Abstract
Background
Leishmaniases, caused by protozoan parasites of the genus Leishmania, are vector-borne diseases occurring mainly in the tropics and subtropics of the world, as well as in the Mediterranean Basin. In this area, the mammalian pathogen Leishmania infantum is endemic, along with the reptile-associated Leishmania tarentolae. The two species occur in sympatry, and there is evidence that the exposure to L. tarentolae in mammalian hosts may elicit a protective immune response towards pathogenic Leishmania species. Accurate detection methods for both species are therefore crucial for gathering comprehensive information on the epidemiology of leishmaniases. In microbiological diagnosis, limits in detection performance imply the risk of false negatives and other issues, which highlights the need for sensitive methods.
Methods
Here, we developed a droplet digital polymerase chain reaction assay targeting the kinetoplast minicircle DNA, for the simultaneous and differential detection of L. infantum and L. tarentolae. The assay features primers designed to bind to both species and species-specific probes. The assay was validated on three cultured isolates for each species, whose cells were spiked into Leishmania-negative dog blood, and on Leishmania-positive sand flies. Sensitivity was assessed with testing serial dilutions, and specificity was evaluated by assessing the cross-reactivity of the probes with the controls of Leishmania-free dog blood and male sand fly DNA.
Results
The assay demonstrated high sensitivity, with a limit of detection corresponding to one Leishmania cell in the reaction mix for isolates of both L. infantum and L. tarentolae. Limited cross-reaction of the L. tarentolae-targeting probe was observed on L. infantum isolates. No cross-reaction was observed with the controls of Leishmania-free dog blood and male sand flies.
Conclusions
The protocol can represent a valuable method for comprehensive surveillance in both canine hosts and sand flies in areas in which L. infantum and L. tarentolae occur in sympatry.
Graphical Abstract
Keyword: Droplet digital PCR, Leishmania infantum, Leishmania tarentolae, Leishmaniasis, Epidemiology, Sand flies
Background
Leishmaniases are vector-borne diseases caused by protozoan parasites of the genus Leishmania (Kinetoplastida: Trypanosomatidae), which are transmitted to their vertebrate hosts via the bite of infected female sand flies (Diptera: Psychodidae: Phlebotominae) [1]. These diseases represent a significant public health burden in various parts of the world, particularly in tropical and subtropical regions, and are also endemic in the Mediterranean Basin [2].
In Italy, human cutaneous leishmaniasis (CL) and visceral leishmaniasis (VL), as well as canine leishmaniasis (CanL), are endemic and are caused by Leishmania infantum Nicolle, 1908 [3]. In the country, the main vectors of L. infantum are sand flies of the species Phlebotomus perniciosus Newstead, 1911 and Phlebotomus perfiliewi Parrot, 1930 [4, 5].
In addition, the reptile-associated Leishmania tarentolae Wenyon, 1921 has also been detected in Italy [5–9]. This parasite is regarded as non-pathogenic to humans and mammals in general, and is therefore exploited as an antigen production and vaccine development platform [10, 11]. The ecology and epidemiology of L. tarentolae, however, remain poorly understood. Leishmania tarentolae is vectored by sand flies of the species Sergentomyia minuta (Rondani, 1843), which feed mainly on reptiles [12]. Nevertheless, this parasite may circulate in vectors other than S. minuta, as L. tarentolae DNA has been detected in the sand fly P. perniciosus in Italy [6, 13]. This finding is in accordance with the development of L. tarentolae in P. perniciosus under laboratory conditions [14]. The parasite may also circulate in non-reptilian hosts, and evidence of this was gathered in central and southern Italy by molecular detection of L. tarentolae in dogs and humans [9, 13]. Moreover, S. minuta sand flies have been reported to feed on humans both in captivity [15] and in the wild [16, 17], and may therefore transmit L. tarentolae to non-reptilian hosts. This is particularly interesting given that exposure of mammalian hosts to L. tarentolae may elicit a protective immune response towards pathogenic Leishmania species [18]. On the other hand, in Italy, the DNA of L. infantum has been detected in sand flies of the species S. minuta [13, 19]. Furthermore, the DNA of both species of Leishmania has been detected simultaneously in sand fly vectors and vertebrate hosts in the country [8, 9]. In addition, in Italy, S. minuta and P. perniciosus have repeatedly been collected in the same sites, raising the potential occurrence of L. infantum and L. tarentolae in (i) sympatric conditions, (ii) unconventional vectors (e.g. L. infantum in S. minuta and L. tarentolae in Phlebotomus spp.), and iii) unconventional hosts (e.g. L. infantum in reptiles and L. tarentolae in mammals) [6, 9].
Therefore, accurately detecting both L. infantum and L. tarentolae in sand flies and vertebrate hosts is essential for reconstructing leishmaniasis epidemiological scenarios and for providing insights into the transmission dynamics of the infection. Traditional diagnostic methods, such as microscopy and polymerase chain reaction (PCR), may have limitations in terms of sensitivity, specificity, and quantification accuracy, particularly when dealing with complex biological samples containing low concentrations of parasite DNA [20]. For this reason, droplet digital PCR (ddPCR) has emerged as a powerful tool for the detection and quantification of nucleic acids with unparalleled sensitivity, specificity, and accuracy. By partitioning PCR reactions into thousands of individual droplets, ddPCR enables absolute quantification of target DNA molecules, overcoming many of the limitations associated with traditional PCR methods [20]. For this reason, ddPCR has been employed in the detection of a variety of pathogenic microorganisms [21–25]. Only three ddPCR protocols for the detection of Leishmania DNA have been published to date: the first protocol was developed for the detection of Leishmania braziliensis Vianna, 1911 DNA in samples obtained from patients affected by cutaneous leishmaniasis [26], the second for the quantification of L. infantum in dogs [27], and the third protocol was validated on six Leishmania isolates representing five species [28]. In addition, to the best of our knowledge, no ddPCR protocols have been developed and published for the screening of Leishmania spp. in sand fly vectors.
