Abstract
Aim
The inhibitory effects of estrogen and progesterone on lipopolysaccharide (LPS)-induced inflammation and the nuclear factor-κB (NF-κB), mitogen-activated protein kinase (MAPK), and phosphoinositide-3 kinase (PI3K)/protein kinase B (Akt) signaling pathways in mouse oviductal epithelial cells were investigated.
Methods
Mouse oviduct epithelial cells were isolated for various in vitro experiments. The CCK-8 method was used to detect the effects of LPS, LPS + Dexamethasone (DXM), LPS + E2, and LPS + P4 on the viability of fallopian tube epithelial cells. RT‒qPCR was used to measure the expression levels of IL-1β, TNF-α, IL-10, and β-defensin-2 (mBD-2) in cells. ELISA was used to measure the levels of IL-1β in cells. Western blotting was used to detect the protein expression of NF-κB p65, IκBα, p38, P-p38, Akt, and P-Akt in cells. Additionally, a salpingitis mouse model was constructed with LPS, and the model mice were treated with estrogen (E2), progesterone (P4), and DXM. The ovarian tissues were collected and subjected to HE staining. Moreover, IL-10 and mBD-2 expression in the tissue was detected by immunohistochemical staining.
Key findings
Estrogen and progesterone significantly inhibited the production of IL-1β, TNF-α, IL-10, and mBD-2, thereby effectively suppressing the inflammatory response induced by LPS. In terms of signaling pathways, estrogen and progesterone significantly inhibited the protein expression of NF-κB, MAPK, and PI3K/Akt pathway members induced by LPS.
Significance
Estrogen and progesterone can protect against LPS-induced mouse salpingitis by inhibiting the activation of the NF-κB, MAPK, and PI3K/Akt signaling pathways and suppressing the expression of the inflammatory factors IL-1β, TNF-α, IL-10, and mBD-2.
Brief Summary
Estrogen and progesterone can effectively reduce the inflammatory response of the fallopian tubes.
Strengths and limitations of this study
The advantages of this study are as follows: high data reliability; a large number of experimental repetitions, resulting in stable outcomes; and a concise and efficient explanation of the issues.
Limitation
The research objective is too broad.
Supplementary Information
The online version contains supplementary material available at 10.1186/s12917-025-04874-x.
Keywords: Estrogen, Progesterone, LPS, NF-κB, MAPK, PI3K/Akt
Introduction
Infertility is a medical condition defined as the inability to become pregnant after a year or more of regular, unprotected sexual intercourse or after artificial insemination. Approximately 15% of couples in the United States are affected by infertility [1]. Female infertility accounts for approximately 50% of all infertility cases, and tubal diseases are responsible for 10-30% of female infertility [2]. The WHO predicts that infertility may become the third-most common disease affecting human health after cancer and cardiovascular diseases in the 21st century.
Salpingitis is a serious reproductive tract disease, and its sequelae include tubal blockage, infertility, ectopic pregnancy, and chronic pelvic pain. The fallopian tubes of mammals play an important reproductive role in the transportation of eggs, transportation of sperm, activation of sperm, and early embryonic development [3]. The normal epithelial cells of the fallopian tubes secrete fallopian tube fluid, which can provide nutritional support for sperm and early embryos, and also helps with the self-defense of the fallopian tubes [4]. Recent studies have shown that tubal inflammation can cause various cytotoxic factors and enzymes to be released into the fluid inside the fallopian tubes, leading to fertilization disorders, early embryo growth defects, and abnormal transport and implantation of fertilized eggs, ultimately resulting in pregnancy failure [5]. Salpingitis is a clinically common and difficult-to-treat disease with various causes and presents multiple inflammatory patterns. It can be classified into acute salpingitis and chronic salpingitis on the basis of the course of the disease. The etiology of this disease can be divided into nonspecific salpingitis and specific salpingitis. The main clinical triggers include pathogen infections, iatrogenic infections, the spread of inflammation from adjacent organs, and high-risk sexual behaviors, among others. The main research topics include eosinophilic salpingitis related to parasitic infections [6], nodular salpingitis associated with infections, cellular invasion, congenital malformations [7], and salpingitis related to Chlamydia trachomatis infection [8]. Salpingitis may lead to obstruction of the fallopian tubes, which can result in infertility.
