this polyclonal antibody to bind the Marchantia ortholog, MpPIN1, the conservation of this region in MpPIN1 was evaluated. The sequence alignment and identity were determined using MUSCLE (https://www.ebi.ac.uk/jdispatcher/msa/muscle?stype=protein) with default settings. The hydrophilic loop region was defined using data from PDB 7Y9T (Yang et al. 2022), and the 2D structure of AtPIN1 was generated using Biotite (Kunzmann et al. 2023). Moreover, a high colocalization of the signal is raised using the antibody with that of proMpPIN1:MpPIN1‐CITRINE; the latter is a line generated and described by Fisher et al. (2023).

2.6. In Silico Determination of the AGK Kinases of Marchantia That Group With AtPINOID

The three Marchantia's AGC kinases closest to AtPINOID (AT2G34650) were identified using OrthoFinder version 2.5.5. For this analysis, the proteomes of Arabidopsis thaliana (Araport11, https://phytozome‐next.jgi.doe.gov/) and Marchantia (MpTak_v7.1, https://marchantia.info/) were downloaded. The orthogroup corresponding to AtPINOID (ID AT2G34650) was subsequently retrieved.

2.7. Immunohistofluorescence for IAA and MpPIN1 Detection

The gemmae were fixed with 2.5% PFM in 1× PBS and Tween 20 at 4°C overnight, then washed three times with 1× PBS 0.2% Tween 20 at 4°C. Subsequently, the cell wall was degraded with 1% driselase (Sigma, D8037), 1% BSA (Sigma, A9647) at 37°C for 45 min and washed with 1× PBS 0.2% Tween 20 for 15 min. Posteriorly, the samples were permeated in 1× PBS 2% Tween 20 for 2 h, on ice. For labeling, samples were incubated with primary polyclonal anti‐IAA antibody (Agrisera, AS09 445) and polyclonal anti‐PIN1 (Santa Cruz Biotechnology, aP‐20: sc‐27163) at a 1:1000 dilution, and incubated overnight at 4°C. Then washed three times with 1× PBS 0.2% Tween 20 for 6 h at 4°C. For secondary labeling, the samples were incubated with anti‐Rabbit IgG Alexa Fluor 488 conjugate (Thermo Fisher Scientific, A11008) and anti‐Goat IgG Alexa Fluor 594 conjugate (Jackson, 305‐586‐045) at a 1:1000 dilution, and incubated overnight at 4°C. Then washed three times with 1× PBS 0.2% Tween 20, on ice. Afterwards, the samples were treated with DAPI (Sigma, D9542) to label nuclei. Finally, samples were washed with 1× PBS 0.2% Tween 20 for 1 h and mounted in a coverslip with Prolong‐Gold antifade mountant reagent. Conditions for IAA immunolabeling were adjusted based on Aguilar‐Cruz et al. (2023).

2.8. Tissue Staining and Imaging

The gemmae and thalli were stained with propidium iodide (PI) at a concentration of 10 mg/L in ddH2O for 10 min in an Eppendorf tube. After incubation, the samples were rinsed twice with ddH2O. EdU staining was carried out similarly to Fu et al. (2024); thalli of 4 days‐post‐sowing were immersed in 1/2 strength Gamborg's B5 liquid medium with 10 μM EdU at 22°C for 2 h under white light. Then they were fixed in FAA (50% Ethanol, 2.5% glacial acetic acid, and 2.5% formaldehyde) for 2 h at room temperature. Then samples were washed with a PBST buffer (0.5% Triton X‐100, pH 7.4) for 5 min and PBS buffer (pH 7.4) for 5 min. Then the samples were labeled with Yefluor 488 Azide (40287ES60, YEASEN) for 30 min in dark conditions. After the samples were washed with a PBS buffer (pH 7.4) for 30 min.

2.9. Keyence Microscopy

Gemmae and thalli of 0, 4, 14, and 30 days‐post‐sowing were observed using a Keyence VHX‐5000 Digital Microscope (Keyence Corp.) with an LED light source and a 20–200× magnification range lens (VH‐Z200).

2.10. Confocal Microscopy

Confocal laser scanning microscopy imaging of gemmae, apical notches, rhizoid initial cells and thalli was performed on an inverted LSM‐800 Zeiss microscope (Zeiss). Propidium iodide was excited at 561 nm with a laser intensity of 0.2%, emitted light was collected between 576 and 700 nm. eGFP was excited at 488 nm with a laser intensity of 20%, emitted light was collected between 410 and 546 nm. For immunolocalization, the IAA signal was excited at 488 nm with an emission wavelength of 520 nm. The PIN1 signal was excited at 590 nm, and the emission wavelength was 617 nm. DAPI staining signal was detected with an excitation wavelength of 405 nm and emission wavelength of 461 nm.

2.11. Image Processing

The area (mm2) of gemmae and thalli was measured using the Measure tool of Fiji (https://imagej.net/software/fiji/). To measure the number of rhizoid initial cells, images of gemmae stained with PI were analyzed using Fiji. The Z‐stack immunolocalization images were processed in Fiji using the Z‐project function with maximum intensity projection. For nuclei analysis, the Mean‐Shift Super Resolution (MSSR) method (Torres‐García et al. 2022) was applied with the following parameters: AMP = 5, FWHM of PSF = 4, and Order = 1. To analyze the results, ANOVA was performed followed by a Post Hoc Tukey HSD test.

3. Results

3.1. Auxin Positively Modulates MpANT Expression in the Meristematic Region of Marchantia polymorpha

The protein structure of MpANT is like that of A. thaliana APB proteins, and the sequence and length of the DNA‐binding AP2‐R1—linker—AP2‐R2 region display a high degree of conservation (Figure 1A,B). The spatiotemporal transcriptional pattern of MpANT was characterized using a construct containing a 2.5 kb sequence upstream of the MpANT transcription start site (TSS) fused to the GFP gene (MpANT:GFP). GFP signal was observed in the apical notch regions (Figure 1C, mock) of young gemmae. Previous studies have shown that MpANT is co‐expressed with MpARF1 and MpARF2 in the apical meristem region of M. polymorpha (Flores‐Sandoval, Eklund, et al. 2018). Consistent with a putative link between MpARFs and MpANT, we identified 6 putative auxin‐responsive elements (AREs) in the MpANT cis‐regulatory region (Figure 1B; Dipp‐Álvarez and Cruz‐Ramírez 2019).