We developed a novel ddPCR assay targeting the minicircles of the kinetoplast DNA (kDNA) for the sensitive and specific simultaneous detection of L. tarentolae and L. infantum and validated this method on DNA samples derived from laboratory-maintained Leishmania strains, spiked to Leishmania-free dog blood, and from wild-caught sand flies. The method showed high sensitivity, allowing for the detection of low parasite loads, and high specificity, showing only minimal cross-reactivity.
Methods
Oligonucleotide design
A region encompassing the Conserved Sequence Blocks 1 and 2 (CSB 1 and CSB 2) of the kinetoplast minicircles was chosen as the ddPCR target. Sequences from L. infantum, L. tarentolae, L. donovani (Laveran et Mesnil, 1903), L. major Yakimoff et Schokhor, 1914, L. tropica Wright, 1903, and L. braziliensis Vianna, 1911 were aligned to design the primers and the probes. The primers were designed to amplify both L. tarentolae and L. infantum DNA, whereas the probes were designed to be species-specific. The resulting amplicon was 56 bp long. The absence of cross-reaction and formation of secondary structure of primers and probes was verified using the PrimerPooler software [29]. The probes were labelled with the FAM fluorophore for L. tarentolae and with the HEX fluorophore for L. infantum. All the primers and probes were manufactured by Eurofins Genomics (Konstanz, Germany). The oligonucleotide sequences are reported in Table 1.
Table 1.
Oligonucleotides designed and employed for the validation of the ddPCR assay
| Oligonucleotide name | Type | Target gene | Species | Sequence (5′-3′) |
|---|---|---|---|---|
| MC_Leish_F | Forward primer | Minicircles CSB 1 and CSB 2 | L. tarentolae + L. infantum | TCCCAAACTTTTTAGGTC |
| MC_Leish_R | Reverse primer | Minicircles CSB 1 and CSB 2 | L. tarentolae + L. infantum | GCRWTTTTGGCCAWTTTTTG |
| MC_tar_FAM | Probe FAM | Minicircles CSB 1 and CSB 2 | L. tarentolae | CCGAAAACCGAAAAATGCATGCA |
| MC_inf_HEX | Probe HEX | Minicircles CSB 1 and CSB 2 | L. infantum | GCGAAAACSGAAAAATGGGTGCA |
ddPCR experiment conditions
Each ddPCR reaction targeting L. tarentolae and L. infantum minicircles included 11 μL of Bio-Rad ddPCR Supermix for Probes (No dUTP) (Bio-Rad, Hercules, CA, USA) primers at a final concentration of 900 nM and probes at a final concentration of 250 nM, 0.78 μL of Milli-Q water, and 5 μL of DNA. The assays were performed in the QX200 Droplet Digital PCR System (Bio-Rad, Hercules, CA, USA). The PCR reaction was conducted on a SimpliAmp Thermal Cycler (Applied Biosystems, Waltham, MA, USA) following a thermal protocol of 10 min at 95 °C for denaturation, 50 cycles of annealing at 50 °C, and elongation at 72 °C. Annealing temperatures were chosen after gradient PCR experiments (see below).
Dog blood handling
The methods to handle dog blood, which is derived from a previous study [30], were approved by the Clinvet Institutional Animal Care and Use Committee (no. CG1331-CVMO22/216). All experiments involving the use of dog blood were performed in accordance with the ARRIVE guidelines and international regulations. All methods were carried out in accordance with relevant guidelines and regulations.
ddPCR assay validation
Leishmania-cultured cells spiked in dog blood
The ddPCR assay validation was performed on DNA extracted from both L. tarentolae and L. infantum cultures spiked into Leishmania-negative dog blood, derived from another study [30]. For L. tarentolae, the commercial P10 strain (Jena Bioscience, Jena, Germany), maintained in Brain Heart Infusion (BHI) broth, was used. Alongside the P10 strain, the DNA of wild L. tarentolae strains “W”, isolated from the sand fly vector S. minuta, and “RI325”, isolated from the reptile host Tarentola mauritanica (Linnaeus, 1758), were used. Both wild strains were isolated at the Parasitology and Micology laboratory of the University of Bari Aldo Moro and were maintained in Schneider broth. For L. infantum, the DNA of the MHOM/TN/80/IPT-1 reference strain (Office International des Epizooties [OIE] Reference Laboratory National Reference Center for Leishmaniasis—C.Re.Na.L., Palermo, Italy) and the “S” and “G” strains recently isolated from dogs from southern Italy were used. The dog strains were isolated at the University of Bari Aldo Moro and maintained in Schneider’s Drosophila medium.
