Skip to main content
NCBI home page
Biomolecules & Therapeutics logoLink to Biomolecules & Therapeutics
. 2025 Jun 30;33(4):704–715. doi: 10.4062/biomolther.2025.023

MST3 Regulates AMPK and YAP-Hippo Signaling in Cell Models Relevant to Renal Fibrosis

Chee-Hong Chan 1,†, Te-Jung Lu 2,†, Bo-Ying Bao 3, Po-Chen Chu 4, Yu-Kai Chen 5, Syuan-Long Syu 5, Wen-Yih Jeng 6,*, Te-Ling Lu 3,*
PMCID: PMC12215031  PMID: 40592764

Abstract

YAP is a transcription cofactor in the Hippo pathway that interacts with the TEAD family of transcription factors in the nucleus to promote CTGF expression and stimulate cell growth. YAP hyperactivation is frequently observed in fibrotic diseases. The main kinases in the Hippo pathway, MST1/2, a member of the STE20 family, promote Lats phosphorylation, leading to YAP phosphorylation, which prevents its nuclear entry and thus inhibits cell growth. High cell density induces Lats phosphorylation, causing YAP phosphorylation and its exclusion from the nucleus. Additionally, energy stress, such as glucose deprivation, induces AMPK phosphorylation, which also prevents YAP from entering the nucleus. MST3, another member of the STE20 family, has been shown to regulate cell apoptosis, migration, polarization, and ion homeostasis in previous studies. We hypothesized that MST3 is involved in Hippo pathway-mediated fibrosis. To test this, we overexpressed HA-tagged MST3 (HA-MST3) and a kinase-dead mutant (HA-MST3-KD) in MDCK cells. When cells reached a high density, HA-MST3 was activated to phosphorylate YAP, promoting its nuclear exit and inhibiting cell growth. In contrast, HA-MST3-KD cells showed reduced phosphorylated YAP, resulting in YAP retention in the nucleus, continuous cell growth, and NIH/3T3 cell fibrosis. Interestingly, YAP did not exit the nucleus in HA-MST3-KD cells treated with the YAP inhibitor verteporfin, but it did exit under metformin treatment due to energy stress, accompanied by increased AMPK and YAP phosphorylation, which inhibited MST3-KD-mediated fibrosis. These findings suggest that metformin-induced AMPK activation could provide a therapeutic approach for MST3-KD-mediated fibrosis.

Keywords: STK24, MST3, YAP, Hippo pathway, Metformin, AMPK

INTRODUCTION

The Hippo pathway is crucial in control organ size through regulating cell apoptosis, proliferation, differentiation, and tissue regeneration. The core component of the Hippo pathway is the transcription cofactor YAP. YAP in nuclei interacts with transcription factor TEAD to promote gene expression. Constitutive activation of the YAP can lead to a range of diseases, including cancer and fibrosis in several tissues (Zhu et al., 2015; Mia and Singh, 2022). Increased YAP in the nuclear distribution of renal proximal tubule epithelial cells (RPTC) were observed in patients with acute kidney injury (AKI) and patients with diabetes (Chen et al., 2018, 2020). Under severe AKI, these active YAP in the nuclei constitutively promote target gene expression, such as CTGF and cyr61, leading to kidney damage (Chen et al., 2020). The increased CTGF expression with transforming growth factor (TGF)-β promote the activation of fibroblast, leading to kidney fibrosis (Bradham et al., 1991; Frangogiannis, 2020). Inducible deletion of YAP specifically in RPTC significantly attenuated diabetic tubulointerstitial fibrosis in HEK 293 cells (Chen et al., 2020). These results indicate that YAP needs to be tightly regulated to maintain kidney function and excessive activation can cause kidney fibrosis.

The nuclear localization of YAP is regulated by energy status to meet cellular energy demands. When cells experience glucose deprivation, AMP levels increase, activating AMPK, which then phosphorylates YAP at multiple sites, including S94. This phosphorylated YAP disrupts the YAP-TEAD interaction, inhibiting YAP’s function in the nucleus. Thus, AMPK, as a key cellular energy sensor, is activated under energy stress, leading to YAP phosphorylation and inhibiting cell growth. Metformin, a first-line drug for treating type 2 diabetes, has been associated with a reduced incidence of cancer in diabetic patients. Recent studies have shown that metformin-mediated AMPK activation induces YAP phosphorylation and inhibits YAP’s transcriptional activity (DeRan et al., 2014; Mo et al., 2015; Wang et al., 2015).

In addition to AMPK-mediated YAP phosphorylation, MST1 and MST2 are the core kinases of Hippo pathway that phosphorylate YAP at several serine residues. Phosphorylation of YAP at serine 127, in association with 14-3-3, sequesters YAP in the cytoplasm, leading to its degradation and preventing its nuclear accumulation (Zhao et al., 2007; Hao et al., 2008; Zhao et al., 2008). In the kidneys of MST1/2 double knockout mice, YAP is not phosphorylated, leading to increased YAP nuclear accumulation in tubular cells and higher expression levels of Cyr61 and CTGF compared to control mice. These mice exhibit inflammation, tubular lesions, fibrosis, and chronic kidney disease, suggesting that MST1/2-mediated YAP activation could prevent the progression of kidney fibrosis by suppressing Cyr61 and CTGF expression (Xu et al., 2020).

The mammalian sterile 20-like serine/threonine kinase (STK) family includes MST1, MST2, MST3, MST4, and STK25, with MST1/2 kinases representing the canonical Hippo-YAP pathway. The loss of MST1/2 results in the overactivation of YAP, leading to various cancers and fibrosis (Harvey et al., 2013; Xu et al., 2020; Mia and Singh, 2022).

MST4 induces gastritis through the non-canonical Hippo-YAP pathway (An et al., 2020). Our research found that MST3 plays diverse roles, such as triggering apoptosis through caspase-mediated activation and nuclear translocation, leading to DNA fragmentation and morphological changes (Huang et al., 2002). MST3 inhibits cell migration by phosphorylating and inhibiting the protein-tyrosine phosphatase PTP-PEST (Lu et al., 2006b). Additionally, MST3 contributes to cell polarity by regulating Cdc42 activity and actin cytoskeleton organization. MDCK cells with inactive MST3 kinase form multi-lumen cysts instead of single-lumen cysts in 3D culture (Chan et al., 2023). In vivo, we found MST3 localized on renal tubule, regulating renal ion channels and maintaining stable blood pressure. MST3 knockout mice exhibit higher blood pressure (Lu et al., 2019; Chan et al., 2021). According to Iglesias et al., MST3 inhibits the insulin signaling pathway and is important in the development of insulin resistance and impaired blood glucose levels after a high-fat diet (Iglesias et al., 2017). These findings indicate that MST3 functions in apoptosis, cytoskeleton reorganization, cell polarity, osmotic and energy homeostasis, which are related to Hippo signaling-mediated functions. Therefore, we used MDCK kidney cells with stable overexpression of HA-MST3 and HA-MST3 kinase-dead (HA-MST3-KD) to investigate whether MST3-mediated Hippo signaling pathway induces fibrosis.