To investigate the role of auxin in regulating MpANT transcription, we plated gemma in mock, the auxin analogue 2,4‐D (10 μM), the auxin transport inhibitor NPA (10 μM), or a combination of NPA + 2,4‐D and observed the expression of MpANT:GFP 4 days post‐plated (dpp). The application of 2,4‐D expanded the GFP expression domain, with signal detected not only in the apical notch but also in the transition zone (Figure 1C). Inhibition of auxin transport with NPA resulted in increased signal at the apical notch, suggesting that MpANT expression is influenced by auxin accumulation. Furthermore, the combination of exogenous auxin and transport inhibition expanded the expression pattern and created additional auxin maxima, as observed in the NPA + 2,4‐D‐treated plants (Figure 1C). Together, these results indicate that auxin signaling, perhaps through the MpARF1 activator, modulates MpANT transcription in response to auxin levels and distribution.

3.2. Gain‐ and Loss‐of‐Function Alleles Indicate MpANT Plays Key Roles in M. polymorpha Early Development

To investigate the biological roles of MpANT in Marchantia polymorpha early gemma development, both gain‐ and loss‐of‐function lines were generated. For the gain‐of‐function analysis, we generated an MpANT ectopic overexpression line with a translationally fused fluorescent reporter (35S:MpANT‐CITRINE; hereafter referred to as MpANT OE ). MpANT loss‐of‐function mutant alleles (hereafter referred to as Mpant) were generated as described in Section 2 and Figure S1.

We observed that Mpant gemmae were smaller than WT, with area quantification supporting a statistically significant reduction in size (Figure 2A,D). In contrast, MpANT OE gemmae were significantly larger than WT and Mpant plants (Figure 2A,E). These size differences were also evident in Mpant, MpANT OE , and WT young thalli, not only in the overall area but also in the putative meristematic region (Figure 2B,E).

FIGURE 2.

FIGURE 2

MpANT is important for meristem function in Marchantia thalli. Overall morphology of WT, Mpant, and MpANT OE thalli. (A) Gemmae morphology, the black dotted lines show a magnification of the apical notch. Black scale bar = 0.2 mm. (B) Thalli of 4 days‐post‐plated (dpp), the black dotted lines show the apical notches and white dotted lines show a magnification of the transition zones. White scale bar = 2 mm. (C) EdU incorporation assay to visualize the proliferative cells in the apical notch and transition zone of 4 dpp thalli. White dotted lines show Edu‐stained cells. BF, Bright field. Edu scale bar = 200 μm. (D) Gemmae area (mm2) of WT, MpANT OE , and Mpant (E) Meristem‐like areas (mm2) of WT, MpANT OE , and Mpant young thalli. (F) Area of Edu‐positive cells (μm2) in WT, MpANT OE , and Mpant young thalli. One‐way ANOVA followed by Tukey's post hoc test compared to WT (*p < 0.05 and **p < 0.01).

To correctly assess the impact of MpANT on cell proliferation in the meristematic regions, we performed EdU staining experiments on Mpant, MpANT OE , and WT thalli. We observed a reduction in the proliferative cell area in Mpant thalli compared to WT controls (Figure 2C,F). This finding aligns with recent studies characterizing loss‐of‐function mutants of MpANT, although in different Marchantia strains (Fu et al. 2024; Liu et al. 2024). In all three independent loss‐of‐function mutants, downregulation or absence of MpANT was found to compromise meristem function. In contrast, our results with MpANT OE plants revealed that MpANT ectopic overexpression expands the area of proliferative cells in young thalli, compared to WT plants (Figure 2C,F).

We also found that MpANT function is important for rhizoid cell development. PI staining and confocal microscopy imaging of 2 days post‐plated (dpp) gemmae from Mpant, MpANT OE , and WT plants revealed that Mpant gemmae developed fewer rhizoid initial cells compared to WT plants, while MpANT OE gemmae exhibited a greater number of rhizoid initials (Figure S2A–D).

3.3. MpANT Regulates Thallus Growth, Branching Architecture, and Antagonizes Gemma Cup Production in M. polymorpha

In M. polymorpha , thallus growth and organization are determined by the highly regulated division of apical and sub‐apical cells in the apical notch (Shimamura 2016). Our data show that MpANT plays a key role in meristem maintenance, influencing not only thalli growth and branching architecture, which is also known to be auxin‐dependent (Eklund et al. 2015; Streubel et al. 2023). To further investigate the role of MpANT, we analyzed the branching phenotypes and gemma cup production in Mpant and MpANTOE lines and compared them to WT plants.

At 14 dpp, Mpant and MpANT OE lines exhibited evident differences in branching patterns compared to WT plants (Figure 3A). The area of Mpant lines was smaller than that of WT controls, while MpANT OE lines showed a statistically significant increase in size (Figure 3C). In the meristematic zone, WT and MpANT OE lines exhibited the typical convex shape at the apical notch and formed dichotomous branching points (Solly et al. 2017). In contrast, Mpant lines showed delayed development, characterized by the formation of central lobes (Zoom‐in, Figure 3A). All lines contained approximately 12 gemma cups at 14 days, consistent with previous studies (Suzuki et al. 2020). At 1 month, significant differences in development area were observed among the lines (Figure 3B), though the number of plastochrons remained similar (Figure 3E). Notably, 30 dpp Mpant plants exhibited a dramatic overproduction of gemma cups, approximately 70 per plant, compared to around 40 and 30 gemma cups in plants of MpANT OE and WT lines, respectively (Figure 3F).

FIGURE 3.

FIGURE 3

Plastochron and branching analyses of WT, Mpant, and MpANT OE lines. (A) Thalli of 14 dpp. The black dotted lines show a zoomed‐in meristem zone, and the white arrowheads show differences in the notch divergence. (B) Phenotype of a 1‐month‐old WT, Mpant, and MpANT OE plants. (C) Area (mm2) of thallus 14 dpp. (D) Normal plastochron and gemmae cup development in 1‐month‐old plants. (E) Plastochron numbers analysis in WT, Mpant, and MpANT OE plants at 30 days. (F) Mean of gemmae cup number at 30 dpp. Scale bars = 1 cm. One‐way ANOVA followed by Tukey's post hoc test compared to Tak‐1 (*p < 0.05 and **p < 0.01), n.s. = non‐significant.