Leishmania cells were counted in a counting chamber under a Leica DM300 optical microscope (Leica Microsystems, Germany) and then spiked to 100 µl of Leishmania-negative dog blood. Amounts of 106, 5 × 105, 105, 5 × 104, 104, 5 × 103, 103, 5 × 102, 102, 50, and 20 cells were used. These quantities correspond to 104, 5 × 103, 103, 5 × 102, 102, 50, 10, 5, 1, 0.5, and 0.2 cells/µl of blood, respectively. The mixture was then subjected to DNA extraction using the DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany). The elution step was carried out in 100 μl, and 5 μl of DNA was added to the ddPCR mix. This means that the estimated Leishmania DNA present in the mix should correspond to 1/20 of the DNA of the original cell quantities, namely to 5 × 104, 25 × 103, 5 × 103, 25 × 102, 500, 250, 50, 25, 5, 2.5, and 1 cell, respectively.
The annealing temperatures of the assay thermal protocol were selected based on gradient PCR experiments, with temperatures ranging from 45 °C to 60 °C. Each of the isolated serial dilutions was run in triplicate.
Cross-reactivity testing
The potential of cross-reactivity of the probes was assessed by testing the DNA extracted from the dog blood which Leishmania cells where spiked to, and the DNA extracted from four male sand flies, collected during routine monitoring activity carried out by laboratory members.
Wild-caught sand flies
Fifteen female sand fly DNA samples from the collection of the Parasitology and Micology laboratory of the University of Bari Aldo Moro were used to validate the ddPCR assay (n. 13 = S. minuta; n. 2 = P. perniciosus). These sand flies have been collected in the Valenzano municipality, Bari district. Their DNA samples have been previously screened for both L. tarentolae and L. infantum with a duplex quantitative real-time PCR (qPCR) assay targeting the first Internal Transcribed Spacer (ITS-1) region [31].
Statistical analyses
All the statistical analyses of the study were carried out in the R programming environment (https://www.r-project.org/).
Results
ddPCR annealing set-up
The optimal annealing temperature for detecting L. tarentolae and L. infantum was determined through experimentally established gradients using Leishmania-free dog blood spiked with Leishmania cells coming from the six above-mentioned laboratory-maintained strains (see Methods section). For L. tarentolae, the best amplification performance was obtained at 55 °C. A non-specific population of droplets was present at 3500 Relative Fluorescence Units (RFUs) amplitude but was clearly distinguishable from the droplets of interest, which form at around 5500–6000 RFUs amplitude (Fig. 1). “Rain” was observed between the non-specific population and the droplets of interest.
Fig. 1.
ddPCR assay sensitivity assessment on dog blood spiked with serial dilutions of the commercial P10 L. tarentolae strain (Jena Bioscience), and the wild “W” and “RI325” L. tarentolae strains. Annealing temperature of 55 °C. The limit of detection is 0.2 Leishmania cells/μl of DNA extracted from dog blood added to the ddPCR mix, corresponding to one Leishmania cell present in the ddPCR mix. The fluorescence amplitude intensity is indicated on the y-axis. Each dot represents an individual droplet. The pink line represents the amplitude threshold above which a droplet is assigned as positive (i.e. it contains one or more target copies, coloured in blue), and below which a droplet is assigned as negative (i.e. it contains no target copies, coloured in grey). For each sample, the number of Leishmania cells per μL of input DNA sample is shown above, while the concentration of target DNA copies per μL of input DNA sample is displayed in the box below
As for L. infantum detection, the best amplification performance was obtained at 50 °C instead of 55 °C. The maximum density of droplets in positive samples was localized between 3000 and 4000 RFUs, with more “rain” observed compared to the L. tarentolae isolates. However, the positive droplets were distinguishable from the negative droplets occurring at around 2000 RFUs. A statistically significant difference was observed after comparing the concentrations of target DNA obtained from the above-mentioned serial dilutions of L. infantum MHOM/TN/80/IPT-1 reference strain at 50 °C and 55 °C of annealing (Shapiro–Wilk test for normality P-value = 0.004754; Wilcoxon signed rank exact test, P-value = 0.01563). In summary, the annealing temperature of 55 °C resulted to be too high for L. infantum, and a temperature of 50 °C was chosen instead (Fig. 2). When testing L. tarentolae samples at 50 °C annealing, no significant differences were observed with regard to the results obtained at 55 °C, considering the above-mentioned serial dilutions of the L. tarentolae P10 isolate (Shapiro–Wilk test for normality P-value = 0.006; Wilcoxon signed rank exact test, P-value = 0.1563). The only difference was observed in the droplets’ amplitude: at 50 °C annealing, positive droplets showed an amplitude of ~ 8000 RFUs, while the non-specific population had an amplitude of 5000 RFUs. The positive and negative droplets remained clearly separated. Rain was still observed. In conclusion, for duplex application targeting both Leishmania species, we decided to set the annealing temperature at 50 °C.
Fig. 2.
ddPCR assay sensitivity assessment on dog blood spiked with serial dilutions of the L. infantum “MHOM/TN/80/IPT-1” reference strain (OIE Reference Laboratory National Reference Center for Leishmaniasis—C.Re.Na.L., Palermo, Italy), and the wild “S” and “G” L. infantum strains (University of Bari Aldo Moro). Annealing temperature of 50 °C. The limit of detection is 0.2 Leishmania cells/μl of DNA extracted from dog blood added to the ddPCR mix, corresponding to one Leishmania cell present in the ddPCR mix. The fluorescence amplitude intensity is indicated on the y-axis. Each dot represents an individual droplet. The pink line represents the amplitude threshold above which a droplet is assigned as positive (i.e. it contains one or more target copies, coloured in green), and below which a droplet is assigned as negative (i.e. it contains no target copies, coloured in grey). For each sample, the number of Leishmania cells per μL of input DNA sample is shown above, while the concentration of target DNA copies per μL of input DNA sample is displayed in the box below
Assay sensitivity and specificity
The presented ddPCR assay showed high sensitivity. The assay limit of detection for both species was 0.2 Leishmania cells/μl of dog blood. In other words, the assay is able to detect the DNA of one Leishmania cell present in the ddPCR mix (0.2 cells/5 μl of DNA in the mix).
