Selenium enhances salt tolerance in safflower via biochemical and molecular modulation

Abstract

Salinity represents a significant challenge to global agriculture and crop production, emphasizing the need for innovative strategies to enhance the salt tolerance of various crop species. Selenium (Se), an essential inorganic plant elicitor, has shown potential in mitigating salinity stress. This study investigated the effectiveness of Se in alleviating salt stress in Carthamus tinctorius L. Two weeks old seedlings were exposed to NaCl and sodium selenate. Selenium application reduced the adverse effects of salinity on physiological, molecular, and biochemical processes compared to the control. Se treatment increased the proline and protein content in safflower under saline conditions. Furthermore, Se mitigated oxidative stress by enhancing the activities of POX and PPO in both leaf and root tissues. Se promoted the biosynthesis of secondary metabolites, leading to increases in total phenolic, flavonoids, and anthocyanin content under saline conditions. SOD and PAL genes expression increased in salinized C. tinctorius and treated with Se as a molecular strategy to cope with the salinity. The findings of this study elucidated some biochemical, physiological, and molecular mechanisms. These mechanisms underlie selenium-mediated salt resilience in C. tinctorius.

Introduction

Salinity is a prevalent factor contributing to abiotic stress in plants, potentially leading to yield reduction of up to 65% in agricultural species¹. The accumulation of elevated salt levels in cultivated soils disrupts plants’ physiological and biochemical processes, thereby inducing salinity stress².

Salt toxicity enhances the production of reactive oxygen species (ROS), leading to cellular damage in plants³. Salinity induces oxidative stress at the cellular level, resulting in increased lipid peroxidation, protein degradation, reduced membrane stability, DNA damage, enzyme inactivation, and imbalances in hormones and nutrients^4,5. To cope with salt stress, plants have developed a range of adaptive strategies to mitigate its effects, including the synthesis of osmoprotectants and antioxidant compounds⁶. Salinity decreased chlorophyll and total soluble protein contents in safflower; conversely, the concentrations of proline, glycine betaine, carbohydrates, total carotenoids, flavonoids, and anthocyanins, along with the expression of the phenylalanine ammonia-lyase (PAL) gene, increased⁷.

Various elicitors help mitigate plant stress by inducing physiochemical and molecular changes associated with stress responses^8–10. Selenium (Se), recognized as an essential micronutrient, promotes plant growth and development even in minimal quantities. It also provides protective effects against various abiotic stresses, functioning as an antioxidant or stimulant in a dose-dependent manner¹¹. Se enhances the antioxidant defense mechanisms at low concentrations, protecting plant tissues from oxidative stress; conversely, at elevated concentrations, it can exhibit pro-oxidant behavior¹².

Previous research has demonstrated that exogenous Se enhances tolerance to abiotic stress, such as salinity^13,14. Selenium has significantly mitigated salinity stress in maize by improving photosynthetic efficiency and strengthening the antioxidant defense system through increased activity of superoxide dismutase (SOD) and ascorbate peroxidase (APX) enzymes¹⁵. Furthermore, Hussain et al.¹⁶ reported that Se influences the activity of various antioxidant enzymes in Brassica rapa, including APX, SOD, peroxidase (POX), and catalase (CAT) in response to salinity treatment. Alterations at the transcriptomic level of genes associated with antioxidant systems in plants subjected to salinity stress were assessed, revealing that both salinity and Se modulated the expression levels of SOD, CAT, APX, and POX¹⁶.

Due to deteriorating climatic conditions, soil salinity is progressively intensifying, exerting adverse effects on diverse plant species. There exists an urgent imperative to identify molecular, physiological, and biochemical markers of salt tolerance to enhance crop resilience under saline environments. The objectives of this investigation were to analyze the biochemical, physiological, and molecular responses of safflower (Carthamus tinctorius L.) subjected to salinity stress and to evaluate the potential role of Se in alleviating salt-induced adverse effects. This research enables us to contribute to the development of strategies to mitigate salt stress impacts and to deepen our understanding of selenium’s function in reducing salinity-related challenges in crop cultivation.