Many previous studies have shown that estrogen (E2) and progesterone (P4) have anti-inflammatory effects. Estradiol is the most potent natural estrogen in the human body and plays a key role in reproductive health and metabolic regulation. According to the relevant literature, estradiol can effectively inhibit lipopolysaccharide (LPS)-induced inflammatory responses in ovine fallopian tube epithelial cells by downregulating the p38 and NF-κB signaling pathways [9]. Estrogen can significantly reduce the upregulation of inflammatory factors such as IL-1β, IL-6, and TNF-α in LPS-induced rat uterine epithelial cells [10]. Additionally, a decrease in estradiol can lead to an increase in the expression of inflammatory factors such as TNF-α and IL-6 [11]. In addition to estradiol, progesterone is also an important steroid hormone that is primarily secreted by the corpus luteum in female ovaries and plays a central role in reproductive health, maintenance of pregnancy, and endocrine regulation. Previous experiments have shown that progesterone can effectively inhibit the production of inflammatory factors in LPS-induced bovine endometrial epithelial cells by intervening in the NF-κB and MAPK signaling pathways [12]. Furthermore, progesterone effectively suppressed the expression of inflammatory factors in LPS-induced human fetal membrane cells [13]. Therefore, on the basis of previous experiments, the anti-inflammatory effects of E2 and P4 as well as their possible molecular mechanisms were investigated in this study through in vitro and in vivo experiments.
Materials
Animals and cell lines
Thirty female Kunming mice (6–8 weeks old; 18–22 g) were provided by the Experimental Animal Center of Inner Mongolia Medical University (Inner Mongolia Autonomous Region, Hohhot City). The animal experiments were approved by the Animal Ethics Committee. These animals were kept in plastic cages with a controlled temperature of 20–26 °C and humidity of 50–60% under a 12 h/12 h light/dark cycle. The fallopian tube epithelial cells were isolated from the mice (Procell, Wuhan).
Main reagents and instruments
Mouse fallopian tube epithelial cells were cultured with complete culture medium, fetal bovine serum, antibiotics, DMSO, polylysine, trypsin, and PBS (Procell, Wuhan). Collagen type I (Sigma), polyformaldehyde (China National Pharmaceutical Group Corporation), concentrated normal goat serum (Wuhan Boster Biological Technology), Cy3-labeled sheep anti-mouse IgG (Wuhan Boster Biological Technology), Triton X-100 (Beyotime), DAPI (Beyotime), fluorescence quenching sealing agent (SouthernBiotech), and a CCK-8 assay (Biosharp) were purchased.
Methods
CCK-8 assay to evaluate cell proliferation
The effects of LPS, LPS + Dexamethasone (DXM), LPS + E2, and LPS + P4 on the viability of fallopian tube epithelial cells were evaluated via the CCK-8 method. The epithelial cells of the fallopian tube were seeded at a density of 1 × 105 cells per well in a 96-well plate for 24 h, treated with different concentrations of DXM, E2, and P4 in 100 µL, and incubated for an additional 12 h in the incubator. Then, 10% CCK-8 was added to each well, and the samples were incubated for 2 h. The optical density (OD) was measured at 450 nm via a microplate reader. The percentage of viable cells was calculated using the following formula: (OD treatment - OD blank)/(OD control - OD blank) × 100%.
RT‒qPCR detection of the expression levels of IL-1β, TNF-α, IL-10 and β-defensin-2 (mBD-2) in cells
The cells were collected, total RNA was extracted according to an RNA extraction manual, reverse transcription was performed, and the samples were incubated at 42 °C for 2 min to remove genomic DNA. The mixture was incubated at 37 °C for 15 min and then at 85 °C for 5 s. The specific primer sequences are shown in the table below, with β-actin as the internal reference. The primers were synthesized by Sangon Biotech. The reaction conditions for real-time PCR were as follows: predenaturation at 95 °C for 30 s, denaturation at 95 °C for 5 s, and annealing at 60 °C for 30 s for a total of 40 cycles. The Ct values of each experimental group were measured separately, and the relative expression levels of the target genes were calculated via the ΔΔCt method. The primer sequences are shown in Table 1.
Table 1.