MATERIALS AND METHODS

Stable clones and cell culture

NIH/3T3 and MDCK cells were obtained from the Bioresource Collection and Research Center (BCRC, Hsinchu, Taiwan) and maintained in DMEM containing 10% FBS and antibiotics at 37°C with 5% CO2 in a humidified incubator. The stably overexpressing HA-MST3 and HA-MST3-KD cells have been established as our previous report (Chan et al., 2023). Briefly, HA-MST3 or HA-MST3-K53R (HA-MST3-KD) plasmids were transfected into MDCK cells using LF2000 and selected with G418 to obtain stably overexpressing HA-MST3 and HA-MST3-KD cells.

Cell proliferation assay

Cell proliferation was determined by using the Cell Titer 96 aqueous one-solution cell proliferation kit (Promega, Madison, WI, USA). Approximately 1*104 cells of control, HA-MST3 and HA-MST3-KD were seeded in 96-well plate and cultured for 24, 48, 72, and 96 h or with 1 mM metformin treatment. At 24, 48, 72, and 96 h, cells were replaced with 100 μL medium containing 20 μL MTS and then incubated at 37°C for 1 h. Absorbance was measured at 490 nm with a Spectra Max M2 microplate reader (Molecular Devices, Menlo Park, Calif, CA, USA). The absorbance values of the cells at 24 h were used as the baseline and set to 1. Therefore, the fold of cell growth was calculated by the ratio of absorbance at 24, 48, 72, and 96 h to the absorbance at 24 h.

Phos-tag gel and western blot

3×105 cells in 6 well plate were lysed with lysis buffer (50 mM Tris, pH 7.4, 150 mM NaCl and 1% Triton X-100). 50 μg cell lysates were incubated with 0.1 μg of recombinant protein phosphatase 2A C subunit (Cayman, MI, USA) at 30°C for 30 min. The supernatants with 3X sample buffer (130 mM Tris, pH 6.8, 4% SDS, 10% 2-ME, 20% glycerol and 0.04% bromophenol blue) were denatured by heating at 95°C for 5 min. The same amounts of protein were run on 8% separating SDS/PAGE gels or gel containing 50 μM Phos-tag and 100 μM MnCl2. After proteins separated, the proteins in gel were transferred to nitrocellulose membranes. Membranes were incubated with primary antibodies, including YAP (ab205270, Abcam, MA, USA), phosphor-YAP S127 (# 4911, Cell Signaling Technology, MA, USA), TGF-β (21898-1-AP, Proteintech, IL, USA), phospho-AMPK (phospho T183+T172, GTX130429, GeneTex, CA, USA), vinculin antibody (26520-1-AP, Proteintech) and HA (3F10, Roche Diagnostics GmbH, Mannheim, Germany), and secondary antibodies. The MST3 antibody against MST3, a kind gift from Dr. Ming-Derg Lai, was validated in our previous publications (Lu et al., 2006a, 2019). Bands were detected by Western Lightning Plus (Perkin Elmer, MA, USA) using LAS2000. Representative images were uniformly processed in Adobe Photoshop (CA, USA).

RNA-seq

The total RNA of MDCK cell was extracted using Trizol® Reagent, RNA-seq libraries were prepared using SureSelect XT HS2 mRNA Library Preparation kit (Agilent, CA, USA) followed by AMPure XP beads (Beckman Coulter, IN, USA) size selection. Briefly, poly(A)+ RNA samples were fragmented and then used for first- and second-strand cDNA synthesis with random hexamer primers. The cDNA fragments were treated with DNA End Repair Kit to repair the ends, then add an A at the 3’end of the DNA fragments, and finally ligated to adapters. Purified dsDNA was subjected to 10 cycles of PCR amplification, and the libraries were sequenced by Illumina sequencing platform on a 150 bp paired-end run. Sequencing reads from RNA-seq data were aligned using the spliced read aligner HISAT2, which was supplied with the Dog (CanFam3.1) as the reference genome. Gene expression levels were calculated by TPM (transcript per million). Annotations of mRNA in the Dog genome were retrieved from the Ensembl database. The differentially expressed genes between each group were analyzed using DEseq2 (DEseq2 v1.28.1). The significant candidates were extracted with Fold Change >=2 or <0.5 and p-value <0.05.

qPCR analysis

Total RNA was extracted from the cells using the QIAgen RNeasy Mini Kit. RNA (1 μg) was analyzed via RT-PCR using the QuantiTect® Reverse Transcription Kit (QIAgen, MD, USA). The cDNA products served as templates for the qRT-PCR assays using intercalation of SYBR Green as a fluorescence reporter. The quantitative PCR data analysis was performed using the 2-△△Ct method, and the data were normalized to the mean of GAPDH. The primer sequences used for GAPDH were as follows: The primer sequences used for qPCR were as follows: CTGF forward: 5’GCTGACCTGGAA GAGAACATT A3’, reverse: 5’ CTTGGCGATTTTGGGGGT A3’, and GAPDH forward: 5’AAGAGGGTCATCATCTCTGCT C3’, reverse: 5’ GGCATTGCTGACAATCTTGA 3’. The primer sequences used for qPCR were as follows: TGF-β forward: 5’TACCACGCTAACTTCTGCCT3’, reverse: 5’TCCAGGCTCCAAATGTAGGG3’

Immunofluorescence Staining and Confocal Microscopy

1×104 cells were seeded on 24 well transwell for 24, 72 and 96 h. The cell grew to reach confluence over 4 days, permitting them to fully polarize. When cells grew to confluent at 72 h, metformin or verteporfin were added for 24 h. The cells were washed with PBS and then fixed with 4% PFA at room temperature for 10 min. The cells were permeabilized with PBS/1% BSA/0.1% Triton X-100 for 30 min. The cells were incubated with primary antibodies for 1 h or overnight, followed by FITC- or TRITC-conjugated secondary antibodies for 1 h. The cells were mounted to slides with gevetol medium and visualized using a Dragonfly High Speed Confocal Microscope System (Oxford Instruments, MA, USA) equipped with a FLUOTAR objective (63X, 0.95 NA, Oil) and an EMCCD camera (iXon Ultra 888). Images were acquired using Imaris software. Representative images were uniformly processed in Adobe Photoshop using the brightness and contrast tools.

Conditioned medium Collection and NIH/3T3 cell fibrosis

3×106 MDCK (control), HA-MST3, and HA-MST3-KD cells were seeded in 10 for 72 h, followed by treatment with or without metformin for 24 h. The medium was then collected and centrifuged at 1000 rpm for 5 min. The supernatant was transferred to a Macrosep 3K filter and centrifuged at 5000 g for 30 min to obtain the concentrated conditioned medium. The CTGF in conditioned medium were analyzed by western blot. The 1.5×104 of NIH/3T3 cells were seeded in 12 well and cultured for 24 h. The cells were changed to medium containing 2% FBS medium with 10 ng/mL TGF-β or 2% concentrated conditioned medium collected from control, HA-MST3 and HA-MST3-KD cells for 24 h. After 48 h, cells were rinsed with PBS and fixed and stained to detect α-SMA (green) and vinculin (red).

miRNA Expression Data Analysis

Publicly available human kidney miRNA expression data were obtained from the Gene Expression Omnibus (GEO) database (accession number GSE51674), which includes kidney biopsy samples from patients with diabetic nephropathy (DN, n=6), type 2 diabetes-associated membranous nephropathy (T2D-MN, n=6), and normal controls (NK, n=4). Processed and normalized expression values were directly downloaded from the GEO database. Four miRNAs, including miR-128-3p, miR-139-5p, miR-222-3p, and miR-455-3p were selected for analysis based on their predicted or validated targeting of STK24 (MST3) from TargetScanHuman databases. For visualization and statistical comparison, data were reshaped to long format using R, and plotted using the ggplot2 package. Statistical tests were chosen based on data distribution and experimental context. For miRNA expression data from GSE51674, non-parametric Wilcoxon rank-sum tests were used. For cell-based experiments, comparisons between groups were made using Student’s t-test. p<0.05 was considered statistically significant.