Since auxin influences MpANT expression (Figure 1C), we examined whether the gemmae cup phenotype observed in MpANT loss‐ and gain‐of‐function mutants is related to auxin. We treated Mpant and MpANT OE plants with NPA and exogenous auxin (2,4‐D) and noted gemmae cup overproduction in 21 old Mpant plants was drastically reduced from more than 30 gemmae cups in the mock medium to half of that in 2,4‐D treated plants and to an average of 3 in plants grown in NPA‐supplemented medium (Figure S3A,B). The effect of exogenous auxin and NPA on gemmae cup formation was even more pronounced in WT and MpANT OE plants, which exhibited a complete inhibition in both treatments compared to their respective control (Figure S3A,B). These results together suggest that MpANT plays an important role in gemmae cup formation. Although the negative role of auxin on gemmae cup formation has been previously described (Flores‐Sandoval et al. 2015), our findings implicate MpANT in this process.

3.4. Genome‐Wide Identification of MpANT Binding Sites Reveals Its Role in Development and Auxin Signaling

To identify potential targets of MpANT, we conducted a genome‐wide search in the M. polymorpha genome using the consensus APB DNA‐binding motif (CNTNGNNNNNNGTGC), as reported by Santuari et al. (2016). Our results show that approximately 13% (2515 genes) of the protein‐coding genes in the M. polymorpha genome could be regulated by MpANT (Figure S4A). Most of these predicted target genes harbor a single APB binding site, and the majority are located within 500 bp upstream of their transcription start sites (Figure S4B). Gene ontology analysis of the predicted target genes revealed that many are involved in critical biological processes such as development, morphogenesis, hormone signaling, and triterpene biosynthesis. Notably, a recent study by Fu et al. (2024), which performed ChIP‐Seq to identify MpANT targets, found overlap with our predictions, as 387 genes were shared between both datasets (Table S1).

Given that the MpANT promoter is responsive to different auxin levels, we further examined whether auxin‐related genes are regulated by MpANT. Our analysis revealed that the APB‐binding site is present in the promoter regions of MpPIN1 and MpTAA, two genes involved in auxin transport and synthesis, respectively. These genes are co‐expressed in the apical cell region, where MpANT expression is also prominent (Figure S5). We also performed a co‐expression analysis to identify genes whose transcript levels are highly correlated with MpANT expression across various tissues and developmental stages. Among the putative MpANT targets, we identified genes whose orthologs in A. thaliana are critical for development. Notably, MpMADS2, a MIKCc‐type MADS‐box gene, was found to be expressed at higher levels in gametangia (Figure S5) and is a predicted target of MpANT. In A. thaliana , there is evidence for interaction between the APB family and MIKCc‐type genes such as AGAMOUS (Krizek et al. 2020). Another putative MpANT target, MpSPL2 (Mp1g10030), is homologous to the SQUAMOSA PROMOTER‐BINDING LIKE (SPL) TFs in A. thaliana , which regulate the transition to the reproductive phase and the development of floral organs.

These findings indicate that MpANT regulates diverse processes in M. polymorpha by modulating the expression of genes involved in development and auxin signaling. To explore the role of MpANT in auxin‐related pathways, we analyzed the transcript levels of several auxin‐related genes in Mpant lines at 7 and 14 days post‐plated (dpp) by qRT‐PCR. At 7 dpg, genes such as MpYUC1, MpYUC2, MpARF1, MpARF3, MpTAA, and multiple MpPIN genes were moderately downregulated in Mpant plants compared to WT controls (Figure 4A). At 14 dpp, a stronger downregulation of MpANT, MpARF1, MpARF2, MpARF3, MpTAA, MpPIN1, and MpPIN2 was observed (Figure 4A). Additionally, we examined the expression of MpGRAS3 (Mp1g10440) and MpCYCD, which are involved in cell proliferation and meristem maintenance in Arabidopsis root stem cell niche. Both genes showed slight downregulation in Mpant plants compared to the control (Figure 4A).

FIGURE 4.

FIGURE 4

MpANT regulates the transcription of genes involved in auxin synthesis and auxin transport, including MpPIN1, which is the sole ortholog of long AtPINs. (A) RT‐qPCR analyses of auxin‐related genes and putative MpANT targets at 7 and 14 dpg in WT and Mpant plants. (B) Graphic representation of the hydrophilic loop in AtPIN1 (against which the polyclonal antibody α‐PIN1, used in our study, was generated), comparison with MpPIN1 and the partial deletion of such region Mppin1‐4 mutant. (C) Colocalization of α‐PIN1 in Wt and MpPIN1:MpPIN1‐Citrine line, the white dotted lines show zoom in the apical notch, rhizoids and attachment cells. Colocalization test shows the Persons correlation coefficient (R) of α‐PIN1 and MpPIN1:MpPIN1‐Citrine channels. White scale bar = 100 μm. (D) Zoom in the apical notch, rhizoids and attachment cells, signal of α‐PIN1 and pro MpPIN1:MpPIN1‐Citrine and Colocalization test. White scale bar = 100 μm.

3.5. MpANT Acts Upstream of MpPIN1 Localization and Auxin Distribution

We demonstrated that auxin concentration and distribution are crucial for proper MpANT expression in the apical notch. These findings, alongside the presence of several AREs in the MpANT promoter (Figure 1B), suggest that MpARFs regulate MpANT expression in response to the auxin maxima formed at the apical notch. Previous studies (Flores‐Sandoval et al. 2015) showed that disrupting auxin signaling affects gemmae cup formation and thallus branching; all phenotypic alterations we observed in Mpant loss‐ and gain‐of‐function lines. In Arabidopsis, PLT genes act downstream of auxin signaling but also regulate genes involved in auxin synthesis and transport in a feedback loop (Horstman et al. 2014).

Since MpANT acts upstream of MpPIN1 and MpPIN2, we investigated the patterns of IAA distribution and MpPIN1 localization in WT, Mpant, and MpANT OE gemmaelings. For this, we performed immunofluorescence assays with antibodies against IAA and MpPIN1. To assess the potential usefulness and specificity of a commercial antibody generated against AtPIN1 to recognize MpPIN1, we performed diverse in silico analyses (see Section 2) which indicated that AtPIN1 shares greater identity with MpPIN1 than with other M. polymorpha PIN proteins (Fisher et al. 2023; Figure S6), supporting the use of this antibody for specifically detecting MpPIN1. Furthermore, we corroborated that the phosphorylation sites critical for proper AtPIN protein localization are well conserved in MpPIN1 (Fisher et al. 2023; Figure S6).

Besides the previously described in silico analyses, we performed immunofluorescence assays in the gemmae of Mppin1‐8 mutant (Fisher et al. 2023) complemented with MpPIN1:MpPIN1‐Citrine construct (In figures labeled as MpPIN1‐Citrine). Our results show a high correlation in the expression patterns among signals in red (α‐PIN1) and green (MpPIN1‐CITRINE) as shown in Figure 4C,D. This pattern is representative of several other independent events, as shown in Figure S7.