Primer sequences
| Target gene | Forward primer (5’-3’) | Reverse primer (5’-3’) |
|---|---|---|
| β-actin | GATTACTGCTCTGGCTCCTAGC | GACTCATCGTACTCCTGCTTGC |
| IL-1β | CAACCAACAAGTGATATTCTCC | GATCCACACTCTCCAGCTGCA |
| IL-10 | TGCTAACCGACTCCTTAATGCAGGAC | CCTTGATTTCTGGGCCATGCTTCTC |
| TNF-α | GCACCACCATGAAGGACTCA | TCGGAGGCTCCAGTGAATTCG |
| mBD-2 | TCTCTGCTCTCTGCTGCTGATATGC | AGGACAAATGGCTCTGACACAGTACC |
ELISA detection of IL-1β levels
After treating the cultured mouse fallopian tube epithelial cells according to the intervention protocols, and the supernatant was collected for testing. First, blank wells and samples wells were set up on the ELISA plate. Next, 40 µL of sample mixture was added to the wells containing the test samples, and then 10 µL of the test sample was added. One hundred microliters of enzyme-labeled reagent was added to each well, excluding the blank well, and the plate was sealed with sealing film and incubated at 37 °C for 60 min. The mixture was discarded, the wells were shaken dry, each well was filled with wash solution, and the wash solution was discarded after 30 s. Then, 50 µL of color developer A was added to each well, followed by 50 µL of color developer B. The mixture was gently shaken, and incubated at 37 °C in the dark for 15 min. Fifty microliters of stop solution was added to terminate the reaction. The OD values of each well were measured at a 450 nm wavelength, and the IL-1β levels were calculated.
Western blot detection of NF-κB p65, IκBα, p38, P-p38, akt, and P-Akt protein expression
RIPA lysis buffer was used to extract total protein from fallopian tube epithelial cells. The protein concentration was quantified using a BCA assay kit. Equal amounts of protein were separated via 10% SDS‒PAGE and then transferred to a PVDF membrane. In accordance with our previous protocol, the PVDF membrane was blocked with BSA and then treated with primary and secondary antibodies. The signal intensity was quantified via a chemiluminescence detection system.
Establishing a mouse model of ovarian ablation
A total of 0.15 ml of 1% pentobarbital sodium was injected into the abdominal cavity of each mouse. After 3 min, when the mouse was in an anesthetized state, the mouse was placed on its back, the back fur was shaved, the area was disinfected, and a horizontal incision of 1–2 cm near the rib arch on the back of the mouse was made. The fat on both sides of the ribs was removed with forceps, the germinal epithelium was separated, and the ovaries inside were removed. The uterine horn was placed back into the abdominal cavity with forceps, and the abdominal cavity was closed. In the sham surgery group, only the fat tissue around the ovaries was removed, and the remaining procedures were the same.
Grouping and intervention
Two weeks postsurgery, the mice were randomly divided into four groups: the sham surgery group (SHAM), the ovariectomy group (OVX), the ovariectomy plus estrogen group (OVX + E2), and the ovariectomy plus progesterone group (OVX + P4), with 5 mice in each group. Each group of mice received intraperitoneal injections once a day according to the required drug dosage, with each group receiving 0.1 mL of the drug for one week. See Table 2.
Table 2.
Intervention protocols for the mice (n = 5)
| Group | Handing method | Medicine | Dosage | Time(d) | Route of administration |
|---|---|---|---|---|---|
| SHAM | Fake surgery | Vegetable oil | 0.1mL/d | 7 | Abdominal cavity injection |
| OVX | Bilateral oophorectomy | Vegetable oil | 0.1mL/d | 7 | Abdominal cavity injection |
| OVX + E2 | Bilateral oophorectomy | Estrogen | 50 µg/kg/d | 7 | Abdominal cavity injection |
| OVX + P4 | Bilateral oophorectomy | Progesterone | 100 mg/kg/d | 7 | Abdominal cavity injection |
Hematoxylin and Eosin (HE) staining of tissues
The pathological damage to tubal tissue induced by LPS was evaluated through histopathological examination. The tubal tissues from each group of mice were collected, fixed in 10% formaldehyde for 24 h, dehydrated in ethanol, embedded in paraffin after clearing with xylene, cut into 0.5 μm thick sections with a microtome, and then stained with HE. In accordance with the requirements of the experimental design, different researchers have observed histopathological lesions via optical microscopy.