RESULTS

HA-tagged MST3 and kinase dead (KD) MST3 were stably overexpressed in MDCK cells and HA antibodies were used to detect the expression of HA-MST3 and HA-MST3-KD as our previous report (Chan et al., 2023). The HA antibody could not detect any bands in parental MDCK cells (control) in SDS/PAGE. Due to MST3 autophosphorylation, the HA-MST3 apparently migrated slower than HA-MST3-KD in SDS/PAGE (Fig. 1A, HA panel). The MST3 antibody detected endogenous MST3 in all control, HA-MST3 and HA-MST3-KD cells; it also detected exogenous HA-MST3 by its slower migration in HA-MST3 cells. Because the loss of phosphorylation in HA-MST3-KD led to faster migration, resulting in HA-MST3-KD could not be separated from endogenous MST3. Therefore, the MST3 antibody detected only a single thicker band in HA-MST3-KD cells (Fig. 1A, MST3 panel). We used phos-tag gel (Kinoshita et al., 2009) to further confirm the phosphorylation of HA-MST3 and HA-MST3-KD. The phos-tag gel of Fig. 1A showed that HA-MST3 exhibited multiple bands with much slower mobility (Fig. 1A, arrow, HA phos-tag panel) than HA-MST3-KD. PP2A, a serine/threonine phosphatase, induced slightly dephosphorylation in both HA-MST3 and HA-MST3 KD. These results indicated that we successfully established MDCK cells overexpressing HA-MST3 and HA-MST3-KD and HA-MST3 activities could be examined by phos-tag gel.

Fig. 1.

Fig. 1

Open in a new tab

MST3 overexpression inhibited YAP nuclear localization. (A) Stable expression of HA-MST3 and HA-MST3-KD in MDCK cells. MDCK (control), HA-MST3 and HA-MST3-KD cells were lysed with lysis buffer. The cell lysates were treated with or without PP2A. Subsequently, equal amount of cell lysates were analyzed by phos-tag gel or normal SDS/PAGE and immunoblot with anti-HA, MST3 and actin antibodies. (B) The cells were seeded into 96 well and the cell viability was determined using MTS assay after 1 to 4 days. **p<0.01 and ***p<0.005 compared to the control group. (C) The cells were seeded on 24 well transwell for 24, 72 and 96 h. Representative images of control, HA-MST3 and HA-MST3 KD cells were fixed and stained to detect nuclei (blue) and YAP (green). Bar, 30 μm. (D) Quantification of YAP nuclear staining. Cells displaying nuclear YAP staining (N), both nuclear and cytoplasmic YAP staining (N+C) and cytoplasmic YAP staining (C) were counted. Ratio of nuclear YAP to total cells is plotted. The mean ± SD of >1000 cells from each experiment is shown, for three independent experiments. (E) The cells were seeded on 6 well plates for 24, 72 and 96 h. Equal amount of protein were immunoblotted with indicated antibodies by using phos-tag gel or normal SDS/PAGE.

YAP is nuclear and active at low cell density, but to prevent cell overgrowth, it is phosphorylated and translocated to the cytoplasm to inhibit cell growth at high cell density (McClatchey and Yap, 2012). We compared the growth rates of control, HA-MST3, and HA-MST3 KD cells. After 24 h, all three cell lines reached about 40% confluency. By 96 h, control cells grew 2.53 times, HA-MST3 cells grew 1.60 times, and HA-MST3 KD cells grew 2.91 times. These results show that HA-MST3 cells grew the slowest, while HA-MST3 KD cells grew the fastest (Fig. 1B).

Next, we examined whether MST3-regulated YAP nuclear localization control cell density. When control cells are in a low-density state after 24 h of seeding, approximately 97% of YAP were located in the cell nucleus (Fig. 1C, 24 h and Fig. 1D control, 24 h black bar). After continuing incubation for 72 h, about 36% of YAP were located in both the nucleus and cytoplasm (Fig. 1C, 72 h and Fig. 1D control, 72 h grey bar). Since contact inhibition, after 96 h of incubation, more YAP, approximately 50%, were located in both the nucleus and cytoplasm (Fig. 1C, 96 h and Fig. 1D control, 96 h grey bar). HA-MST3 cells at low density after 24 h of seeding, almost all YAP were located in the cell nucleus. After 72 h of incubation, 47% were located in the cytoplasm, and another 18% are located in both the nucleus and cytoplasm. After 96 h of incubation, when the cells became denser, only 26% of YAP remains in the nuclei, indicating that MST3 promoted more YAP to cytoplasm. HA-MST3-KD cells, at low density, showed that 99% of YAP were located in the cell nucleus, similar to the other two cell lines. However, after 72 h, 94% of YAP still remained in the cell nucleus. When cultured for 96 h, even with very high cell density (Fig. 1C, HA-MST3-KD, 96 h), 95% of YAP still remained in the cell nucleus (Fig. 1D HA-MST3-KD, 96 h black bar). Notably, at 24 h, the nuclear size of the three cell lines was consistent. However, after 96 h of culture, the nuclei in HA-MST3-KD cells appeared smaller due to the higher cell density compared to the other two cell lines, suggesting that HA-MST3-KD cells have lost their contact inhibition and continue to grow to very high density. This also explains the growth rate (Fig. 1B), where HA-MST3-KD cells continue to grow even after 96 h of incubation.

MST1/2-mediated phosphorylation of YAP including serine 127 (S127) is necessary for its exclusion from the nucleus and sequestration in the cytoplasm (Zhao et al., 2007). We also investigated whether MST3 phosphorylates YAP by using an antibody that recognizes YAP S127 phosphorylation (p-YAP S127) and a phos-tag gel. We found that p-YAP S127 was higher in HA-MST3 cells compared to control and HA-MST3-KD cells after 24, 72, and 96 h of seeding (Fig. 1E, SDS/PAGE). With increased incubation time, phosphorylated YAP detected by phos-tag gel increased in all groups. However, after 72 and 96 h, HA-MST3 cells showed significantly higher phosphorylation than controls and HA-MST3 KD cells (Fig. 1E, phos-tag, YAP). MST3 activities were also increased after culture for 96 h (Fig. 1E, phos-tag, HA). These results indicated that when cells reached to high density, MST3 was activated to phosphorylate YAP to prevent cell overgrowth, whereas MST3-KD fails to exhibit contact inhibition due to YAP dysregulation. Taken together, our results indicated that high-density cells activated MST3, leading to YAP phosphorylation and its localization in the cytoplasm, thereby inhibiting cell growth.