Materials and methods

Conditions of the experiments

This study was carried out in the greenhouse and plant physiology laboratory at the Faculty of Biological Sciences, Kharazmi University, Tehran. Seeds of Carthamus tinctorius L. were obtained from the Pakan Bazr Company. Initially, safflower seeds were planted in a culture tray filled with cocopeat. After a development period of 15 days, during which the true leaves emerged, the seedlings were transferred to plastic pots containing soil¹⁷ (Table 1). The dry soil was artificially contaminated by the addition of NaCl (0, 0.5, 1.5, and 2.5 g kg⁻¹) and sodium selenate (0, 0.01, and 0.02 g kg⁻¹) (Table 2). The contaminated soil was then allowed to equilibrate for two weeks under greenhouse conditions. Each experimental pot, with an approximate diameter of 20 cm and a depth of 20 cm, was filled with 4 kg of soil. The pots were maintained in a greenhouse at a temperature of 28 ± 2 °C with a light cycle consisting of 16 h of light followed by 8 h of darkness. To mitigate potential microclimatic variations that could influence plant growth, the pots were shuffled and repositioned daily. Sampling was conducted after 30 days.

Table 1.

Physical and chemical characterization of the experimental soil.

Parameter	Value
pH	7
EC (dS m−1)	0.73
Total lime (%)	9.9
Organic carbon (%)	5.15
Total Nitrogen (%)	0.37
Soil texture	loam
Cu (mg kg−1)	2.3
P (mg kg−1)	190
K (mg kg−1)	2780

Table 2.

Treatments used in experiments.

Abbreviated names of treatments	Treatments (g kg−1)
T1	0 NaCl + 0 Se
T2	0 NaCl + 0.01 Se
T3	0 NaCl + 0.02 Se
T4	0.5 NaCl + 0 Se
T5	0.5 NaCl + 0.01 Se
T6	0.5 NaCl + 0.02 Se
T7	1.5 NaCl + 0 Se
T8	1.5 NaCl + 0.01 Se
T9	1.5 NaCl + 0.02 Se
T10	2.5 NaCl + 0 Se
T11	2.5 NaCl + 0.01 Se
T12	2.5 NaCl + 0.02 Se

Proline content

The proline concentration in C. tinctorius was evaluated using a standard ninhydrin-based method in conjunction with spectrophotometric analysis, as outlined by Bates et al.¹⁸. In summary, 0.2 g of fresh tissue was homogenized in 5 mL of 3% aqueous sulfosalicylic acid and allowed to extract for 60 min. The resulting mixture was centrifuged at 6000 rpm for 10 min. Subsequently, a combination of 2 mL of the supernatant, 2 mL of glacial acetic acid, and 2 mL of acidic ninhydrin was boiled in a water bath for 60 min. The reaction was terminated by cooling the mixture in an ice bath, after which 4 mL of toluene was added, and the solution was vigorously mixed using a vortex. After the mixture reached room temperature, the absorbance was recorded at 520 nm, using toluene as a blank. The proline concentration was quantified against a standard curve ranging from 20 to 100 µg mL⁻¹ of L-proline.

Total phenolic content

Total phenolic content was measured by preparing a methanol extract, which involved grinding and blending 0.1 g of fresh tissue with 10 mL of 85% methanol. 100 µL of this extract was combined with 1500 µL of Folin reagent, which has been previously diluted tenfold with distilled water, and incubated at room temperature for 5 min. Subsequently, 1200 µL of a 7% sodium carbonate solution was added, and the mixture was stored in the dark for 90 min. Finally, the absorbance was measured at 760 nm, and the total phenolic content was expressed as gallic acid equivalents (mg GAE g⁻¹ DW)¹⁹.

Flavonoid content

The total flavonoid content was assessed using the aluminum chloride colorimetric method²⁰. Leaf samples were ground in methanol, followed by the addition of 0.30 mL of 5% NaNO₂ to 1 mL aliquots of the extract. After 5 min, 0.3 mL of 10% AlCl₃ was added. After an additional 5 min, 2 mL of 1M NaOH was added, and the final volume was adjusted to 10 mL with distilled water. The resulting solution was thoroughly mixed, and its absorbance was recorded at 510 nm against a blank reference. The flavonoid content was quantified using a calibration curve generated with quercetin as the standard for flavonoid compounds.