Immunohistochemical staining was used to detect the expression levels of IL-10 and mBD-2 in tissues
The fallopian tubes were collected from mice in each group, fixed, dehydrated, embedded in paraffin, and processed into 3 μm thick sections. The paraffin-embedded sections were deparaffinized with xylene, immersed in 3% H2O2 at room temperature for 10 min, and washed with PBS for 5 min. The tissue sections were placed in antigen retrieval solution and microwaved at a high temperature for 15 min. The endogenous peroxidases in the area of interest were blocked with a blocking solution at room temperature for 10 min, and the samples were washed with PBS three times. The samples were incubated with primary antibodies according to the instructions and washed with PBS three times. Then, a biotinylated goat anti-mouse IgG was added, the samples were incubated at room temperature for 10 min, and the samples were washed with PBS three times. A horseradish peroxidase solution was incubated at room temperature for 10 min. After color development with DAB, the sections were washed with PBS, counterstained with hematoxylin for 1 min, cleared with xylene, dehydrated, mounted on slides and coverslipped with neutral gum, and observed and photographed under a light microscope. Positive expression of the IL-10 and mBD-2 proteins was indicated by the appearance of corresponding brown deposits in epithelial cells. Analysis method 1: The optical density integral was measured via ImageJ software. Analysis method 2: The tissues were scored based on the proportion of positive cells and the staining intensity in the high-power field (200×). The staining intensity and positive cell proportion scores were added to obtain the immunohistochemistry score. The scoring process strictly adheres to experimental blind methods, with different personnel conducting the scoring for different groups. In the case of differing opinions, a third party evaluated the scores.
Statistical methods
Data analysis was performed using GraphPad Prism 8.0. All the data were calculated as the mean ± standard error of the mean (SEM) from three independent experiments. Statistical analysis was conducted using one-way analysis of variance and Dunnett’s multiple comparison test. A p value < 0.05 was considered to indicate statistical significance.
Results
Morphological observation of fallopian tube epithelial cells
The mouse fallopian tube epithelial cells used in this study were purchased from Wuhan Puno Sai Life Science Technology Co., Ltd. Before proceeding with subsequent experiments, the cell status was verified via an optical microscope. After 24 h of culture, the cells exhibited diverse morphologies, including flattened oval, polygonal, and elongated spindle shapes. After 5 days of culture, the cells had reached 80-90% confluence, and their morphology became uniform, appearing elongated and slightly smaller in size (Fig. 1).
Fig. 1.
Morphology of mouse fallopian tube epithelial cells
CCK-8 assay to evaluate cell proliferation
Effects of different concentrations of LPS on the proliferation of mouse oviduct epithelial cells
Compared with those of the control group, the OD values of the 0, 2.5, 5, 7.5, and 10 µg/mL LPS groups did not significantly differ (P > 0.05), whereas the OD values of the 12.5 and 15 µg/mL LPS groups were significantly decreased compared with those of the control group (P < 0.05) (Fig. 2 - A).
Fig. 2.
CCK-8 assay to evaluate cell proliferation A: Effects of different concentrations of LPS on the proliferation of mouse oviduct epithelial cells. B: Effects of different concentrations of DXM on the proliferation of mouse oviduct epithelial cells. C: Effects of different concentrations of E2 + LPS on the proliferation of mouse oviduct epithelial cells. D: Effects of different concentrations of P4 + LPS on the proliferation of mouse oviduct epithelial cells. Note: Compared with the control group, *P < 0.05, #P < 0.01, +P < 0.001
The combined effects of DXM and LPS on the proliferation of mouse oviduct epithelial cells
The CCK-8 assay results revealed that, compared with those of the LPS group, the OD values of the DXM groups were greater. Compared with that of the LPS group, the OD value of the LPS + 10− 7 mol/L + DXM group was significantly greater (P < 0.001) (Fig. 2 - B).
The combined effects of E2 and LPS on the proliferation of mouse oviduct epithelial cells
The CCK-8 assay results revealed that, compared with those of the LPS group, the OD values of the E2 groups were greater. Compared with that of the LPS group, the OD value of the LPS + 10− 8 mol/L + E2 group was significantly increased (P < 0.001) (Fig. 2 - C).
The combined effects of P4 and LPS on the proliferation of mouse oviduct epithelial cells
Compared with those of the LPS group, the OD values of the P4 groups were greater. Compared with that of the LPS group, the OD value of the LPS + 10− 7 mol/L + P4 group was significantly increased (P < 0.001) (Fig. 2 - D).