To explore MST3-mediated YAP function, RNA-seq gene expression analysis indicated significantly higher levels of fibrosis-related mRNAs, including alpha-actinin-1 (ACTN1), laminin subunit gamma-2 (LAMC2), fibronectin 1 (FN1), vinculin (VCL), and collagen (COL) in HA-MST3-KD cells compared to control and HA-MST3 cells (Fig. 2A). We used qPCR to evaluate mRNA levels of CTGF and TGF-β, we found that in high-density HA-MST3-KD cells, CTGF expression increased approximately 10-fold and TGF-β expression increased approximately 1.5-fold compared to control cells; in contrast, CTGF and TGF-β expression decreased in HA-MST3 cells compared to control cells (Fig. 2B, 2C). Immunoblotting using anti-TGF-β antibody demonstrated that HA-MST3-KD cells expressed elevated TGF-β levels in cell lysates (Fig. 2D).

Fig. 2.

Fig. 2

Open in a new tab

MST3-KD-mediated YAP activation increased CTGF and TGF-β expression. (A) Heatmap for mRNA levels of indicated genes in control, HA-MST3 and HA-MST3-KD cells. The mRNA levels of (B) CTGF and (C) TGF-β from control, HA-MST3 and HA-MST3 KD cells were measured by qRT-PCR. Means ± stdev was from each experiment with three independent experiments. Error bars represent stdev. *p<0.05 and ***p<0.005 compared to the control group. (D) The conditioned medium from confluent MDCK (control), HA-MST3 and HA-MST3 KD cells were subjected to SDS/PAGE to analyze TGF-β.

We further analyzed publicly available miRNA expression data (GSE51674) from kidney tissues of patients with diabetic nephropathy (DN), type 2 diabetes-associated membranous nephropathy (T2D-MN), and normal kidney (NK) controls (Conserva et al., 2019). Several human miRNAs predicted by TargetScan Human or validated to target MST3, including miR-455-5p, miR-128-3p, miR-222-3p, and miR-139-5p, were found to be significantly upregulated in both DN and T2D-MN groups compared to NK controls (Fig. 3A). Among these, miR-222-3p, has previously shown to downregulate MST3 expression, promoting colorectal cancer cell migration and invasion (Luo et al., 2019). These findings suggest the potential involvement of these miRNAs in MST3-mediated renal pathogenesis. To induce NIH/3T3 cell fibrosis, cells were switched to low-serum media (2% FBS) and treated with TGF-β1 for 24 h (Lee et al., 2020). In control cells, α-SMA fibers with vinculin at their ends, referred to as α-SMA-positive cells (Fig. 3B), are clearly shown in an enlarged image in Fig. 3C. These α-SMA-positive cells account for 40% of the total cell population (Fig. 3D). TGF-β1 treatment significantly increased the number of α-SMA-positive cells to about 60% (Fig. 3B, b and b’ vs. a and a’ and Fig. 3D), which was clearly visible in the enlarged image (Fig. 3C, b and b’). TGF-β1 treatment also resulted in larger cell areas (Fig. 3E). The conditioned medium from HA-MST3-KD cells induced approximately 60% of α-SMA-positive NIH/3T3 cells (Fig. 3B, 3C, e and e’; Fig. 3D), compared to 40% in NIH/3T3 cells treated with the control and HA-MST3 conditioned medium (Fig. 3B, 3C, e and e’; Fig. 3D). Additionally, the conditioned medium from HA-MST3-KD cells significantly increased the cell area of NIH/3T3 cells (Fig. 3E). These results indicate that the loss of MST3 activity in epithelial cells can induce NIH/3T3 cell fibrosis.

Fig. 3.

Fig. 3

Open in a new tab

The increased CTGF and TGF-β from MST3-KD cells stimulates NIH/3T3 cell fibrosis. (A) Violin plots show the expression levels of miR-128-3p, miR-139-5p, miR-222-3p, and miR-455-3p in 4 normal kidney (NK), 6 diabetic nephropathy (DN), and 6 membranous nephropathy (MN) tissues. These miRNAs are predicted or validated to target and downregulate MST3. Expression data were obtained from the publicly available GSE51674 dataset. Statistical analysis was performed using the Wilcoxon rank-sum test. Asterisks indicate statistically significant differences (*p<0.05, **p<0.01). The NIH/3T3 cells were seed on coverslips in 60 mm dish for 24 h and changed to medium containing 2% FBS (control) or additional 10 ng/mL TGF-β. The conditioned medium collected from control, HA-MST3 and HA-MST3-KD cells were also added to NIH/3T3 cells with 2% FBS for 24 h. The NIH/3T3 cells (B) were fixed and stained to detect α-SMA (green) and vinculin (red) and enlarged image from white boxes were shown in (C) Bar, 50 μm. The (D) α-SMA positive cells and (E) area of NIH/3T3 cells were analyzed. Means± stdev was from each experiment with three independent experiments. Error bars represent stdev. *p<0.05 compared to the control group.

Since verteporfin disrupts the interaction between YAP and TEAD, resulting in YAP retention in the cytosol (Brodowska et al., 2014), we examined whether YAP could be trapped in cytosol by verteporfin in HA-MST3-KD cells. Fig. 4A and 4B showed that 1 μM verteporfin could not translocate YAP from nucleus to cytoplasm in HA-MST3-KD cells. We also examined the phosphorylation status of YAP after verteporfin treatment. Fig. 4C showed that verteporfin could not induce YAP phosphorylation in HA-MST3 and HA-MST3-KD cells. These results indicated that MST3-KD-induced YAP nuclear localization could not be trapped in cytosol by verteporfin.

Fig. 4.

Fig. 4

Open in a new tab

MST3-KD-mediated YAP nuclear localization was not affected by verteporfin. (A) The cells were seeded on 24 well transwell for 72 h following treatment with 1 μM verteporfin for 24 h. Representative images of control, HA-MST3 and HA-MST3 KD cells were fixed and stained to detect nuclei (blue) and YAP (green). Bar, 30 μm. (B) Quantification of YAP nuclear staining. Cells displaying nuclear YAP staining with or without verteporfin treatment were counted. Ratio of nuclear YAP to total cells is plotted. The mean ± SD of >1000 cells from each experiment is shown, for three independent experiments. (C) The cells were lysed and equal amount of protein were immunoblotted with indicated antibodies.