During the assay validation process, specificity was assessed by testing the Leishmania-spiked dog blood, inverting the probes (i.e. FAM included in the mix for L. infantum and HEX for L. tarentolae). No cross-reaction occurred for the HEX probe with regards to L. tarentolae-spiked blood, while one to four FAM-positive droplets were observed in L. infantum-spiked blood, regardless of the parasite concentrations (Fig. 3).
Fig. 3.
ddPCR specificity assessment by testing for cross-reaction between the FAM probe and the L. infantum DNA extracted from the three isolates used in the study. Annealing temperature of 50 °C. A maximum of four FAM-positive droplets were detected when analysing L. infantum samples. Therefore, any result with fewer than five FAM-positive droplets should be considered negative. The fluorescence amplitude intensity is indicated on the y-axis. Each dot represents an individual droplet. The pink line represents the amplitude threshold above which a droplet is assigned as positive (i.e. it contains one or more target copies, coloured in blue), and below which a droplet is assigned as negative (i.e. it contains no target copies, coloured in grey)
The ddPCR assay also showed high specificity: the HEX probe, targeting L. infantum, showed no cross-reactivity with Leishmania-free dog blood. Regarding the FAM probe, targeting L. tarentolae, only a single droplet resulted positive at 50 °C of annealing while testing dog DNA (Fig. 4). While testing Leishmania-free male sand flies (see Methods section), the HEX probe targeting L. infantum did not hybridize with the DNA extracted from the insects. Considering the FAM probe, two positive droplets were detected in three out of four male DNA samples, while in the fourth one positive droplet was detected (Fig. 4). However, while testing DNA of female L. infantum positive sand flies (see next section) no cross reaction occurred between the FAM probe and the DNA of those samples.
Fig. 4.

ddPCR assay specificity assessment on the controls represented by DNA extracted from Leishmania-negative dog blood and male sand flies. Annealing temperature of 50 °C. Each sample has been tested with both the FAM probe, targeting L. tarentolae, and with the HEX probe, targeting L. infantum. A maximum of two FAM-positive droplets have been observed in the sand fly samples, whereas no droplets hybridized with the HEX probe. Given the threshold set after testing for cross-reaction between the FAM probe and the L. infantum DNA, the control samples should be considered negative. For each sample, the FAM result is shown in the box on the top, while the HEX result is displayed in the box below. The fluorescence amplitude intensity is indicated on the y-axis. Each dot represents an individual droplet. The pink line represents the amplitude threshold above which a droplet is assigned as positive (i.e. it contains one or more target copies, coloured in blue), and below which a droplet is assigned as negative (i.e. it contains no target copies, coloured in grey)
The concentration, expressed as copies of target/µL, of the serial dilutions of the L. tarentolae “W” isolates and all L. infantum isolates did not exhibit a constant decrease between the samples of 1, 0.5, and 0.2 parasite cells/µL of dog blood. This may be due to the effect of chance or to dilution errors that can occur at such low cell concentrations.
ddPCR vs ITS-1 qPCR
The ddPCR, targeted to the minicircle, and the qPCR, targeted to the ITS-1 (see Methods section), showed congruence in their results on 11 out of 15 sand fly DNA samples (73.3%). Two S. minuta sand flies resulted positive to L. tarentolae only at qPCR testing, but positive to both L. tarentolae and L. infantum after the application of the ddPCR herein described. In addition, one S. minuta sand fly and one P. perniciosus sand fly showed positivity to L. tarentolae after qPCR, but ddPCR resulted positive to L. infantum, and negative to L. tarentolae. The ddPCR target amplicon concentrations and qPCR quantification cycles (cqs) are reported in Table 2. The ddPCR results are reported in Fig. 5.
Table 2.
Results of ITS-1-targeted qPCR and ddPCR on the same female Leishmania-positive samples.
Samples whose corresponding cells are highlighted in red showed positivity to both species after ddPCR; samples whose corresponding cells are highlighted in blue were positive only for L. infantum after ddPCR, despite having shown positivity for L. tarentolae in the qPCR results
Fig. 5.
Results of the ddPCR testing of the qPCR-Leishmania-positive sand flies from the collection of the University of Bari Aldo Moro. Annealing temperature of 50 °C. Each sample has been tested with both the FAM probe, targeting L. tarentolae, and with the HEX probe, targeting L. infantum. For each sample, the FAM result is shown in the box on the top, while the HEX result is displayed in the box below. Sample names are indicated at the bottom of the HEX box. The fluorescence amplitude intensity is indicated on the y-axis. Each dot represents an individual droplet. The pink line represents the amplitude threshold above which a droplet is assigned as positive (i.e. it contains one or more target copies, coloured in blue or green), and below which a droplet is assigned as negative (i.e. it contains no target copies, coloured in grey)
Estimation of parasite number in sand flies
Comparing the concentrations obtained from ddPCR quantification of serial Leishmania cell dilutions in dog blood can provide a broad estimate of the number of parasite cells infecting the tested sand flies. Three individual sand fly females showed the maximum ddPCR concentration of 1,000,000 copies of amplified target DNA/μl. All the other samples ranged from less than one copy of target/μl to ~ 11,500 copies of target/μl. Based on these results, we estimated parasite numbers, which ranged from less than one to 5000 or more, in positive sand flies, as reported in Table 3. We emphasize that, in saturated samples (i.e. those with maximum ddPCR concentration of 100,000 copies), the number of parasite cells at 5000 could be an underestimation.