Anthocyanin content

For the quantification of anthocyanin content, 0.1 g of fresh leaf tissue was homogenized in 10 mL of a methanol solution (comprising 7 mL of acetic acid mixed with 80 mL of methanol to yield a total volume of 100 mL)²¹. The resulting solution was centrifuged at 4000 g for 10 min, after which 100 µL of chloroform was added to facilitate the removal of chlorophyll. The absorbance for each sample was measured at 530 nm. Anthocyanin content was determined using the extinction coefficient of 33 mmol cm⁻¹.

Assay of total protein content and enzymatic activity

To quantify the total protein content and assess enzymatic activity, 0.1 g of freshly harvested leaves and roots were homogenized in 2 mL of a 50 mM phosphate buffer at pH 6.8. The homogenate was subsequently centrifuged at 15,000 rpm for 12 min at 4 °C using a Smart R17 refrigerated microcentrifuge. The supernatant collected following centrifugation was isolated for subsequent analysis.

Total protein content

Protein quantification was performed using the Bradford method²². The absorbance of the samples was recorded at 595 nm using a Unico model 2150 spectrophotometer, and the protein concentration was determined. Total protein content was expressed in milligrams per gram of fresh weight, based on a standard curve generated with bovine serum albumin (BSA).

Peroxidase activity

Peroxidase (POX) activity was evaluated using a reaction mixture containing 25 mM phosphate buffer (pH 6.8), 40 mM hydrogen peroxide, 20 mM guaiacol, and an enzymatic extract. The absorbance of the reaction solution was then measured at 470 nm using a spectrophotometer²³. The enzymatic activity was expressed as the ΔOD min⁻¹ g⁻¹ protein.

Polyphenol oxidase activity

Polyphenol oxidase (PPO) activity was assessed following the protocol established by Raymond, et al.²⁴. The enzymatic activity was quantified by monitoring the increase in absorbance at 430 nm. The reaction mixture consisted of a 200 mM phosphate buffer at pH 6.8, 20 mM pyrogallol, and the enzyme extract. The enzymatic activity was reported as the ΔOD min⁻¹ g⁻¹ protein.

RNA extraction and cDNA synthesis

Total RNA was extracted from control and treated plant samples using the DENAzist Column RNA Isolation Kit (DENA Zist Asia Company, Iran). A total of 500 ng of the isolated RNA was mixed with 1 μL of 50 µM Oligo(dT) primer and 1 μL of 10 µM Random primer, then adjusted to a final volume of 12 μL using Diethylpyrocarbonate (DEPC) water. This mixture was incubated at 65 °C for 10 min, followed by cooling on ice for 1 min.

Next, a reaction mixture containing 1 μL of reverse transcriptase enzyme (SMOBio, Taiwan), 2 μL of 10X Buffer, 4 μL of 10 mM dNTPs, 0.5 μL of RNase inhibitor, and 0.5 μL of H₂O was added, bringing the final volume to 20 μL. The samples were incubated at 42 °C for 90 min, followed by a termination step at 70 °C for 5 min. The resulting cDNA products were stored at -80 °C until further analysis by real-time PCR.

Primers and real-time PCR

Real-time PCR reactions were performed in a total volume of 10 μL, containing 5 μL of Taq SYBR Green (Ampliqon 2 × SYBR Green High ROX), 2 μL of cDNA, and 0.2 μL of a primer pair mix. Optimal primer design was achieved using Geneious IR9 software alongside the Oligoanalyzer tool. The specificity of the designed primers was verified through BLAST primer analysis in the NCBI GenBank database (Table 3).

Table 3.

Designed primers.

Primer name	Sequence (5–3)	Tm (°C )	Amplicon (bp)
PAL-F	CCATTGCTGCTATCGGGAAAC	62	97
PAL-R	CGGCTACCGGATAGATTCGAA	61
SOD-F	AGGCAGAAGGTGCTCCCAC	60	100
SOD-R	CCATTGGTTGTGTCACCAAG	59
actin-F	GAAGATCAAGGTGGTTGCACC	60	93
actin-R	CACATCTGTTGGAAGGTGCTG	60

The amplification process was conducted under the following conditions: an initial denaturation step at 95 °C for 15 min, followed by 40 cycles of 94 °C for 15 s, and 59 °C for 40 s, concluding with a final extension at 72 °C for 20 s. Changes in target genes’ expression levels were evaluated using the 2^−ΔΔCt method²⁵.