Energy stress, such as glucose starvation or metformin treatment, has been shown to inhibit YAP activity through AMPK-mediated phosphorylation (DeRan et al., 2014; Mo et al., 2015; Wang et al., 2015). Liu et al. previously identified MST3 as a novel kinase capable of directly phosphorylating and activating AMPK using recombinant proteins purified from E. coli (Liu et al., 2022). As shown in Fig. 1E, HA-MST3-KD cells failed to activate AMPK after 24 to 48 h of culture. We next investigated whether metformin-mediated AMPK activation could compensate for the loss of MST3 function. Metformin treatment promoted YAP cytoplasmic translocation in control and HA-MST3 cells, and notably in HA-MST3-KD cells. The nuclear localization of YAP in HA-MST3-KD cells decreased from ~100% to ~20% (Fig. 5A, 5B). Furthermore, we observed increased phosphorylation of AMPK and YAP in HA-MST3 cells, and this phosphorylation was also induced by metformin in all cell types (Fig. 5C). To determine whether metformin-induced AMPK activation was mediated through MST3 activation, we examined whether metformin treatment or glucose deprivation could activate MST3. However, as shown in Fig. 5D, neither metformin nor glucose deprivation caused a detectable phosphorylation shift of MST3 on Phos-tag gels, indicating that MST3 is not activated under these conditions. These results suggest that metformin does not promote YAP phosphorylation by activating MST3. Instead, metformin activates AMPK directly, thereby compensating for the impaired AMPK activation caused by MST3 deficiency in HA-MST3-KD cells.

Fig. 5.

Fig. 5

Open in a new tab

MST3-KD-mediated YAP nuclear localization was inhibited by metformin. The cells were seeded on 24 well transwell for 72 h following treatment with 1 mM metformin for 24 h (A). Representative images of control, HA-MST3 and HA-MST3 KD cells were fixed and stained to detect nuclei (blue) and YAP (green). Bar, 50 μm. (B) Quantification of YAP nuclear staining. Cells displaying nuclear YAP staining with or without metformin were counted. Ratio of nuclear YAP to total cells is plotted. The mean ± SD of >1000 cells from each experiment is shown, for three independent experiments. (C) Cells were first cultured for 24 h, then treated with 1 mM metformin for an additional 24 h. (D) Cells were first cultured for 24 h, then treated with glucose-free or 1 mM metformin for another 24 h. After treatment, cells were lysed and equal amounts of protein were subjected to immunoblotting with the indicated antibodies.

We next investigated whether metformin could alleviate fibrosis induced by HA-MST3-KD in NIH/3T3 cells. Fig. 6A shows that 1 mM metformin inhibited the proliferation of control, HA-MST3, and HA-MST3-KD cells at 72 and 96 h. Notably, the medium of HA-MST3 cells turned very yellow, suggesting a significant decrease in pH, which implies increased acidity (data not shown). We suspected that this could be due to a combined effect of MST3-induced AMPK activation and metformin-induced AMPK activation. However, this result needs further investigated. The metformin inhibited CTGF and TGF-β expression in HA-MST3-KD cells (Fig. 6B, 6C). The conditioned medium of HA-MST3-KD cells decreased a-SMA positive cells and cell area of NIH/3T3 cells (Fig. 6D-6F). These results indicated that HA-MST3-KD with metformin treatment attenuated cell proliferation and NIH/3T3 cell fibrosis.

Fig. 6.

Fig. 6

Open in a new tab

MST3-KD-mediated cell proliferation and fibrosis was inhibited by metformin. (A) The cells were seeded into 96 well without or with 1 mM metformin treatment for 24, 48 and 72 h. The cell viability was determined using MTS assay. The mRNA levels of (B) CTGF and (C) TGF-β in control, HA-MST3 and HA-MST3 KD cells with or without metformin treatment were measured by qRT-PCR. Means ± stdev was from each experiment with three independent experiments. Error bars represent stdev. *p<0.05 and ***p<0.005 compared to the control group. (D) The conditioned medium collected from control, HA-MST3 and HA-MST3-KD cells with metformin treatment were added to NIH/3T3 cells with 2% FBS for 24 h. The NIH/3T3 cells were fixed and stained to detect α-SMA (green) and vinculin (red) Bar, 50 μm. The α-SMA positive cells (E) and area (F) of NIH/3T3 cells were analyzed. Means± stdev was from each experiment with three independent experiments. Error bars represent stdev. *p<0.05 compared to the control group.

DISCUSSION

The Hippo signaling pathway is a central growth control mechanism in multicellular organisms through regulation of cell proliferation, differentiation, apoptosis, and tissue regeneration. Consequently, dysregulation of the Hippo pathway can lead to a range of diseases, including cancer and fibrosis (Fu et al., 2022). In mammals, the molecular compositions and biological functions of the Hippo pathway are largely conserved and regulated by multiple upstream signals, including biophysical, biochemical and energy stress cues. Among the mammalian sterile20-like serine/threonine kinase (STK) family, MST1 (STK4) and MST2 (STK3) kinases are the well-known master kinases that regulate Hippo-YAP axis. MST1/2 knockout mice exhibit liver hepatocyte proliferation and cancer (Zhou et al., 2009; Lu et al., 2010; Song et al., 2010), intestinal dysplasia and adenomas (Zhou et al., 2011), enlarged heart ventricles with thickened walls (Heallen et al., 2011) and kidney fibrosis (Xu et al., 2020). MST4, another STK kinase, suppresses gastric tumorigenesis by limiting YAP activation via a non-canonical pathway (An et al., 2020). However, MST3 function in Hippo-YAP pathway is not understood. Our study elucidates that MST3 was involved in cell contact inhibition. When cells reached to high density, MST3-induced YAP phosphorylation drove YAP from nucleus to cytoplasm which was dependent on AMPK activation. In contrast, MST3-KD failed to induce AMPK activation, leading to impaired YAP phosphorylation and YAP remaining in the nuclei. YAP in the nucleus drove the expression of downstream CTGF. Metformin-induced AMPK activation can rescue YAP phosphorylation. This metformin-rescued YAP phosphorylation alleviates MST3-KD-induced cell proliferation and fibrosis (Fig. 7).

Fig. 7.

Fig. 7

Open in a new tab

The proposed model for MST3 targeting of AMPK (AMP-activated protein kinase) and YAP (Yes-associated protein) in the Hippo signaling pathway to attenuate fibrotic functions. When cells reach high density, MST3-induced YAP phosphorylation promotes its translocation from the nucleus to the cytoplasm, a process partially dependent on AMPK activation. Dashed arrows indicate a possible but unconfirmed direct link. In contrast, MST3-KD fails to activate AMPK, leading to impaired YAP phosphorylation and its retention in the nucleus. Nuclear YAP interacts with TEAD (transcriptional enhanced associate domain) to promote the expression of CTGF (connective tissue growth factor), which in turn stimulates TGF-β (transforming growth factor beta) release from tubular epithelial cells, contributing to MST3-KD-induced cell proliferation and fibrosis. Metformin-induced AMPK activation rescues YAP phosphorylation, thereby alleviating MST3-KD-induced cell proliferation and fibrosis.

The outcomes of MST3-mediated Hippo-YAP signaling are still unclear. Here, we found that after 96 h of cell culture reaching a very high density, due to contact inhibition, more YAP was localized in the cytoplasm in HA-MST3 cells compared to the control cells. In contrast, even at very high cell density after 96 h culture, YAP remained localized in the nucleus in HA-MST3-KD cells (Fig. 1C, 1D), indicating that the loss of MST3 activity fails to exhibit contact inhibition through the loss of inhibition of YAP activation. The MST3-KD-induced YAP activation increased CTGF secretion, leading to NIH/3T3 cell fibrosis (Fig. 3). Our previous research demonstrated that downregulation of MST3 enhanced cell migration with decreased paxillin phosphorylation on residue 118 in MCF7 breast cancer cells (Lu et al., 2006b). Furthermore, we found that MDCK cells with MST3-KD overexpression formed multi-lumen cyst in matri-gel, which was involved cell polarity through cdc42-mediated tight junction (Chan et al., 2023). Taken together, these results indicated that MST3-mediated cell growth, cell migration, cell polarity and fibrosis are linked to Hippo-YAP pathway.