Table 3.
Estimated number of parasite cells in relation to concentration values of “W” isolate for L. tarentolae and “G” isolate for L. infantum
| Sand fly ID | Species | Estimated L. tarentolae cells | Estimated L. infantum cells |
|---|---|---|---|
| 31 | S. minuta | 5000 and up | 0 |
| 74 | S. minuta | less than 1 | 0 |
| 190 | S. minuta | less than 1 | 0 |
| 192 | S. minuta | 5000 and up | 0 |
| 197 | S. minuta | 2.5—5 parasites | 0 |
| 199 | S. minuta | 2.5—5 parasites | 0 |
| 202 | S. minuta | ~ 25 parasites | 0 |
| 279 | S. minuta | 5000 and up | 0 |
| 288 | S. minuta | Over 500 | 0 |
| 454 | S. minuta | ~ 1 parasite | 0 |
| 364 | P. perniciosus | 0 | 50–250 parasites |
| 292 | S. minuta | ~ 250 parasites | less than 1 parasite |
| 372 | S. minuta | less than 1 parasite | 0 |
| 365 | S. minuta | 0 | ~ 1 parasite |
| 393 | P. perniciosus | 0 | less than 1 parasite |
Discussion
The ddPCR assay described in the present research demonstrated high sensitivity and specificity. Setting the annealing temperature to 50 °C does not represent a limit for the detection of L. tarentolae, as the non-specific population of droplets is clearly distinguishable from the positive droplets of interest. The limit of detection for L. tarentolae corresponds to 0.2 Leishmania cells/μl of dog blood, or, in other words, to one Leishmania cell included in the reaction mix, therefore, the assay can represent a powerful tool for estimating parasite prevalence in extensive epidemiological screenings.
Rain was observed in all samples. As our aim was to develop an assay for large epidemiological screenings, we kept a “conservative” threshold in terms of the amplitude of droplets that have to be considered positive. Excluding the rain by raising the threshold for positive droplets lowers the concentration detected by the assay. However, even by setting the threshold in a way in which all rain is excluded, the limit of detection of the assay does not change.
Our assay was characterized by minimal cross-reactivity of the probes with the non-target Leishmania species and with the controls represented by dog and sand fly DNA. The complete absence of cross-hybridization with the non-targets was observed in every experimental condition for the HEX probe targeting L. infantum. Limited hybridization of the FAM probe, targeted on L. tarentolae, occurred with non-targets instead. Indeed, up to four positive droplets were obtained analysing L. infantum samples and the controls of Leishmania-free dog blood and male sand flies. Therefore, in our assay, a result with fewer than five FAM-positive droplets and zero HEX-positive droplets should be classified as negative.
Of the 15 female Leishmania-positive sand fly samples tested with the ddPCR assay, 11 were consistent with the qPCR results obtained previously, using ITS-1 as the target [31]. Two S. minuta sand flies resulted positive only to L. tarentolae after qPCR, but also resulted positive to L. infantum after ddPCR, with a post-amplification target DNA concentration of less than one copy/μl. This result suggests a possible contact of these sand flies with L. infantum parasites, with the corresponding molecular signature undetected after the ITS-1-targeted qPCR. The ddPCR assay, instead, successfully revealed this signature, likely due to the use of kDNA minicircles as the target of the assay. These mitochondrial elements occur in thousands of copies per parasite [32], in contrast to the ITS-1 nuclear region, which is present in only 20 to 200 copies per cell [33]. This marked difference in copy number translates into a higher sensitivity of ddPCR, particularly when dealing with samples harbouring low parasite loads. The simultaneous detection of L. tarentolae and L. infantum in the tested sand flies is also in accordance with the finding of co-infected sand flies coming from the same area where the samples were collected [7]. One S. minuta and one P. perniciosus sand fly tested positive for L. tarentolae after ITS-1-targeted qPCR; however, after ddPCR application, the same samples were positive for L. infantum and negative for L. tarentolae. This incongruence may reflect mitonuclear discordance occurring in the Leishmania parasites infecting these sand flies. In mitonuclear discordance, nuclear and mitochondrial genomes have discordant evolutionary histories; this causes topological discordance between nuclear gene and mitochondrial gene-based phylogenies, ultimately resulting in incorrect species identification [34]. Mitonuclear discordance is the result of genetic exchange between different species, resulting in the formation of hybrids. The biological mechanism on the basis of mitonuclear discordance in Leishmania remains poorly understood, but there is experimental evidence that the genetic exchange between the parental species happens in the sand fly vector [34]. Therefore, we could interpret the discordance in the results we obtained as an example of mitonuclear discordance, occurring in two out of the 15 sand flies constituting the dataset tested in our study (frequency = 13.3%), with nuclear DNA (ITS-1) of L. tarentolae and mitochondrial DNA (kDNA) of L. infantum. A study in Peru described a similar frequency of New World Leishmania hybrids in samples obtained from CL human patients [35]. Our study provides the first evidence to date of mitonuclear discordance and possible hybridization between the representatives of two subgenera of the Leishmania genus, namely L. (Leishmania) and L. (Sauroleishmania). This also represents the first possible report of the phenomenon observed in wild-caught sand flies. The sympatric occurrence of L. infantum and L. tarentolae may enhance the possibilities of hybridization of these two Leishmania species [12]. This may have happened in the collection area of the sand flies tested in our study, in which the two Leishmania species coexist. Therefore, the use of both mitochondrial- and nuclear-targeted detection methods is recommended in areas where more than one species is present.