Statistical analysis

The study was conducted in a factorial design based on a completely randomized design, with three replications using SPSS software (version 27). Data were expressed as means ± SE, and the statistically significant differences (P ≤ 0.05) between the groups were evaluated using the Duncan test. Graphs were created using GraphPad Prism 9.0 software. Heat map analysis was performed using CIMMiner online at https://discover.nci.nih.gov/cimminer/home.do.

Results

Proline content

The interaction between NaCl and Se significantly affected the proline concentration in safflower leaves (P ≤ 0.01). The amount of proline increased with increasing NaCl and Se concentrations. The proline content in safflower was measured at 116.73, 248.13, 321.17, and 561.75 µg g⁻¹ FW at NaCl concentrations of 0, 0.5, 1.5, and 2.5 g kg⁻¹, respectively. Upon the addition of 0.02 g kg⁻¹ Se, the proline content was recorded at 216.65, 285.47, 393.26, and 699.89 µg g⁻¹ FW (Fig. 1a). Proline content was significantly different in the groups treated with varying concentrations of Se under 0, 1.5, and 2.5 g kg⁻¹ of NaCl treatments (Fig. 1a).

Fig. 1.

Effect of Se (0, 0.01, and 0.02 g kg⁻¹) on (a) proline (b) total phenolic (c) flavonoid and (d) anthocyanin content of safflower under NaCl stress (0, 0.5, 1.5, and 2.5 g kg⁻¹). Lowercase letters show significant statistical difference between treatments. Data was presented in means (n = 3 ± S.E.)

Total phenolic content

The total phenolic content in safflower leaves showed an upward trend under NACl and Se treatments (P ≤ 0.05). The total phenol content in the treatment of 2.5 g kg⁻¹ NaCl and 0.02 g kg⁻¹ Se was 581.33 mg GAE g⁻¹ DW, which is the highest amount of total phenol. Selenium increased total phenol 1.04 times compared to the treatment of 2.5 g kg⁻¹ NaCl alone (Fig. 1b).

Flavonoid content

Flavonoid content was significantly (P ≤ 0.01) affected by the combined treatment of Se and NaCl. Flavonoid content increased with increasing NaCl and Se concentrations. The highest content was observed in the treatment involving 2.5 g kg⁻¹ NaCl and 0.02 g kg⁻¹ Se (34.53 mg QE g⁻¹ FW). Flavonoid content increased 1.5 times when 0.02 g kg⁻¹ Se was added to 2.5 g kg⁻¹ NaCl compared to when only 2.5 g kg⁻¹ NaCl was used (Fig. 1c). There was a significant difference in the groups treated with different concentrations of Se under 0 and 2.5 g kg⁻¹ of NaCl treatments (Fig. 1c).

Anthocyanin content

The results showed that the effect of Se on the anthocyanin content of safflower leaves under NaCl treatment was significant (P ≤ 0.01). With increasing NaCl concentration, the anthocyanin content increased. The highest anthocyanin content was in the treatment of 2.5 g kg⁻¹ NaCl and 0.02 g kg⁻¹ Se (25.80 μmol g⁻¹ FW). Although Se enhanced the anthocyanin content, there was no significant difference when compared to the treatment with only 2.5 g kg⁻¹ NaCl (Fig. 1d). There was a significant difference in the groups treated with different concentrations of Se under 0, 0.5, and 1.5 g kg⁻¹ of NaCl treatments (Fig. 1d).

Total protein content and enzymatic activity

Selenium significantly influenced the protein content of safflower leaves (P ≤ 0.05) and roots (P ≤ 0.01) under salt stress. An increase in salinity levels was correlated with a reduction in the protein content of both leaves and roots. Selenium at concentrations of 0.02 g kg⁻¹ to 2.5 g kg⁻¹ NaCl resulted in increases in the protein content of leaves and roots by 1.6 and 15.6 times, respectively, compared to the plants that were treated with 2.5 g kg⁻¹ NaCl alone (Fig. 2).