Other evidence supporting that α‐PIN1 is indeed recognizing MpPIN1 protein is shown in Figure S8. We performed immunofluorescent assays with the α‐PIN1 antibody in gemmae of the Mppin1‐4 mutant, in which a big portion of the hydrophilic region was deleted but still encodes a fragment of such region (Figure 4B). Our results show that, compared to WT gemmae, the expression pattern of MpPIN1 is affected in localization and intensity (Figure S8).

To explore the role of MpANT over auxin distribution, as well as on MpPIN1 localization, we performed double immunofluorescence assays using α‐PIN1 and α‐IAA antibodies. Our results revealed significant differences in the localization of IAA and MpPIN1. In WT gemmae, auxin maxima were observed in the apical notch, rhizoid initials (green, fluorescent signal, Figure 5A,C), and the gemmae stalk. MpPIN1 was also localized to the membranes of apical notch and rhizoid cells (red fluorescent signal, Figure 5A–C). However, in Mpant gemmae, this pattern was drastically altered. MpPIN1 no longer localized to the cell membranes but instead re‐localized to other organelle membranes, as observed in both the apical notch cells and rhizoid initials (Figure 5A–C). To quantitatively measure this phenomenon, we segmented α‐PIN1 signal in cells of different regions of gemmae from the three diverse genetic backgrounds and plotted the Number of segmentation points located in the membrane and the cytosol (Figure 5A,B). Moreover, we observed not only that MpPIN1 is mislocalized but also that the IAA distribution is affected, with the auxin signal shifting from the apical notch to the cytoplasm and membranes of rhizoid cells (Figure 5C). These patterns were consistent, as observed in other gemmae of each of the genetic backgrounds analyzed (Figure S9).

FIGURE 5.

FIGURE 5

MpANT acts upstream polar localization of MpPIN1 and auxin distribution in Marchantia gemmae. (A) Immunolocalization assays detecting MpPIN1 and IAA in gemmae of WT, Mpant, and MpANT OE , the red signal corresponds to α‐PIN1 (Alexa Fluor 594 conjugated secondary antibody), the green signal to free IAA (Alexa Fluor 488 conjugated secondary antibody). The white color in (A) shows the segmentation process of α‐PIN1 signal localization in the central zone cells. (B) Number of segmentation points located in the membrane and the cytosol in each genetic background. One‐way ANOVA followed by Tukey's post hoc test compared to Tak‐1 (**p < 0.01). White scale bar = 100 μm. (C) PIN1 and IAA distributions in apical notch and rhizoid cells. In the notch zone, white arrows show IAA accumulation in the border cell, transitions zone, apical, and sub‐apical cell, respectively. In rhizoid cells, white arrows show the IAA accumulation in the endomembrane and inside the rhizoid cells. White scale bars = 50 μm.

Intrigued by the mislocalization of MpPIN1 in the Mpant gemmae, we conducted further double immunofluorescence assays for MpPIN1 and auxin detection, staining with DAPI to denote the nuclei. In some cases, we observed co‐localization of MpPIN1 with the DAPI signal, suggesting potential nuclear localization. However, a detailed analysis using Mean Shift Super‐Resolution (MSSR) on WT, Mpant, and MpANT OE gemmae revealed that MpPIN1 was localized outside the nucleus (Figure S10).

In summary, our immunolocalization assays showed differences in the distribution and accumulation of MpPIN1 and IAA signals in Wt, Mpant, and MpANT OE gemmae (Figure 5 and Figure S9). In WT, IAA and DAPI signals overlapped, while MpPIN1 was localized around the nucleus (Figure S10). In Mpant gemmae, IAA and MpPIN1 signals were also localized to the cytoplasm, far from the nucleus (Figure 5 and Figure S9). In contrast, MpANT OE lines exhibited a highly polarized distribution of MpPIN1 at the plasma membrane (Figure 5 and Figure S9).

Our in silico comparisons among AtPINs and MpPIN1 proteins show that the phosphosites in AtPIN1, which are targets of AtPINOID (AtPID) for the localization of AtPIN1 to the plasma membrane, are highly conserved in MpPIN1. Based on the conserved phosphosites, we speculate the existence of a Kinase that could exert a function orthologous to that AtPID exerts over AtPIN1. AtPID is an AGC kinase and, using its sequence, we found three AGC‐Kinases in Marchantia (Bowman et al. 2017; Figure S11A).

Moreover, since in the Mpant gemmae the localization of MpPIN1 is drastically altered, we speculated whether MpANT could be influencing, indirectly, MpPIN1 localization by regulating the transcription of the putative MpAGCs. In silico analyses of the promoters of these three MpAGCs showed that all the intergenic regions upstream of the ATG of the genes contain several MpANT response elements (MpANT‐REs) as well as several ARF binding sites or AREs (Figure S11B), suggesting that one or more of these MpAGCs could be regulated by MpARFs and/or MpANT. With this hypothesis in mind, we quantified transcript levels of the three MpAGC genes in Mpant gemmae at 0 and 3 days post‐germination (dpg) and compared them to those in Wt gemmae at the same time points. Our RT‐qPCR assays showed that at 0 dpg, transcript levels of Mp8g16840.1 and Mp8g11302.1 were very low in both Wt and Mpant. In contrast, Mp6g08530.1 transcripts were approximately four times more abundant in Wt than in the mutant. At 3 dpg, transcript levels of Mp8g16840.1 and Mp8g11302.1 were clearly reduced in Mpant compared to Wt, while the difference in Mp6g08530.1 transcript levels between the two backgrounds was less pronounced than at 0 dpg (Figure S11C). These results suggest that MpANT positively regulates the transcription of these MpAGC genes.