The method of ddPCR does not require the construction of a standard curve because it relies on the absolute quantification of the target molecules. Nevertheless, serial dilutions can be useful to experimentally determine the assay limit of detection. By comparing the ddPCR quantification of the serial dilution of Leishmania cells in dog blood, we can perform a broad estimation of the parasite cell number infecting the tested sand flies. The value of the concentration of L. tarentolae in three sand fly samples reached saturation (i.e. 1,000,000 copies of target/μl). This result is in accordance with the ITS-1 targeted qPCR cqs of these samples, which are amongst the lowest in the dataset. While preparing serial dilutions of L. tarentolae isolates employed in the ddPCR validation, the saturation was reached starting from 100,000 L. tarentolae cells (corresponding to 5000 parasite cells added in the reaction mix; not shown) spiked in dog blood. Therefore, the sand flies representing the above-mentioned samples could have harboured 5000 or more Leishmania cells. One sand fly sample showed a concentration higher than 10,000 L. tarentolae cells (corresponding to 500 parasite cells added in the reaction mix; not shown). The number of parasites estimated for the other samples ranged from less than 1 to 250 parasites. The estimated parasite count of less than one cell in some samples may result from mere contact between the sand fly and parasite DNA, rather than indicating an established infection. Indeed, these samples showed higher cqs when tested with the ITS-1 targeted qPCR. Overall, the estimation of Leishmania cells in sand flies, although being approximate, is consistent with the quantifications reported in the literature [36–38].
However, our ddPCR assay suffers from some limitations, some of them intrinsic to the method. The ddPCR is more expensive than the qPCR. For instance, in qPCR the cost is approximately $1.70 per sample, while in ddPCR the cost for a single sample is ∼$5.00. Moreover, ddPCR may be more prone to contamination than qPCR. Considering that ddPCR can detect minimal amounts of target DNA, the higher risk of contamination compared to qPCR is a disadvantage in the studies of Leishmania prevalence in sand flies. These insects can be collected and stored with methods by which they can come in close contact (i.e. sticky traps), and contamination may occur. Therefore, the assay may ultimately result in lower specificity due to a higher number of false-positive samples. To overcome this problem, as the limit of detection is as low, an experimental threshold should be set in order to identify possible cross-reactions, especially with other sand fly and Leishmania species. In fact, in this study, we were able to validate the assay only on P. perniciosus and S. minuta sand flies, and we did not include other Leishmania species apart from L. tarentolae and L. infantum.
Conclusions
In this study, we present the first ddPCR protocol developed for the simultaneous detection of L. tarentolae and L. infantum parasites in both reservoir hosts and vectors. The assay exhibited high sensitivity, detecting low levels of DNA of both L. tarentolae and L. infantum parasites spiked into dog blood samples. This demonstrates the assay’s utility for reliable Leishmania detection in dog blood, underscoring its potential as a valuable tool for clinical diagnostics and early intervention in canine leishmaniasis. To our knowledge, this is the first ddPCR assay validated for use on sand flies. By enabling accurate detection of Leishmania in sand fly populations, this assay could significantly enhance monitoring efforts and inform targeted control strategies in endemic regions. This dual application makes the protocol highly valuable for comprehensive surveillance in both canine hosts and sand flies. To prevent misinterpretation of results, we highlight the importance of establishing an experimental threshold, particularly for L. tarentolae, to avoid false positives. Additionally, we recommend that screening for Leishmania parasites include both mitochondrial and nuclear targets to account for potential mitonuclear discordance.
Acknowledgements
All visuals were generated using BioRender.com. We thank Davide Pagan and Gianluca Lombardo for the editing of the visuals. We thank Francesca Dionisio of Bio-Rad laboratories for the assistance and support during the assay validation process.
Author contributions
Conceptualization, S.E. and A.A.; Methodology, S.E., A.A., and G.M.C.; Formal analysis, A.A., S.E., and M.B.; Writing—original draft preparation, A.A.; Writing—review and editing, S.E., C.B., I.V.B., R.M., A.M., V.G., and M.S.C.; Visuals preparation; Supervision, J.M.R. and D.O.; Funding acquisition, S.E. and C.B.
Funding
The authors thank EU funding within the NextGeneration EU-MUR PNRR Extended Partnership initiative on Emerging Infectious Diseases (Project no. PE00000007, INF-ACT).
Availability of data and materials
All the data generated in the paper are available in the paper itself.
Declarations
Ethics approval and consent to participate
The dog blood used for the presented research was obtained from a previous study. [30]. The methods to handle dog blood were approved by the Clinvet Institutional Animal Care and Use Committee (n° CG1331-CVMO22/216).
Consent for publication
Not applicable.
Competing interests
S.E. is an Associate Editor for Parasites & Vectors, and A.M. is employed by VisMederi Srl. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationship.