Fig. 2.

Effect of Se (0, 0.01, and 0.02 g kg⁻¹) on (a) shoot total protein content and (b) root total protein content of safflower under NaCl stress (0, 0.5, 1.5, and 2.5 g kg⁻¹). Lowercase letters show significant statistical difference between treatments. Data was presented in means (n = 3 ± S.E.)

The results revealed a significant effect of Se on the activity of the POX in safflower shoots (P ≤ 0.05) and roots (P ≤ 0.01) under saline stress. Elevated NaCl concentrations led to an enhancement in antioxidant activity within both leaves and roots. The POX activity in the roots and the shoot was 9.61 and 2.65 ΔOD min⁻¹ g⁻¹ protein, respectively, at a concentration of 2.5 g kg⁻¹ NaCl. Selenium (0.02 g kg⁻¹) increased the activity of the POX by 20.75% and 37.46% in roots and shoots under NaCl treatment (2.5 g kg⁻¹), respectively (Fig. 3a,b).

Fig. 3.

Effect of Se (0, 0.01, and 0.02 g kg⁻¹) on antioxidant enzyme activity of safflower under NaCl stress (0, 0.5, 1.5, and 2.5 g kg⁻¹). (a) shoot peroxidase (POX) activity, (b) root POX activity, (c) shoot polyphenol oxidase (PPO) activity, and (d) root PPO activity. Lowercase letters show significant statistical difference between treatments. Data was presented in means (n = 3 ± S.E.)

The impact of Se on PPO activity in safflower shoots under salt stress was significant (P ≤ 0.01), although no significant effect was observed in the roots. PPO activity in shoots peaked in the treatment of 2.5 g kg⁻¹ NaCl (3.66 ΔOD min⁻¹ g⁻¹ protein). Selenium at a concentration of 0.02 g kg⁻¹ simultaneously with 2.5 g kg⁻¹ NaCl in leaves enhanced the activity of PPO by about 42.89% compared to the 2.5 g kg⁻¹ NaCl treatment alone (Fig. 3c,d).

Expression levels of the SOD and PAL genes

The changes in the transcriptomic expression of genes related to antioxidant systems in plants treated with NaCl and Se were evaluated (Fig. 4). The findings demonstrated that Se significantly elevated the expression levels of SOD and PAL genes (P ≤ 0.01). NaCl treatment at a concentration of 2.5 g kg⁻¹ resulted in an 8.1-fold increase in SOD expression (Fig. 4a) and a 9.62-fold increase in PAL expression (Fig. 4b) relative to the control group. In plants subjected to NaCl (2.5 g kg⁻¹), Se application (0.02 g kg⁻¹) resulted in increases in SOD and PAL expression levels by 23.75% and 8.05%, respectively, compared to the plants receiving 2.5 g kg⁻¹ NaCl without Se (Fig. 4).

Fig. 4.

Effect of Se (0, 0.01, and 0.02 g kg⁻¹) on relative expression level of (a) SOD and (b) PAL gene of safflower under NaCl stress (0, 0.5, 1.5, and 2.5 g kg⁻¹) by qRT-PCR. Lowercase letters show significant statistical difference between treatments. Data was presented in means (n = 3 ± S.E.)

Heat map

The heat map analysis revealed the presence of distinct patterns related to the variability in root protein and PAL gene expression under different treatments. These parameters exhibited the maximum variability among the measured traits, indicating their sensitivity to the treatment conditions. On the other hand, a cluster consisting of total phenolic content showed minimal variability, suggesting a more stable response to the treatments. Two clusters emerged based on the treatments applied. The classification of plant samples into these clusters was predominantly influenced by the concentrations of NaCl and Se (Fig. 5, left). The first cluster included control plants and those treated with 0.5 g kg⁻¹ NaCl and Se (0.02 g kg⁻¹). The second cluster comprised plants treated with 2.5 g kg⁻¹ NaCl and Se (0.02 g kg⁻¹). Overall, these findings underscore the varying sensitivities of different plant traits and responses to the treatments, as well as the crucial role of different treatments in shaping these responses (Fig. 5).