4. Discussion

4.1. A Genetic Program Driven by MpANT Maintains a Stem Cell Niche in Coordination With the Auxin Pathway

The PLETHORA TFs are essential for the maintenance of the stem cell niche in the root apical meristem of A. thaliana . PLTs act in gradients of expression and are key players of a network that establishes a feed‐forward positive loop for auxin maxima formation. PLT TFs directly regulate genes involved in auxin synthesis and transport, and conversely, PLTs expression in the RAM depends on auxin maxima formation. Our study and two other recent ones (Fu et al. 2024; Liu et al. 2024) show that MpANT transcription is active in the meristem of Marchantia thalli and concur that loss‐of‐function MpANT mutants result in reduced meristematic activity leading to smaller plants (Figure 2). Therefore, MpANT is essential for the proper size and function of the stem cell niche in Marchantia. On the other hand, MpANT overexpression expands the region of proliferative cells in a pattern that suggests a correlation between auxin gradient and zonation of stem cells; its transit amplifying daughters and the final differentiation towards the midrib. Liu et al. (2024) proposed that MpANT restricts cell proliferation and meristem size through its transcriptional target MpCLE1. However, our EdU staining results show that overexpression of MpANT expands the meristem and the stem cell pool. We should explore whether any aspects of the Mpant phenotype are MpCLE1‐dependent in future studies. Fu et al. (2024) also propose that MpANT promotes meristem maintenance via MpWOX but Hirakawa et al. (2020) showed that Mpwox mutants are not meristem‐deficient. We should also consider that while we generated all our research in the widely distributed strain Tak‐1, Liu et al. (2024) used the Upp strain. It is important to note that differences among the phenotypes of diverse mutant alleles reported in this study, as well as those previously reported (Fu et al. 2024; Liu et al. 2024), not only depend on the growth conditions but also on the Marchantia strains used, and the promoters driving the constructs, that is, p35S versus pER8, the later an artificial expression system based on Zuo et al. (2000) technical design. It is important to note that, besides all these differences, all alleles share major phenotypes related to the meristematic function of MpANT and its involvement in the auxin signaling pathway.

4.2. A Feed‐Forward Loop Involving MpANT , Auxin Transport and Auxin Distribution Modulates Marchantia Development

The MpANT transcription domain is defined by auxin transport, distribution, and concentration, most probably by the action of MpARFs on MpANT (Figures 1 and 6), in turn MpANT induces the expression of its direct and indirect transcriptional targets, some of them related to auxin synthesis and auxin transport (Figures 4 and 6). This network creates a positive loop for meristem function in which MpANT modulates MpANT transcription (Figure 6). Liu et al. (2024) position MpANT as directly regulating MpGRAS9, while Fu et al. (2024) proposed that MpANT regulates MpWOX, MpGRAS3, and MpCYCD, which are downstream of MpANT (Figure 4). These observations indicate that the link between the two main pathways for stem cell niche maintenance in Arabidopsis, the Aux‐AtPLT and the SHR‐SCR‐CYCD‐RBR regulatory networks, seems to be conserved in Marchantia. However, a clear definition of Marchantia's functional orthologs for several genes of these networks still needs to be defined.

FIGURE 6.

FIGURE 6

The roles of MpANT roles in regulatory networks in the meristem (purple box) and in epidermal cells (pink box) of Marchantia. Diverse studies and ours show the expression of MpANT in the apical notch, coincident with an auxin maximum. Here, we show that increasing auxin concentrations induces MpANT transcription, most probably via ARFs action. MpANT acts upstream of auxin synthesis genes MpTAA and MpYUC2 as well as on MpPIN1 involved in auxin transport. This loop is essential for the proper development of the Marchantia meristem. Additionally, in the epidermal cells, the localization of MpPIN1 to the plasma membrane depends on MpANT, probably by regulating the expression of putative AGC Kinases encoded in the Marchantia genome. The described functions for MpANT in the meristem and epidermal cells are not mutually exclusive.

Besides the auxin‐related putative targets of MpANT, we found several genes highly co‐expressed with MpANT, such as MpPYL1, the closest gene to MpANT in terms of co‐expression, and a putative MpANT target. MpPYL1 encodes an ABA receptor protein, with orthologs in Arabidopsis (AtPYL4‐6) involved in the ABA signaling pathway, particularly in response to environmental stress. Since both MpPYL1 and MpANT are co‐expressed in apical cells, it would be interesting to test whether they interact directly and if MpANT plays a role in ABA signaling in M. polymorpha . Additionally, we identified MpGRF, a gene moderately correlated with MpANT and expressed at higher levels in apical cells. In A. thaliana , GRF proteins are linked to proliferative niches in various organs and control the expression of PLT genes. Other co‐expressed genes were identified in specific regions, such as MpASLBD17 and MpRDR5/6‐2 in the young sporophyte, and MpCHK1, MpLFY, MpBHLH44, and MpDCL3 in the antheridia/archegonia. Other interesting targets predicted in our study and in Chip‐seq experiments in previous studies are grouped in Table S1; they are a rich source of new questions to explore, especially for key genes involved in development such as MpMADS2 and MpSPL2, which orthologs in Arabidopsis play important roles in plant development as previously mentioned. Together, these findings open new directions to explore the function of MpANT in other regulatory networks, organs and developmental stages.

4.3. MpANT Is Required for Proper MpPIN1 Subcellular Localization

In the cells of Mpant gemmae, MpPIN1 localization to the plasma membrane is severely affected (Figure 5 and Figure S9). This phenotype cannot be explained by the fact that MpPIN1 is a transcriptional target of MpANT. Plasma membrane localization of AtPIN1 relies on the phosphorylation status of AtPIN1 in specific residues, which are the substrate of the AGC Kinase AtPINOID (Ganguly et al. 2012; Sasayama et al. 2013). MpPIN1 is the sole long PIN protein in Marchantia and the residues targeted by the AGC kinase AtPINOID in AtPIN1 are conserved in MpPIN1 (Fisher et al. 2023). Therefore, we speculate that the mis‐localization of MpPIN1 in Mpant may be caused by changes in AGC kinase activity, of which there are Marchantia genes that encode for AGC Kinases (Bowman et al. 2017; Figure S11). That the promoter regions of each of these putative AGC Kinase‐encoding genes bears several potential MpANT‐response elements led us to propose a model where MpANT acts upstream of MpAGC transcription, as shown by RT‐qPCR analyses (Figure S11C). These results suggest that, in the absence of MpANT, the downregulation of AGC Kinase genes would cause MpPIN1 to lack proper phosphorylation and not be localized to the plasma membrane. However, the biochemical consequences of the downregulation of AGC Kinases in Mpant plants, over MpPIN1 phosphorylation status, remain to be determined.

This is the first report demonstrating MpANT acting upstream of MpPIN1 localization. We found that MpPIN1 is not localized inside the nucleus but instead around it (Figure 5 and Figure S10), consistent with the known intracellular trafficking patterns of long AtPINs, which also localized around the nucleus, mainly at the endoplasmic reticulum. Mis‐localization of MpPIN1 in the Mpant gemmae (Figure 5 and Figure S9) is correlated with the reduction of rhizoid formation (Figure S2). Therefore, MpANT is not only important for meristem maintenance, but also for the proper development of rhizoids. Future experiments are needed to define the exact mechanism that connects MpANT with MpAGC‐Kinases and MpPIN1 subcellular localization.