Footnotes
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Cecílio P, Cordeiro-da-Silva A, Oliveira F. Sand flies: Basic information on the vectors of leishmaniasis and their interactions with Leishmania parasites. Commun Biol. 2022;5:305. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Mann S, Frasca K, Scherrer S, Henao-Martínez AF, Newman S, Ramanan P, et al. A review of leishmaniasis: current knowledge and future directions. Curr Trop Med Rep. 2021;8:121–32. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Ferroglio E, Maroli M, Gastaldo S, Mignone W, Rossi L. Canine leishmaniasis, Italy. Emerg Infect Dis. 2005;11:1618–20. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Calzolari M, Carra E, Rugna G, Bonilauri P, Bergamini F, Bellini R, et al. Isolation and molecular typing of Leishmania infantum from Phlebotomus perfiliewi in a re-emerging focus of leishmaniasis Northeastern Italy. Microorganisms. 2019;7:644. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Maroli M, Gramiccia M, Gradoni L, Ready PD, Smith DF, Aquino C. Natural infections of phlebotomine sandflies with Trypanosomatidae in central and south Italy. Trans R Soc Trop Med Hyg. 1988;82:227–8. [DOI] [PubMed] [Google Scholar]
- 6.Iatta R, Mendoza-Roldan JA, Latrofa MS, Cascio A, Brianti E, Pombi M, et al. Leishmania tarentolae and Leishmania infantum in humans, dogs and cats in the Pelagie archipelago, southern Italy. PLoS Negl Trop Dis. 2021;15:e0009817. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Mendoza-Roldan JA, Zatelli A, Latrofa MS, Iatta R, Bezerra-Santos MA, Annoscia G, et al. Leishmania (Sauroleishmania) tarentolae isolation and sympatric occurrence with Leishmania (Leishmania) infantum in geckoes, dogs and sand flies. PLoS Negl Trop Dis. 2022;16:e0010650. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Mendoza-Roldan JA, Latrofa MS, Tarallo VD, Manoj RR, Bezerra-Santos MA, Annoscia G, et al. Leishmania spp. in Squamata reptiles from the Mediterranean basin. Transbound Emerg Dis. 2022;69:2856–66. [DOI] [PubMed] [Google Scholar]
- 9.Mendoza-Roldan JA, Latrofa MS, Iatta R, Manoj RRS, R, Panarese R, Annoscia G, et al. Detection of Leishmania tarentolae in lizards, sand flies and dogs in southern Italy, where Leishmania infantum is endemic: hindrances and opportunities. Parasit Vect. 2021;14:461. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Bandi C, Mendoza-Roldan JA, Otranto D, Alvaro A, Louzada-Flores VN, Pajoro M, et al. Leishmania tarentolae: a vaccine platform to target dendritic cells and a surrogate pathogen for next generation vaccine research in leishmaniases and viral infections. Parasit Vect. 2023;16:35. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Epis S, Varotto-Boccazzi I, Manenti A, Rubolini D, Gabrieli P, Cattaneo GM, et al. Efficacy of mucosal vaccination using a protozoan parasite as a vehicle for antigen delivery: IgG and neutralizing response after rectal administration of LeCoVax-2, a candidate vaccine against COVID-19. Pharmacol Res. 2022;186:106546. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Mendoza-Roldan JA, Votýpka J, Bandi C, Epis S, Modrý D, Tichá L, et al. Leishmania tarentolae : a new frontier in the epidemiology and control of the leishmaniases. Transbound Emerg Dis. 2022;69:e1326-e1337. 10.1111/tbed.14660. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Pombi M, Giacomi A, Barlozzari G, Mendoza-Roldan J, Macrì G, Otranto D, et al. Molecular detection of Leishmania (Sauroleishmania) tarentolae in human blood and Leishmania (Leishmania) infantum in Sergentomyia minuta : unexpected host-parasite contacts. Med Vet Entomol. 2020;34:470–5. [DOI] [PubMed] [Google Scholar]
- 14.Ticha L, Kykalova B, Sadlova J, Gramiccia M, Gradoni L, Volf P. Development of Various Leishmania (Sauroleishmania) tarentolae Strains in three phlebotomus species. Microorganisms. 2021;9:2256. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Ticha L, Volfova V, Mendoza-Roldan JA, Bezerra-Santos MA, Maia C, Sadlova J, et al. Experimental feeding of Sergentomyia minuta on reptiles and mammals: comparison with Phlebotomus papatasi. Parasit Vect. 2023;16:126. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Abbate JM, Maia C, Pereira A, Arfuso F, Gaglio G, Rizzo M, et al. Identification of trypanosomatids and blood feeding preferences of phlebotomine sand fly species common in Sicily Southern Italy. PLoS ONE. 2020;15:e0229536. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.González E, Molina R, Aldea I, Iriso A, Tello A, Jiménez M. Leishmania sp detection and blood-feeding behaviour of Sergentomyia minuta collected in the human leishmaniasis focus of southwestern Madrid, Spain (2012–2017). Transbound Emerg Dis. 2020;67:1393–400. [DOI] [PubMed] [Google Scholar]
- 18.Breton M, Tremblay MJ, Ouellette M, Papadopoulou B. Live nonpathogenic parasitic vector as a candidate vaccine against visceral leishmaniasis. Infect Immun. 2005;73:6372–82. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Latrofa MS, Iatta R, Dantas-Torres F, Annoscia G, Gabrielli S, Pombi M, et al. Detection of Leishmania infantum DNA in phlebotomine sand flies from an area where canine leishmaniosis is endemic in southern Italy. Vet Parasitol. 2018;253:39–42. [DOI] [PubMed] [Google Scholar]