Fig. 5.

Heat map of studied traits under NaCl and Se treatments in the vegetative phase. RPr: root protein content, PAL gene, TF: total flavonoids, Pro: proline, SOD: SOD gene, RPOX: root POX, SPPO: shoot PPO, SPOX: shoot POX, RPPO: root PPO, SPr: shoot protein content, TPC: total phenolic, Ant: anthocyanin. T1: 0 NaCl* 0 Se, T3: 0.02 Se, T4: 0.5 NaCl, T6: 0.5 NaCl*0.02 Se, T10: 2.5 NaCl, T12: 2.5 NaCl * 0.02 Se.

Discussion

Soil salinity has become a major challenge, threatening agricultural productivity worldwide. Research indicates that salinity stress adversely affects plant growth and yield across various species^16,26. Although Se is not classified as an essential nutrient, it can have beneficial and harmful effects on plant growth, depending on its concentration^27,28. Our findings provide insights into how Se enhances salt tolerance in safflower, underpinning these effects with biochemical and molecular mechanisms.

The present study indicated a significant accumulation of proline in plants exposed to NaCl stress, with Se treatment further promoting proline levels in these stressed plants. The substantial increase in proline levels observed under salt stress aligns with its well-documented role as an osmolyte that stabilizes cellular structures, thus maintaining osmotic balance²⁹. The further promotion of proline synthesis by Se suggests an active modulation of osmoprotective pathways. Under conditions of stress, Se influences proline metabolism by regulating the enzymatic activities of γ-glutamyl kinase and proline oxidase, thereby promoting increased biosynthesis and reduced catabolism of proline³⁰. This indicates that Se may indirectly bolster antioxidant capacity by supporting osmolyte accumulation, thus maintaining cellular integrity under salinity stress. Additionally, research have revealed that Se enhances proline content in grapevine³¹ and wheat³² under stress conditions, as observed in the present study.

Our research demonstrated that NaCl stress elevated the levels of phenolic compounds, flavonoids, and anthocyanins in safflower leaves. Selenium enhanced the concentration of these compounds in salt-stressed plants. Salt stress-induced accumulation of phenolic compounds, flavonoids, and anthocyanins enhances the plant’s antioxidant defense system^33,34. These secondary metabolites act as non-enzymatic antioxidants, directly scavenging ROS and chelating metal ions that catalyze oxidative reactions^35,36.

The administration of Se influences the metabolism of proteins and amino acids, particularly phenylalanine, which is a precursor to phenolic compounds, offering protection such as flavonoids. Flavonoids are recognized for their ability to neutralize free radical ions, offering protection to plants against the detrimental effects of abiotic stress, thereby functioning effectively as antioxidants^37,38. Selenium and nano-selenium (Nano-Se) application has been shown to significantly alleviate the toxic impacts of salinity in lemon verbena by enhancing both non-enzymatic (total phenolic and flavonoid contents) and enzymatic (catalase, superoxide dismutase, and peroxidase) antioxidant systems³⁹, similar to our study. Selenium supplementation was observed to enhance the expression levels of two transcription factors, MYB1 and MYB2, both of which are critical regulators in flavonoid biosynthesis. These findings suggest that following Se application, MYB1 and MYB2 play a contributory role in the upregulation and positive modulation of flavonoid accumulation⁴⁰. Phenylalanine ammonia-lyase is the essential and initial rate-limiting enzyme in the phenylpropanoid pathway, responsible for converting L-phenylalanine into cinnamic acid. This pathway leads to the production of various phenolic compounds⁴¹. Thus, an increase in the synthesis of phenolic compounds upon Se application suggests the activation of phenylpropanoid pathway enzymes, potentially driven by elevated gene expression of key regulators, such as PAL, as corroborated by our gene expression data.