Author Contributions

The experimental plan was supervised by Alfredo Cruz‐Ramírez. Wet lab and in silico experiments were designed by Alfredo Cruz‐Ramírez, Dipp‐Álvarez Melissa, and Lorenzo‐Manzanarez J. Luis. Wetlab and in silico experiments were performed and/or analyzed by Dipp‐Álvarez Melissa, Lorenzo‐Manzanarez J. Luis, Espinal‐Centeno Annie, Méndez‐Álvarez Domingo, Fisher J. Tom, Olvera‐Martínez Fernando, Flores‐Sandoval Eduardo, León‐Ruiz Jesús, Bowman L. John, and Arteaga‐Vázquez A. Mario. The manuscript was written by Alfredo Cruz‐Ramírez, Lorenzo‐Manzanarez J. Luis, Dipp‐Álvarez Melissa, and reviewed by all authors.

Supporting information

Figure S1. Supplementary figures.

Table S1. Common MpANT targets among Genome‐wide in silico predicted in this study versus Chip‐Seq analyses by Liu et al. (2024).

PPL-177-e70365-s001.xlsx (64.9KB, xlsx)

Table S2. Primer sequences used for qPCR quantification.

Acknowledgments

Lorenzo‐Manzanarez J. Luis was supported by CONAHCYT‐Mexico through a postdoctoral fellowship (488063, 2023–2025). León‐Ruiz Jesús (CVU 858608) was supported by Consejo Nacional de Humanidades, Ciencia y Tecnología (CONAHCYT) with a PhD Fellowship and CINVESTAV Elisa Acuña grant. Dipp‐Álvarez Melissa was supported by Consejo Nacional de Humanidades, Ciencia y Tecnología (CONAHCYT) with a PhD Fellowship and CINVESTAV Elisa Acuña Grant. Flores‐Sandoval Eduardo and Bowman L. John were funded in part by The Australian Research Council Centre of Excellence for Plant Success in Nature and Agriculture (ce200100015). Arteaga‐Vázquez A. Mario was supported by Consejo Nacional de Ciencia y Tecnología (CONACYT) grant A1‐S‐38383 and UCMEXUS‐CONACYT Collaborative Grant CN‐20‐166.

Melissa, D.‐Á. , Luis L.‐M. J., Eduardo F.‐S., et al. 2025. “The Mp ANT‐Auxin Loop Modulates Marchantia polymorpha Development.” Physiologia Plantarum 177, no. 4: e70365. 10.1111/ppl.70365.

Handling Editor: P. Marhava

Dipp‐Álvarez Melissa and Lorenzo‐Manzanarez J. Luis should be considered as first authors.

Data Availability Statement

Data sharing is not applicable to this article as all new created data is already contained within this article.