RT‒qPCR test results
Compared with those in the control group, the mRNA expression levels of IL-1β, TNF-α, IL-10, and mBD-2 in the LPS group were significantly greater (P < 0.05). However, compared with the LPS group, the LPS + E2 and LPS + P4 groups presented significantly lower expression levels of IL-1β, TNF-α, IL-10, and mBD-2 (P < 0.05) (Fig. 3).
Fig. 3.
RT‒qPCR detection of the expression of IL-1β, TNF-α, IL-10, and mBD-2 in each group. A: RT‒qPCR detection of the expression of IL-1β in each group. B: RT‒qPCR detection of the expression of TNF-α in each group. C: RT‒qPCR detection of the expression of IL-10 in each group. D: RT‒qPCR detection of the expression of mBD-2 in each group. Note: *P < 0.05 compared with the control group; #P < 0.05 compared with the LPS group; •P < 0.05 compared with the DXM group
ELISA test results
Compared with that in the control group, the level of the inflammatory factor IL-1β in the LPS group was significantly greater (P < 0.05). Compared with that in the LPS group, the level of IL-1β in the LPS + DXM group tended to decrease, but the difference was not statistically significant (P > 0.05). Compared with that in the LPS group, the level of IL-1β significantly decreased in the LPS + E2 and LPS + P4 groups (P < 0.05) (Fig. 4).
Fig. 4.
ELISA detection of IL-1β levels in each group. Note: *P < 0.05 compared with the control group; #P < 0.05 compared with the LPS group; •P < 0.05 compared with the DXM group
Western blot results
NF-κB signaling pathway
Compared with that in the control group, NF-κB p65 protein expression in the LPS group was significantly greater (P < 0.05). Compared with that in the LPS group, NF-κB p65 protein expression in the LPS + P4 and LPS + E2 groups was significantly lower (P < 0.05). Compared with that in the LPS group, NF-κB p65 protein expression in the DXM group tended to decrease but was not statistical significant (P > 0.05) (Fig. 5 - A and B).
Fig. 5.
Western blot detection of protein in each group. A and B: Western blotting was used to detect the protein expression of mOEC NF-κB p65 in each group. C and D: Western blotting was used to detect the protein expression of mOEC IκBα in each group. E and F: Western blotting was used to detect the expression of the mOEC P-p38 MAPK protein in each group. G and H: Western blot detection of p-Akt protein expression in each group. Note: *P < 0.05 compared with the control group; #P < 0.05 compared with the LPS group; •P < 0.05 compared with the DXM group
Compared with that in the control group, the protein expression of IκBα in the LPS group was significantly lower (P < 0.05). Compared with that in the LPS group, the protein expression of IκBα in the LPS + DXM, LPS + E2, and LPS + P4 groups was significantly greater (P < 0.05). Compared with that in the LPS + DXM group, the protein expression of IκBα in the LPS + E2 group and the LPS + P4 group was significantly greater (P < 0.05). Compared with that in the LPS + E2 group, the protein expression of IκBα in the LPS + P4 group was significantly lower (P < 0.05) (Fig. 5 - C and D).
MAPK test results
Compared with that in the control group, the P-p38 protein level in the LPS group was significantly greater (P < 0.05). Compared with that in the LPS group, the P-p38 protein level in the LPS + DXM, LPS + E2, and LPS + P4 groups was significantly lower (P < 0.05). Compared with that in the LPS + DXM group, the P-p38 protein level in the LPS + E2 group was significantly lower (P < 0.05). Compared with that in the LPS + DXM group, the protein expression of P-p38 in the LPS + P4 group was lower, but the difference was not statistically significant (P > 0.05) (Fig. 5 - E and F).
PI3K/Akt test results
The protein expression of p-Akt in the LPS group was significantly greater than that in the control, LPS + DXM, LPS + E2, and LPS + P4 groups (P < 0.05). Compared to the LPS + DXM group, both the LPS + E2 and LPS + P4 groups presented a decreasing trend in p-Akt protein expression, with a significant decrease in the LPS + E2 group (P < 0.05). The decrease in p-Akt protein expression in the LPS + P4 group was not statistically significant (P > 0.05). Compared with the LPS + P4 group, the LPS + E2 group presented a decrease in p-Akt protein, but the difference was not statistically significant (P > 0.05) (Fig. 5 - G and H).