The kidney consists of functionally discrete segments, where injured tubular epithelial cells, unable to re-differentiate after repeated insults, release cytokines, growth factors, CTGF and TGF-β, driving inflammation, myofibroblast activation, and matrix secretion, leading to the development of fibrosis (Frangogiannis, 2020). In patients with kidney fibrosis, increased levels of TGF-β1 and CTGF in urine can serve as indicators of renal fibrosis in individuals with progressive renal diseases (Gilbert et al., 2003; Li et al., 2022). Additionally, CTGF mRNA levels are increased in visceral and parietal epithelial cells of patients with kidney fibrosis (Ito et al., 1998). These results indicate that kidney epithelial cells secrete CTGF and TGF-β, which induce tissue fibrosis, and are associated with the pathogenesis of fibrosis (Frangogiannis, 2020). In MST1/2 double knockout (dKO) mice, YAP was localized in the nuclei of tubular cells in the kidneys and the phospho-YAP levels were decreased in the kidneys. Thickening of tubular basement membrane was apparently observed in MST1/2 dKO kidneys in older kidneys. The amplified activities of TNF-α and YAP in the tubules of kidneys induce kidney fibrosis (Xu et al., 2020). Our previous research demonstrated that MST3 is localized in renal tubules, and MST3 knockout mice exhibit high blood pressure at 3 months of age due to dysregulation of ENaC and NKCC channels (Lu et al., 2018, 2019; Chan et al., 2021). Since there is no significant renal fibrosis observed in 3-month-old mice, we believed that the development of renal fibrosis in MST3 knockout mice needs to be examined in older mice. Here, we investigated whether MST3-mediated Hippo-YAP pathway was involved in kidney fibrosis. We used epithelial cells, MDCK cells, with stable overexpression of MST3 and MST3-KD to examine NIH/3T3 cell fibroblast in vitro. We found that MDCK cells with HA-MST3-KD expression had approximate ten times of CTGF and 1.5 times of TGF-β expression than control cells (Fig. 2A, 2B), which induced NIH/3T3 cell fibrosis (Fig. 3).

A reduction in AMPK activity has been linked to renal fibrosis in various chronic kidney disease (CKD) models (Borges et al., 2020), as it is associated with triglyceride and glycogen accumulation, leading to renal hypertrophy in diabetic kidneys (Lee et al., 2007; Kim and Park, 2016). Metformin, a first-line treatment for type 2 diabetes, increases renal AMPK phosphorylation, inhibits renal hypertrophy by reversing mTOR activation, and alleviates renal tubulointerstitial fibrosis (Lee et al., 2007). Studies have shown that metformin reduces kidney fibrosis in experimental CKD models (Borges et al., 2020). In addition to AMPK regulation, increased YAP expression and activation of YAP were observed in renal proximal tubule cells in patients with diabetes and in mouse kidneys (Ma et al., 2019). Given the link between kidney fibrosis with YAP and AMPK, targeting the YAP phosphorylation through metformin-induced AMPK activation may be expected to be a promising strategy for preventing fibrosis. MST3 have also been reported to be involved in glucose homeostasis. The MST3 mediates impaired fasting blood glucose after a high-fat diet (Iglesias et al., 2017). Here, we further found that MST3-induced Hippo-YAP pathway was partially dependent on AMPK activation. Kinase dead MST3 attenuated AMPK activation, leading to YAP nuclear localization. Metformin instead of verteporfin-induced AMPK activation promoted YAP to cytoplasm in HA-MST3-KD cells (Fig. 4A, 5A). HA-MST3-KD cells showed increased CTGF expression, leading to excessive cell growth (Fig. 1B) and inducing fibrosis in NIH/3T3 cells (Fig. 3). Metformin-treated HA-MST3-KD cells increased AMPK activation, leading to Hippo-YAP inactivation and reduced cell proliferation and fibrosis (Fig. 6). Metformin may be exhibit protective effect with MST3 inactivation via AMPK-induced YAP phosphorylation.

Despite the potential benefits observed in animal studies, the clinical use of metformin is not recommended in patients with severe kidney dysfunction and absolutely contraindicated in those with an estimated glomerular filtration rate (eGFR) <30 ml/min/1.73 m2 because of the risk of lactic acidosis (Kim et al., 2021). Notedly, we found that medium became yellow in HA-MST3 cells with 1 mM metformin treatment and the cells were dead with 5 mM metformin treatment (data not shown). This might be due to the synergistic activation of AMPK through MST3 and metformin, indicating that patients with overactive MST3 might not benefit from metformin. Our results provided a therapy strategy for metformin in prevention kidney fibrosis.

ACKNOWLEDGMENTS

Author Chee-Hong Chan has received research grants from Chang Bing Show-Chwan Memorial Hospital (BRD111057). Author Te-Ling Lu has received research grants from China Medical University (CMU112-S-29) and National Science Council, Taiwan (MOST-109-2320-B-039-017). Author Wen-Yih Jeng has received research grants from National Science Council, Taiwan (NSTC-112-2311-B-006 -005) and (NSTC-113-2311-B-006 -010 -MY3).

Footnotes

CONFLICT OF INTEREST

The authors declare no conflict of interest.

AUTHOR CONTRIBUTIONS

Y.-K. Chen and S.-L. Syu carried out the experiment. C.-H. Chan and T.-J. Lu wrote the manuscript with support from T.L. Lu and W.-Y. Jeng. B.-Y. Bao performed the analytic calculations and helped supervise the project. T.-L. Lu, W.-Y. Jeng and T.-J. Lu conceived the original idea and supervised the project.