References

  1. Abas, L. , Kolb M., Stadlmann J., et al. 2020. “Naphthylphthalamic Acid Associates With and Inhibits PIN Auxin Transporters.” Proceedings of the National Academy of Sciences of the United States of America 118, no. 1: e2020857118. 10.1073/pnas.2020857118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Aguilar‐Cruz, A. , Flores‐Sandoval E., Gutiérrez‐Ramos X., et al. 2023. “Control of Cell Fate Specification and Patterning by an Ancestral MicroRNA.” bioRxiv (Cold Spring Harbor Laboratory). 10.1101/2023.09.09.556951. [DOI] [Google Scholar]
  3. Aida, M. , Beis D., Heidstra R., et al. 2004. “The PLETHORA Genes Mediate Patterning of the Arabidopsis Root Stem Cell Niche.” Cell 119, no. 1: 109–120. 10.1016/j.cell.2004.09.018. [DOI] [PubMed] [Google Scholar]
  4. Bowman, J. L. 2022. “The Origin of a Land Flora.” Nature Plants 8, no. 12: 1352–1369. 10.1038/s41477-022-01283-y. [DOI] [PubMed] [Google Scholar]
  5. Bowman, J. L. , Arteaga‐Vazquez M., Berger F., et al. 2022. “The Renaissance and Enlightenment of Marchantia as a Model System.” Plant Cell 34: 3512–3542. 10.1093/plcell/koac219. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bowman, J. L. , Kohchi T., Yamato K. T., et al. 2017. “Insights Into Land Plant Evolution Garnered From the Marchantia polymorpha Genome.” Cell 171, no. 2: 287–304.e15. 10.1016/j.cell.2017.09.030. [DOI] [PubMed] [Google Scholar]
  7. Catarino, B. , Hetherington A. J., Emms D. M., Kelly S., and Dolan L.. 2016. “The Stepwise Increase in the Number of Transcription Factor Families in the Precambrian Predated the Diversification of Plants on Land.” Molecular Biology and Evolution 33: 2815–2819. [DOI] [PubMed] [Google Scholar]
  8. Chow, C. N. , Zheng H. Q., Wu N. Y., et al. 2016. “PlantPAN 2.0: An Update of Plant Promoter Analysis Navigator for Reconstructing Transcriptional Regulatory Networks in Plants.” Nucleic Acids Research 44, no. D1: D1154–D1160. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Delaux, P.‐M. , Hetherington A. J., Coudert Y., et al. 2019. “Current Biology Reconstructing Trait Evolution in Plant Evo‐Devo Studies.” Current Biology 29: 1105–1121. [DOI] [PubMed] [Google Scholar]
  10. Dipp‐Álvarez, M. , and Cruz‐Ramírez A.. 2019. “A Phylogenetic Study of the ANT Family Points to a preANT Gene as the Ancestor of Basal and euANT Transcription Factors in Land Plants.” Frontiers in Plant Science 10: 17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Dolan, L. 2009. “Body Building on Land—Morphological Evolution of Land Plants.” Current Opinion in Plant Biology 12, no. 1: 4–8. 10.1016/j.pbi.2008.12.001. [DOI] [PubMed] [Google Scholar]
  12. Donoghue, P. , and Paps J.. 2020. “Plant Evolution: Assembling Land Plants.” Current Biology 30, no. 2: R81–R83. 10.1016/j.cub.2019.11.084. [DOI] [PubMed] [Google Scholar]
  13. Eklund, D. M. , Ishizaki K., Flores‐Sandoval E., et al. 2015. “Auxin Produced by the Indole‐3‐Pyruvic Acid Pathway Regulates Development and Gemmae Dormancy in the Liverwort Marchantia polymorpha .” Plant Cell 27, no. 6: 1650–1669. 10.1105/tpc.15.00065. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Fisher, T. J. , Flores‐Sandoval E., Alvarez J. P., and Bowman J. L.. 2023. “PIN‐FORMED Is Required for Shoot Phototropism/Gravitropism and Facilitates Meristem Formation in Marchantia polymorpha .” New Phytologist 238, no. 4: 1498–1515. 10.1111/nph.18854. [DOI] [PubMed] [Google Scholar]
  15. Flores‐Sandoval, E. , Eklund D. M., and Bowman J. L.. 2015. “A Simple Auxin Transcriptional Response System Regulates Multiple Morphogenetic Processes in the Liverwort Marchantia polymorpha .” PLoS Genetics 11, no. 5: e1005207. 10.1371/journal.pgen.1005207. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Flores‐Sandoval, E. , Eklund D. M., Hong S.‐F., et al. 2018. “Class C ARFs Evolved Before the Origin of Land Plants and Antagonize Differentiation and Developmental Transitions in Marchantia polymorpha .” New Phytologist 218: 1612–1630. 10.1111/nph.15090. [DOI] [PubMed] [Google Scholar]
  17. Flores‐Sandoval, E. , Romani F., and Bowman J. L.. 2018. “Co‐Expression and Transcriptome Analysis of Marchantia polymorpha Transcription Factors Supports Class C ARFs as Independent Actors of an Ancient Auxin Regulatory Module.” Frontiers in Plant Science 9: 1345. 10.3389/fpls.2018.01345. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Floyd, S. K. , and Bowman J. L.. 2007. “The Ancestral Developmental Tool Kit of Land Plants.” International Journal of Plant Sciences 168, no. 1: 1–35. 10.1086/509079. [DOI] [Google Scholar]
  19. Fu, J. , Zhou C., Ma F., Zhao J., Yu F., and Cui H.. 2024. “The PLETHORA Homolog in Marchantia polymorpha Is Essential for Meristem Maintenance, Developmental Progression, and Redox Homeostasis.” Plant & Cell Physiology 65, no. 8: 1231–1244. 10.1093/pcp/pcae055. [DOI] [PubMed] [Google Scholar]
  20. Galinha, C. , Hofhuis H., Luijten M., et al. 2007. “PLETHORA Proteins as Dose‐Dependent Master Regulators of Arabidopsis Root Development.” Nature 449, no. 7165: 1053–1057. 10.1038/nature06206. [DOI] [PubMed] [Google Scholar]
  21. Ganguly, A. , Lee S. H., and Cho H. T.. 2012. “Functional Identification of the Phosphorylation Sites of Arabidopsis PIN‐FORMED3 for Its Subcellular Localization and Biological Role.” Plant Journal 71, no. 5: 810–823. 10.1111/j.1365-313X.2012.05030.x. [DOI] [PubMed] [Google Scholar]
  22. Heinz, S. , Benner C., Spann N., et al. 2010. “Simple Combinations of Lineage‐Determining Transcription Factors Prime Cis‐Regulatory Elements Required for Macrophage and B Cell Identities.” Molecular Cell 38, no. 4: 576–589. 10.1016/j.molcel.2010.05.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Hirakawa, Y. 2022. “Evolution of Meristem Zonation by CLE Gene Duplication in Land Plants.” Nature Plants 8, no. 7: 735–740. 10.1038/s41477-022-01199-7. [DOI] [PubMed] [Google Scholar]
  24. Hirakawa, Y. , Fujimoto T., Ishida S., et al. 2020. “Induction of Multichotomous Branching by CLAVATA Peptide in Marchantia polymorpha .” Current Biology: CB 30, no. 19: 3833–3840.e4. 10.1016/j.cub.2020.07.016. [DOI] [PubMed] [Google Scholar]
  25. Horstman, A. , Willemsen V., Boutilier K., and Heidstra R.. 2014. “AINTEGUMENTA‐LIKE Proteins: Hubs in a Plethora of Networks.” Trends in Plant Science 19, no. 3: 146–157. 10.1016/j.tplants.2013.10.010. [DOI] [PubMed] [Google Scholar]
  26. Ishizaki, K. 2017. “Evolution of Land Plants: Insights From Molecular Studies on Basal Lineages.” Bioscience, Biotechnology, and Biochemistry 81, no. 1: 73–80. 10.1080/09168451.2016.1224641. [DOI] [PubMed] [Google Scholar]
  27. Iwasaki, M. , Kajiwara T., Yasui Y., et al. 2021. “Identification of the Sex‐Determining Factor in the Liverwort Marchantia polymorpha Reveals Unique Evolution of Sex Chromosomes in a Haploid System.” Current Biology 31, no. 24: 5522–5532.e7. 10.1016/j.cub.2021.10.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Kato, H. , Ishizaki K., Kouno M., et al. 2015. “Correction: Auxin‐Mediated Transcriptional System With a Minimal Set of Components Is Critical for Morphogenesis Through the Life Cycle in Marchantia polymorpha .” PLoS Genetics 11, no. 6: e1005365. 10.1371/journal.pgen.1005365. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Kato, H. , Kouno M., Takeda M., et al. 2017. “The Roles of the Sole Activator‐Type Auxin Response Factor in Pattern Formation of Marchantia polymorpha .” Plant & Cell Physiology 58, no. 10: 1642–1651. 10.1093/pcp/pcx095. [DOI] [PubMed] [Google Scholar]