- 20.Hou Y, Chen S, Zheng Y, Zheng X, Lin J-M. Droplet-based digital PCR (ddPCR) and its applications. TrAC, Trends Anal Chem. 2023;158:116897. [Google Scholar]
- 21.Dong L, Li W, Xu Q, Gu J, Kang Z, Chen J, et al. A rapid multiplex assay of human malaria parasites by digital PCR. Clin Chim Acta. 2023;539:70–8. [DOI] [PubMed] [Google Scholar]
- 22.Huang J-T, Liu Y-J, Wang J, Xu Z-G, Yang Y, Shen F, et al. Next generation digital PCR measurement of hepatitis B virus copy number in formalin-fixed paraffin-embedded hepatocellular carcinoma tissue. Clin Chem. 2015;61:290–6. [DOI] [PubMed] [Google Scholar]
- 23.King JL, Smith AD, Mitchell EA, Allen MS. Validation of droplet digital PCR for the detection and absolute quantification of Borrelia DNA in Ixodes scapularis ticks. Parasitology. 2017;144:359–67. [DOI] [PubMed] [Google Scholar]
- 24.Li H, Bai R, Zhao Z, Tao L, Ma M, Ji Z, et al. Application of droplet digital PCR to detect the pathogens of infectious diseases. 2018. Biosci Rep. 10.1042/BSR20181170. [DOI] [PMC free article] [PubMed]
- 25.Strain MC, Lada SM, Luong T, Rought SE, Gianella S, Terry VH, et al. Highly precise measurement of HIV DNA by droplet digital PCR. PLoS ONE. 2013;8:e55943. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Ramírez JD, Herrera G, Muskus C, Mendez C, Duque MC, Butcher R. Development of a digital droplet polymerase chain reaction (ddPCR) assay to detect Leishmania DNA in samples from Cutaneous Leishmaniasis patients. Int J Infect Dis. 2019;79:1–3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Pereira DCA, Teixeira-Neto RG, Lopes VV, Pena HP, Paz GF, Custodio CHX, et al. Development of quantitative PCR and digital PCR for the quantification of Leishmania infantum in dogs. Mol Cell Biochem. 2023;478:2445–50. [DOI] [PubMed] [Google Scholar]
- 28.Chen W, Hou J, Wang, Ma Y. Comparison of droplet digital PCR and real-time PCR for Leishmania detection. Chin J Zoonoses. 2023;39:986–92. [Google Scholar]
- 29.Brown SS, Chen Y-W, Wang M, Clipson A, Ochoa E, Du M-Q. PrimerPooler: automated primer pooling to prepare library for targeted sequencing. Biol Methods Protoc. 2017;2:bpx06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Mendoza-Roldan JA, Varotto-Boccazzi I, Louzada-Flores VN, Evans A, Cheikhi IB, Carbonara M, et al. Saurian-associated Leishmania tarentolae in dogs: Infectivity and immunogenicity evaluation in the canine model. PLoS Pathog. 2024;20:e1012598. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Latrofa MS, Mendoza-Roldan JA, Manoj RRS, Pombi M, Dantas-Torres F, Otranto D. A duplex real-time PCR assay for the detection and differentiation of Leishmania infantum and Leishmania tarentolae in vectors and potential reservoir hosts. Entomologia. 2021;41:543–51. [Google Scholar]
- 32.Kocher A, Valière S, Bañuls A-L, Murienne J. High-throughput sequencing of kDNA amplicons for the analysis of Leishmania minicircles and identification of Neotropical species. Parasitology. 2018;145:585–94. [DOI] [PubMed] [Google Scholar]
- 33.Toz SO, Culha G, Zeyrek FY, Ertabaklar H, Alkan MZ, Vardarlı AT, et al. A real-time ITS1-PCR based method in the diagnosis and species identification of Leishmania parasite from human and dog clinical samples in Turkey. PLoS Negl Trop Dis. 2013;7:e2205. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Kato H, Cáceres AG, Gomez EA, Tabbabi A, Mizushima D, Yamamoto DS, et al. Prevalence of genetically complex Leishmania strains with hybrid and mito-nuclear discordance. Front Cell Infect Microbiol. 2021;11:625001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Tabbabi A, Cáceres AG, Bustamante Chauca TP, Seki C, Choochartpong Y, Mizushima D, et al. Nuclear and kinetoplast DNA analyses reveal genetically complex Leishmania strains with hybrid and mito-nuclear discordance in Peru. PLoS Negl Trop Dis. 2020;14:e0008797. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Rogers ME, Ilg T, Nikolaev AV, Ferguson MAJ, Bates PA. Transmission of cutaneous leishmaniasis by sand flies is enhanced by regurgitation of fPPG. Nature. 2004;430:463–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Kimblin N, Peters N, Debrabant A, Secundino N, Egen J, Lawyer P, et al. Quantification of the infectious dose of Leishmania major transmitted to the skin by single sand flies. Proc Natl Acad Sci USA. 2008;105:10125–30. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Giraud E, Martin O, Yakob L, Rogers M. Quantifying Leishmania metacyclic promastigotes from individual sandfly bites reveals the efficiency of vector transmission. Commun Biol. 2019;2:84. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Citations
- Li H, Bai R, Zhao Z, Tao L, Ma M, Ji Z, et al. Application of droplet digital PCR to detect the pathogens of infectious diseases. 2018. Biosci Rep. 10.1042/BSR20181170. [DOI] [PMC free article] [PubMed]
Data Availability Statement
All the data generated in the paper are available in the paper itself.