REFERENCES

  1. An L., Nie P., Chen M., Tang Y., Zhang H., Guan J., Cao Z., Hou C., Wang W., Zhao Y., Xu H., Jiao S., Zhou Z. MST4 kinase suppresses gastric tumorigenesis by limiting YAP activation via a non-canonical pathway. J. Exp. Med. 2020;217:e20191817. doi: 10.1084/jem.20191817. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Borges C. M., Fujihara C. K., Malheiros D. M. A. C., de Ávila V. F., Formigari G. P., Lopes, de Faria J. B. Metformin arrests the progression of established kidney disease in the subtotal nephrectomy model of chronic kidney disease. Am. J. Physiol. Renal Physiol. 2020;318:F1229–F1236. doi: 10.1152/ajprenal.00539.2019. [DOI] [PubMed] [Google Scholar]
  3. Bradham D. M., Igarashi A., Potter R. L., Grotendorst G. R. Connective tissue growth factor: a cysteine-rich mitogen secreted by human vascular endothelial cells is related to the SRC-induced immediate early gene product CEF-10. J. Cell Biol. 1991;114:1285–1294. doi: 10.1083/jcb.114.6.1285. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Brodowska K., Al-Moujahed A., Marmalidou A., Meyer Zu Horste M., Cichy J., Miller J. W., Gragoudas E., Vavvas D. G. The clinically used photosensitizer Verteporfin (VP) inhibits YAP-TEAD and human retinoblastoma cell growth in vitro without light activation. Exp. Eye Res. 2014;124:67–73. doi: 10.1016/j.exer.2014.04.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chan C. H., Lin P., Yang T. Y., Bao B. Y., Jhong J. Y., Weng Y. P., Lee T. H., Cheng H. F., Lu T. L. Epithelial polarization in the 3D matrix requires MST3 signaling to regulate ZO-1 position. PLoS One. 2023;18:e0285217. doi: 10.1371/journal.pone.0285217. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chan C. H., Wu S. N., Bao B. Y., Li H. W., Lu T. L. MST3 involvement in Na(+) and K(+) homeostasis with increasing dietary potassium intake. Int. J. Mol. Sci. 2021;22:999. doi: 10.3390/ijms22030999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Chen J., Wang X., He Q., Bulus N., Fogo A. B., Zhang M. Z., Harris R. C. YAP activation in renal proximal tubule cells drives diabetic renal interstitial fibrogenesis. Diabetes. 2020;69:2446–2457. doi: 10.2337/db20-0579. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Chen J., You H., Li Y., Xu Y., He Q., Harris R. C. EGF receptor-dependent YAP activation is important for renal recovery from AKI. J. Am. Soc. Nephrol. 2018;29:2372–2385. doi: 10.1681/ASN.2017121272. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. DeRan M., Yang J., Shen C. H., Peters E. C., Fitamant J., Chan P., Hsieh M., Zhu S., Asara J. M., Zheng B., Bardeesy N., Liu J., Wu X. Energy stress regulates hippo-YAP signaling involving AMPK-mediated regulation of angiomotin-like 1 protein. Cell Rep. 2014;9:495–503. doi: 10.1016/j.celrep.2014.09.036. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Frangogiannis N. Transforming growth factor-β in tissue fibrosis. J. Exp. Med. 2020;217:e20190103. doi: 10.1084/jem.20190103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Fu M., Hu Y., Lan T., Guan K.-L., Luo T., Luo M. The Hippo signalling pathway and its implications in human health and diseases. Signal Transduct. Target. Ther. 2022;7:376. doi: 10.1038/s41392-022-01191-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Gilbert R. E., Akdeniz A., Weitz S., Usinger W. R., Molineaux C., Jones S. E., Langham R. G., Jerums G. Urinary connective tissue growth factor excretion in patients with type 1 diabetes and nephropathy. Diabetes Care. 2003;26:2632–2636. doi: 10.2337/diacare.26.9.2632. [DOI] [PubMed] [Google Scholar]
  13. Hao Y., Chun A., Cheung K., Rashidi B., Yang X. Tumor suppressor LATS1 Is a negative regulator of oncogene YAP. J. Biol. Chem. 2008;283:5496–5509. doi: 10.1074/jbc.M709037200. [DOI] [PubMed] [Google Scholar]
  14. Harvey K. F., Zhang X., Thomas D. M. The Hippo pathway and human cancer. Nat. Rev. Cancer. 2013;13:246–257. doi: 10.1038/nrc3458. [DOI] [PubMed] [Google Scholar]
  15. Heallen T., Zhang M., Wang J., Bonilla-Claudio M., Klysik E., Johnson R. L., Martin J. F. Hippo pathway inhibits Wnt signaling to restrain cardiomyocyte proliferation and heart size. Science. 2011;332:458–461. doi: 10.1126/science.1199010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Huang C. Y., Wu Y. M., Hsu C. Y., Lee W. S., Lai M. D., Lu T. J., Huang C. L., Leu T. H., Shih H. M., Fang H. I., Robinson D. R., Kung H. J., Yuan C. J. Caspase activation of mammalian sterile 20-like kinase 3 (Mst3). Nuclear translocation and induction of apoptosis. J. Biol. Chem. 2002;277:34367–34374. doi: 10.1074/jbc.M202468200. [DOI] [PubMed] [Google Scholar]
  17. Iglesias C., Floridia E., Sartages M., Porteiro B., Fraile M., Guerrero A., Santos D., Cuñarro J., Tovar S., Nogueiras R., Pombo C. M., Zalvide J. The MST3/STK24 kinase mediates impaired fasting blood glucose after a high-fat diet. Diabetologia. 2017;60:2453–2462. doi: 10.1007/s00125-017-4433-x. [DOI] [PubMed] [Google Scholar]
  18. Ito Y., Aten J., Bende R. J., Oemar B. S., Rabelink T. J., Weening J. J., Goldschmeding R. Expression of connective tissue growth factor in human renal fibrosis. Kidney Int. 1998;53:853–861. doi: 10.1111/j.1523-1755.1998.00820.x. [DOI] [PubMed] [Google Scholar]
  19. Kim H., Yu M. R., Lee H., Kwon S. H., Jeon J. S., Han D. C., Noh H. Metformin inhibits chronic kidney disease-induced DNA damage and senescence of mesenchymal stem cells. Aging Cell. 2021;20:e13317. doi: 10.1111/acel.13317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Kim Y., Park C. W. Adenosine monophosphate-activated protein kinase in diabetic nephropathy. Kidney Res. Clin. Prac. 2016;35:69–77. doi: 10.1016/j.krcp.2016.02.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Kinoshita E., Kinoshita-Kikuta E., Koike T. Separation and detection of large phosphoproteins using Phos-tag SDS-PAGE. Nat. Protoc. 2009;4:1513–1521. doi: 10.1038/nprot.2009.154. [DOI] [PubMed] [Google Scholar]
  22. Lee M. J., Feliers D., Mariappan M. M., Sataranatarajan K., Mahimainathan L., Musi N., Foretz M., Viollet B., Weinberg J. M., Choudhury G. G., Kasinath B. S. A role for AMP-activated protein kinase in diabetes-induced renal hypertrophy. Am. J. Physiol. Renal Physiol. 2007;292:F617–F627. doi: 10.1152/ajprenal.00278.2006. [DOI] [PubMed] [Google Scholar]
  23. Lee Y., Kim H., Hong N., Ahn J.-C., Kang H. W. Combined treatment of low-level laser therapy and phloroglucinol for inhibition of fibrosis. Lasers Surg. Med. 2020;52:276–285. doi: 10.1002/lsm.23131. [DOI] [PubMed] [Google Scholar]