  30. Kato, H. , Mutte S. K., Suzuki H., et al. 2020. “Design Principles of a Minimal Auxin Response System.” Nature Plants 6, no. 5: 473–482. 10.1038/s41477-020-0662-y. [DOI] [PubMed] [Google Scholar]
  31. Kawamura, S. , Romani F., Yagura M., et al. 2022. “MarpolBase Expression: A Web‐Based, Comprehensive Platform for Visualization and Analysis of Transcriptomes in the Liverwort Marchantia polymorpha .” Plant & Cell Physiology 63, no. 11: 1745–1755. 10.1093/pcp/pcac129. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Kenrick, P. , and Crane P. R.. 1997. “The Origin and Early Evolution of Plants on Land.” Nature 389, no. 6646: 33–39. 10.1038/37918. [DOI] [Google Scholar]
  33. Kohchi, T. , Yamato K. T., Ishizaki K., Yamaoka S., and Nishihama R.. 2021. “Development and Molecular Genetics of Marchantia polymorpha .” Annual Review of Plant Biology 77: 677–702. 10.1146/annurev-arplant-082520. [DOI] [PubMed] [Google Scholar]
  34. Kondili, M. , Fust A., Preussner J., Kuenne C., Braun T., and Looso M.. 2017. “UROPA: A Tool for Universal RObust Peak Annotation.” Scientific Reports 7, no. 1: 2593. 10.1038/s41598-017-02464-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Krizek, B. A. , Blakley I. C., Ho Y., Freese N., and Loraine A. E.. 2020. “The Arabidopsis Transcription Factor AINTEGUMENTA Orchestrates Patterning Genes and Auxin Signaling in the Establishment of Floral Growth and Form.” Plant Journal 103, no. 2: 752–768. 10.1111/tpj.14769. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Kubota, A. , Ishizaki K., Hosaka M., and Kohchi T.. 2013. “Efficient Agrobacterium‐Mediated Transformation of the Liverwort Marchantia polymorpha Using Regenerating Thalli.” Bioscience, Biotechnology, and Biochemistry 77, no. 1: 167–172. 10.1271/bbb.120700. [DOI] [PubMed] [Google Scholar]
  37. Kunzmann, P. , Muller T. D., Greil M., et al. 2023. “Biotite: New Tools for a Versatile Python Bioinformatics Library.” BMC Bioinformatics 24, no. 1: 236. 10.1186/s12859-023-05345-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Lehti‐Shiu, M. D. , Panchy N., Wang P., Uygun S., and Shiu S. H.. 2017. “Diversity, Expansion, and Evolutionary Novelty of Plant DNA‐Binding Transcription Factor Families.” Biochimica et Biophysica Acta, Gene Regulatory Mechanisms 1860, no. 1: 3–20. 10.1016/j.bbagrm.2016.08.005. [DOI] [PubMed] [Google Scholar]
  39. Liu, W. , Yang Z., Cai G., et al. 2024. “MpANT Regulates Meristem Development in Marchantia polymorpha .” Cell Reports 43, no. 7: 114466. 10.1016/j.celrep.2024.114466. [DOI] [PubMed] [Google Scholar]
  40. Livak, K. J. , and Schmittgen T. D.. 2001. “Analysis of Relative Gene Expression Data Using Real‐Time Quantitative PCR and the 2(‐Delta Delta C(T)) Method.” Methods (San Diego, Calif.) 25, no. 4: 402–408. 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  41. Riechmann, J. L. , and Meyerowitz E. M.. 1998. “The AP2/EREBP Family of Plant Transcription Factors.” Biological Chemistry 379, no. 6: 633–646. 10.1515/bchm.1998.379.6.633. [DOI] [PubMed] [Google Scholar]
  42. Santuari, L. , Sanchez‐Perez G. F., Luijten M., et al. 2016. “The PLETHORA Gene Regulatory Network Guides Growth and Cell Differentiation in Arabidopsis Roots.” Plant Cell 28, no. 12: 2937–2951. 10.1105/tpc.16.00656. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Sasayama, D. , Ganguly A., Park M., and Cho H. T.. 2013. “The M3 Phosphorylation Motif Has Been Functionally Conserved for Intracellular Trafficking of Long‐Looped PIN‐FORMEDs in the Arabidopsis Root Hair Cell.” BMC Plant Biology 13: 189. 10.1186/1471-2229-13-189. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Shimamura, M. 2016. “ Marchantia polymorpha : Taxonomy, Phylogeny and Morphology of a Model System.” Plant & Cell Physiology 57, no. 2: 230–256. 10.1093/pcp/pcv192. [DOI] [PubMed] [Google Scholar]
  45. Solly, J. E. , Cunniffe N. J., and Harrison C. J.. 2017. “Regional Growth Rate Differences Specified by Apical Notch Activities Regulate Liverwort Thallus Shape.” Current Biology 27, no. 1: 16–26. 10.1016/j.cub.2016.10.056. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Streubel, S. , Deiber S., Rötzer J., Mosiolek M., Jandrasits K., and Dolan L.. 2023. “Meristem Dormancy in Marchantia polymorpha Is Regulated by a Liverwort‐Specific miRNA and a Clade III SPL Gene.” Current Biology: CB 33, no. 4: 660–674.e4. 10.1016/j.cub.2022.12.062. [DOI] [PubMed] [Google Scholar]
  47. Sugano, S. S. , Shirakawa M., Takagi J., et al. 2014. “CRISPR/Cas9‐Mediated Targeted Mutagenesis in the Liverwort Marchantia polymorpha L.” Plant and Cell Physiology 55, no. 3: 475–481. 10.1093/pcp/pcu014. [DOI] [PubMed] [Google Scholar]
  48. Supek, F. , Bošnjak M., Škunca N., and Šmuc T.. 2011. “REVIGO Summarizes and Visualizes Long Lists of Gene Ontology Terms.” PLoS One 6, no. 7: e21800. 10.1371/journal.pone.0021800. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Suzuki, H. , Harrison C. J., Shimamura M., Kohchi T., and Nishihama R.. 2020. “Positional Cues Regulate Dorsal Organ Formation in the Liverwort Marchantia polymorpha .” Journal of Plant Research 133, no. 3: 311–321. 10.1007/s10265-020-01180-5. [DOI] [PubMed] [Google Scholar]
  50. Torres‐García, E. , Pinto‐Cámara R., Linares A., et al. 2022. “Extending Resolution Within a Single Imaging Frame.” Nature Communications 13: 7452. 10.1038/s41467-022-34693-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Wilhelmsson, P. K. I. , Mühlich C., Ullrich K. K., and Rensing S. A.. 2017. “Comprehensive Genome‐Wide Classification Reveals That Many Plant‐Specific Transcription Factors Evolved in Streptophyte Algae.” Genome Biology and Evolution 9, no. 12: 3384–3397. 10.1093/gbe/evx258. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Yang, Z. , Xia J., Hong J., et al. 2022. “Structural Insights Into Auxin Recognition and Efflux by Arabidopsis PIN1.” Nature 609, no. 7927: 611–615. 10.1038/s41586-022-05143-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Zuo, J. , Niu Q. W., and Chua N. H.. 2000. “Technical Advance: An Estrogen Receptor‐Based Transactivator XVE Mediates Highly Inducible Gene Expression in Transgenic Plants.” Plant Journal 24, no. 2: 265–273. 10.1046/j. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1. Supplementary figures.

Table S1. Common MpANT targets among Genome‐wide in silico predicted in this study versus Chip‐Seq analyses by Liu et al. (2024).

PPL-177-e70365-s001.xlsx (64.9KB, xlsx)

Table S2. Primer sequences used for qPCR quantification.

Data Availability Statement

Data sharing is not applicable to this article as all new created data is already contained within this article.


Articles from Physiologia Plantarum are provided here courtesy of Wiley

RESOURCES