HE staining results
As shown in Figs. 3, 4 and 5, in the control group, the fallopian tube wall mucosa was intact, with a clear structure, smooth lumen, and no accumulation of inflammatory cells. In the LPS group, there was mild inflammation in different areas of the fallopian tube, with slight disorganization and mild expansion of the epithelial and submucosal layers; in the LPS + SHAM group, mucosal shedding was observed. Moreover, in the LPS + OVX group, many neutrophils infiltrated the mucosa and muscle layers, causing flattening and a reduction in the number of mucosal folds accompanied by interstitial fibrosis. In the LPS + OVX + E2 group, the fallopian tube tissue structure in the mice was almost completely intact, with only slight fallopian tube mucosal lesions and a small amount of inflammatory cell infiltration. In the LPS + OVX + P4 group, the pathological changes were significantly ameliorated (Fig. 6).
Fig. 6.
Histopathological changes in the fallopian tube tissues of mice in each group
Immunohistochemistry results
Expression of IL-10
The immunohistochemistry results revealed that the control group had essentially no staining, whereas the number of IL-10-positive cells and brown deposits in the fallopian tubes of the mice in the LPS, LPS + SHAM, and LPS + OVX groups were increased. In contrast, the numbers of IL-10-positive cells and brown deposits decreased in the LPS + OVX + E2 group and the LPS + OVX + P4 group (Fig. 7 - A).
Fig. 7.
Effects of E2 and P4 on the expression of IL-10 and mBD-2 in the fallopian tube tissues of tubal inflammation model mice. A and B: Effects of E2 and P4 on the expression of IL-10 in the fallopian tube tissues of tubal inflammation model mice. C and D: Effects of E2 and P4 on the expression of mBD-2 in the fallopian tube tissues of salpingitis model mice. Note: Compared with the control group, *P < 0.05; compared with the LPS group, #P < 0.05; compared with the LPS + OVX group, +P < 0.05
The total score of IL-10 in the control group of mice was 0.75, that in the LPS group was 6.0, that in the LPS + SHAM group was 7.0, that in the LPS + OVX group was 8.25, that in the LPS + OVX + E2 treatment group was 3.0, and that in the LPS + OVX + P4 group was 6.25.
Compared with that in the control group, the expression of IL-10 in the fallopian tube tissues of the LPS, LPS + SHAM, and LPS + OVX groups was significantly greater (P < 0.05). Compared with that in the LPS + OVX group, the expression of IL-10 in the LPS + OVX + E2 and LPS + OVX + P4 groups was significantly lower (P < 0.05) but still significantly greater than that in the control group (P < 0.05) (Fig. 7 - B).
Expression of the mBD-2 protein
The immunohistochemistry results revealed that the control group had basically no staining, whereas the LPS, LPS + SHAM, and LPS + OVX groups of mice presented many mBD-2-positive cells and brown deposits in the fallopian tubes. The LPS + OVX + E2 group and the LPS + OVX + P4 group had a small number of mBD-2-positive cells and brown deposits (Fig. 7 - C).
The total score of mBD-2 in the control group was 0.35, that in the LPS group was 3.25, that in the LPS + SHAM group was 4.5, that in the LPS + OVX group was 8.0, that in the LPS + OVX + E2 group was 1.5, and that in the LPS + OVX + P4 group was 2.25.
Compared with that in the control group, the protein expression of mBD-2 in the fallopian tube tissue sections was significantly greater in the LPS, LPS + SHAM, and LPS + OVX groups (P < 0.05). Compared with that in the LPS + OVX group, the expression of mBD-2 was significantly lower in the LPS + OVX + E2 group and the LPS + OVX + P4 group after treatment (P < 0.05) but was still significantly greater than that in the control group (P < 0.05) (Fig. 7 - D).