  24. Li Y., Jiang S., Gao H., Yang Y., Liu X., Li W. Factors associated with the progression of mesangial lesions in IgA nephropathy: a comparative analysis of renal re-biopsies. Front. Endocrinol. (Lausanne) 2022;13:1004289. doi: 10.3389/fendo.2022.1004289. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Liu Y., Wang T. V., Cui Y., Gao S., Rao Y. Biochemical purification uncovers mammalian sterile 3 (MST3) as a new protein kinase for multifunctional protein kinases AMPK and SIK3. J. Biol. Chem. 2022;298:101929. doi: 10.1016/j.jbc.2022.101929. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Lu L., Li Y., Kim S. M., Bossuyt W., Liu P., Qiu Q., Wang Y., Halder G., Finegold M. J., Lee J. S., Johnson R. L. Hippo signaling is a potent in vivo growth and tumor suppressor pathway in the mammalian liver. Proc. Natl. Acad. Sci. U. S. A. 2010;107:1437–1442. doi: 10.1073/pnas.0911427107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Lu T.-J., Lai W.-Y., Huang C.-Y. F., Hsieh W.-J., Yu J.-S., Hsieh Y.-J., Chang W.-T., Leu T.-H., Chang W.-C., Chuang W.-J., Tang M.-J., Chen T.-Y., Lu T.-L., Lai M.-D. Inhibition of cell migration by autophosphorylated mammalian sterile 20-like kinase 3 (MST3) involves paxillin and protein-tyrosine phosphatase-PEST. J. Biol. Chem. 2006a;281:38405–38417. doi: 10.1074/jbc.M605035200. [DOI] [PubMed] [Google Scholar]
  28. Lu T. J., Chan C. H., Ling P., Chao Y. M., Bao B. Y., Chiang C. Y., Lee T. H., Weng Y. P., Kan W. C., Lu T. L. MST3 (mammalian Ste20-like protein kinase 3), a novel gene involved in ion homeostasis and renal regulation of blood pressure in spontaneous hypertensive rats. Int. Urol. Nephrol. 2018;50:2299–2307. doi: 10.1007/s11255-018-2011-x. [DOI] [PubMed] [Google Scholar]
  29. Lu T. J., Kan W. C., Yang S. S., Jiang S. T., Wu S. N., Ling P., Bao B. Y., Lin C. Y., Yang Z. Y., Weng Y. P., Chan C. H., Lu T. L. MST3 is involved in ENaC-mediated hypertension. Am. J. Physiol. Renal Physiol. 2019;317:F30–F42. doi: 10.1152/ajprenal.00455.2018. [DOI] [PubMed] [Google Scholar]
  30. Lu T. J., Lai W. Y., Huang C. Y., Hsieh W. J., Yu J. S., Hsieh Y. J., Chang W. T., Leu T. H., Chang W. C., Chuang W. J., Tang M. J., Chen T. Y., Lu T. L., Lai M. D. Inhibition of cell migration by autophosphorylated mammalian sterile 20-like kinase 3 (MST3) involves paxillin and protein-tyrosine phosphatase-PEST. J. Biol. Chem. 2006b;281:38405–38417. doi: 10.1074/jbc.M605035200. [DOI] [PubMed] [Google Scholar]
  31. Luo F., Zhou J., Wang S., Sun Z., Han Q., Bai C. microRNA-222 promotes colorectal cancer cell migration and invasion by targeting MST3. FEBS Open Bio. 2019;9:901–913. doi: 10.1002/2211-5463.12623. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Ma R., Ren J. M., Li P., Zhou Y. J., Zhou M. K., Hu Z., Xiao X. Y. Activated YAP causes renal damage of type 2 diabetic nephropathy. Eur. Rev. Med. Pharmacol. Sci. 2019;23:755–763. doi: 10.26355/eurrev_201901_16890. [DOI] [PubMed] [Google Scholar]
  33. McClatchey A. I., Yap A. S. Contact inhibition (of proliferation) redux. Curr. Opin. Cell Biol. 2012;24:685–694. doi: 10.1016/j.ceb.2012.06.009. [DOI] [PubMed] [Google Scholar]
  34. Mia M. M., Singh M. K. New insights into Hippo/YAP signaling in fibrotic diseases. Cells. 2022;11:2065. doi: 10.3390/cells11132065. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Mo J. S., Meng Z., Kim Y. C., Park H. W., Hansen C. G., Kim S., Lim D. S., Guan K. L. Cellular energy stress induces AMPK-mediated regulation of YAP and the Hippo pathway. Nat. Cell Biol. 2015;17:500–510. doi: 10.1038/ncb3111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Song H., Mak K. K., Topol L., Yun K., Hu J., Garrett L., Chen Y., Park O., Chang J., Simpson R. M., Wang C. Y., Gao B., Jiang J., Yang Y. Mammalian Mst1 and Mst2 kinases play essential roles in organ size control and tumor suppression. Proc. Natl. Acad. Sci. U. S. A. 2010;107:1431–1436. doi: 10.1073/pnas.0911409107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Wang W., Xiao Z. D., Li X., Aziz K. E., Gan B., Johnson R. L., Chen J. AMPK modulates Hippo pathway activity to regulate energy homeostasis. Nat. Cell Biol. 2015;17:490–499. doi: 10.1038/ncb3113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Xu C., Wang L., Zhang Y., Li W., Li J., Wang Y., Meng C., Qin J., Zheng Z. H., Lan H. Y., Mak K. K., Huang Y., Xia Y. Tubule-specific Mst1/2 deficiency induces CKD via YAP and non-YAP mechanisms. J. Am. Soc. Nephrol. 2020;31:946–961. doi: 10.1681/ASN.2019101052. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Zhao B., Wei X., Li W., Udan R. S., Yang Q., Kim J., Xie J., Ikenoue T., Yu J., Li L., Zheng P., Ye K., Chinnaiyan A., Halder G., Lai Z. C., Guan K. L. Inactivation of YAP oncoprotein by the Hippo pathway is involved in cell contact inhibition and tissue growth control. Genes Dev. 2007;21:2747–2761. doi: 10.1101/gad.1602907. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Zhao B., Ye X., Yu J., Li L., Li W., Li S., Yu J., Lin J. D., Wang C. Y., Chinnaiyan A. M., Lai Z. C., Guan K. L. TEAD mediates YAP-dependent gene induction and growth control. Genes Dev. 2008;22:1962–1971. doi: 10.1101/gad.1664408. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Zhou D., Conrad C., Xia F., Park J.-S., Payer B., Yin Y., Lauwers G. Y., Thasler W., Lee J. T., Avruch J., Bardeesy N. Mst1 and Mst2 maintain hepatocyte quiescence and suppress hepatocellular carcinoma development through inactivation of the Yap1 oncogene. Cancer Cell. 2009;16:425–438. doi: 10.1016/j.ccr.2009.09.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Zhou D., Zhang Y., Wu H., Barry E., Yin Y., Lawrence E., Dawson D., Willis J. E., Markowitz S. D., Camargo F. D., Avruch J. Mst1 and Mst2 protein kinases restrain intestinal stem cell proliferation and colonic tumorigenesis by inhibition of Yes-associated protein (Yap) overabundance. Proc. Natl. Acad. Sci. U. S. A. 2011;108:E1312–E1320. doi: 10.1073/pnas.1110428108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Zhu C., Li L., Zhao B. The regulation and function of YAP transcription co-activator. Acta Biochim. Biophys. Sin. 2015;47:16–28. doi: 10.1093/abbs/gmu110. [DOI] [PubMed] [Google Scholar]

Articles from Biomolecules & Therapeutics are provided here courtesy of Korean Society of Applied Pharmacology

RESOURCES