The current study found that salt stress caused a significant reduction in the protein content of the roots and leaves of safflower. Conversely, Se treatment increased protein levels, which may be attributed to its role in stabilizing protein structures and enhancing the activity of protective enzymes⁴². Selenium upregulates the glyoxalase system, thereby safeguarding biomolecules such as proteins. Under salt stress conditions, plants tend to accumulate elevated levels of methylglyoxal, which induces carbonyl stress and consequently damages proteins. The glyoxalase system in plants efficiently detoxifies excess methylglyoxal while simultaneously facilitating the regeneration of glutathione (GSH), thus maintaining cellular homeostasis and ensuring a dynamic equilibrium within the cell^43–46.

Exposure to salt stress was associated with elevated activities of POX and PPO in the roots and leaves, and Se treatment increased these enzyme activities in salt-stressed plants. The observed increase in POX and PPO activities suggests that Se stimulates enzymatic antioxidant defenses, directly contributing to ROS detoxification and cellular protection^42,47,48. These enzymes catalyze reactions that decompose ROS, thereby preventing oxidative damage to membranes and macromolecules. The upregulation of these enzymes aligns with previous reports demonstrating Se’s capacity to enhance antioxidant enzyme activities in various crops under salinity stress^49–52.

Previous research has indicated that applying Se under salinity stress often boosts the expression of genes encoding key antioxidant enzymes. This upregulation enhances the plant’s ability to mitigate oxidative stress caused by elevated ROS. Selenium promotes the activity of enzymes by increasing the expression of their corresponding genes, which is crucial for efficiently neutralizing ROS, minimizing oxidative damage, and strengthening antioxidant defenses. These upregulated enzymes catalyze the transformation of harmful ROS into less damaging substances, thereby safeguarding cellular components from oxidative harm⁵³. Additionally, Se not only stimulates the expression of antioxidant enzyme genes but may also influence signaling pathways that regulate stress responses, thereby synergistically reinforcing the plant’s antioxidant defense system against salinity stress⁵⁴. Research supports that salinity increases the activities of various antioxidant enzymes due to the accumulation of more ROS within tissues^53,54. Under saline conditions, Se typically functions as a co-substrate for antioxidant enzymes enhancing SOD activity to protect mitochondria from oxidative damage and increasing GPX and CAT activities to facilitate ROS removal, thereby decreasing membrane peroxidation and MDA levels⁵⁵. Selenium application has been shown to improve plant tolerance to oxidative stress and promote growth under saline conditions by enhancing antioxidant enzyme activities, as demonstrated in studies by Alvan, et al.²⁶.

Our results showing increased expression of PAL and SOD genes upon Se treatment under salt stress highlight Se’s role in fine-tuning molecular defense mechanisms. The upregulation of PAL enhances phenolic biosynthesis, reinforcing antioxidant capacity and cell wall fortification^56,57. Similarly, elevated SOD gene expression contributes to efficient dismutation of superoxide radicals, reducing oxidative stress^58,59. Supporting these findings, studies in rice and chicory have demonstrated that Se supplementation leads to increased expression of key antioxidant and phenylpropanoid pathway genes, correlating with enhanced stress tolerance^58,59. Overexpression of antioxidant genes that respond to stress in plants, such as those in strawberry⁶⁰, Cucurbita pepo⁶¹, and poplar⁶², further confirms their vital role in scavenging ROS and mitigating stress effects. This activation of enzyme genes represents an effective strategy employed by plants to cope with various stresses, including salinity.

Conclusions

In this study, the effects of Se on C. tinctorius cultivated in normal and saline-treated soils were examined. Selenium enhanced salt tolerance in safflower through a multifaceted approach involving the accumulation of osmoprotectants like proline, upregulation of secondary metabolites with antioxidant properties, activation of enzymatic antioxidant defenses, and modulation of stress-responsive gene expression. These mechanisms are interconnected; for example, Se-mediated gene expression enhances enzyme activities that reduce ROS, which in turn preserve cellular components and support metabolic stability under stress. Future research should focus on dissecting the signaling pathways through which Se influences these molecular responses, potentially leading to more targeted use of Se in crop stress management.

Author contributions

All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Fatemeh Fatahiyan and Farzaneh Najafi. The first draft of the manuscript was written by Zohreh Shirkhani and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.

Data availability

All data generated or analyzed during this study are included in this published article.

Declarations

Competing interests

The authors declare no competing interests.