Discussion
Estrogen (E2) and progesterone (P4), key steroid hormones secreted by the ovaries, play indispensable roles in the body, finely regulating a wide range of physiological processes from the development of the reproductive system to maintaining internal homeostasis. Moreover, they exhibit profound effects and show extraordinary potential in preventing and treating various diseases [14]. Previous studies have shown that E2 and P4 are at high physiological concentrations have anti-inflammatory effects [15]. Studies have revealed that there are high concentrations of E2 and P4 in umbilical cord blood, which can effectively inhibit the production of cytokines by cord blood mononuclear cells (CBMCs) and newborn mononuclear cells, similar to the effects of hydrocortisone. The concentration of E2 in umbilical cord blood ranges from 2 µM to 150 µM, and the concentration of P4 in umbilical cord blood ranges from 1 µM to 5 µM [16]. Therefore, the carefully selected concentration ranges of E2 and P4 in this study were based on their inherent biological activity and therapeutic potential.
Under LPS stimulation, the secretion of proinflammatory cytokines increases sharply. Therefore, anti-inflammatory agents are commonly used as treatments [17]. In this study, the effects of E2 and P4 on the expression of IL-1β, TNF-α, IL-10, and mBD-2 in LPS-stimulated fallopian tube epithelial cells, as well as the potential mediation of postinjury salpingitis through the NF-κB, MAPK, and PI3K/Akt pathways, were investigated. LPS upregulated the expression of IL-1β, TNF-α, IL-10, and mBD-2 in fallopian tube epithelial cells, while E2 and P4 dose-dependently downregulated the expression of IL-1β, TNF-α, IL-10, and mBD-2. Furthermore, E2 and P4 inhibited LPS-induced NF-κB pathway activation by reducing IκBα phosphorylation and p65 nuclear translocation. E2 and P4 also decreased the phosphorylation of p38 MAPK in LPS-treated fallopian tube epithelial cells.
Akt is an important target signaling molecule in the downstream signaling pathway of PI3K [18]. The PI3K/Akt pathway has cell type specificity and depends on the stimulus applied [19]. Therefore, PI3K/Akt may exhibit proinflammatory or anti-inflammatory characteristics depending on the context. Research has shown that Akt can phosphorylate IκBα and activate the IKK complex, leading to the translocation of NF-κB from the cytoplasm to the nucleus, thereby regulating the synthesis and release of inflammatory factors [18]. Many studies have explored the therapeutic potential of targeting the NF-κB and MAPK pathways in tubal diseases [20–22]. The PI3K/Akt pathway is involved in multiple pathological conditions associated with epithelial cells, such as epithelial ovarian cancer, mammary epithelial cell inflammation, airway inflammation in asthma models, and airway hyperresponsiveness [23–25]. Moreover, the PI3K/Akt pathway has been shown to regulate the survival of various cells, including epithelial cells [26]. The pathway was also found to regulate epithelial-mesenchymal transition(EMT) [27]. Therefore, the PI3K/Akt signaling pathway may also be involved in the inflammatory response, fibrosis, and development of epithelial ovarian cancer in the fallopian tubes.
In addition, this study established a mouse model of oviduct inflammation. The study revealed that, after the mice in the LPS group were intraperitoneally injected with 50 µL of LPS (1 mg/mL, dissolved in sterile PBS) for 24 h, HE-stained tissue sections from each group were observed to confirm the successful establishment of oviduct inflammation in the mice. Previous studies have reported that E2 can effectively inhibit colon epithelium inflammation and inflammation-related colon tumor formation in mice [28–30].Additionally, P4 can effectively inhibit endometritis in cows and brain inflammation in model mice [31–33]. However, no studies have reported the effects of E2 and P4 in a mouse model of oviduct inflammation.
Interestingly, in this study, E2 and P4 not only reduced the expression of inflammatory factors but also decreased the expression of the anti-inflammatory factor IL-10. In previous studies exploring anti-inflammatory mechanisms, both increases [34–36] and decreases [37] in the levels of anti-inflammatory factors relative to reductions in the levels of inflammatory factors have been reported. On the basis of the results of this study and comparisons with those of previous studies, the significant inhibition of IL-10 by E2 and P4 is likely related to signaling pathways such as the NF-κB pathway and is also associated with feedback stimulation from inflammatory factors and a reduced demand for anti-inflammatory responses due to a weakened inflammatory environment. However, further experiments are needed to confirm these results.
In this study, we comprehensively evaluated the anti-inflammatory effects of E2 and P4 on LPS-induced mouse oviduct inflammation through in vivo and in vitro experiments. In the in vitro experiments, RT‒qPCR analysis revealed that the mRNA expression of IL-1β, TNF-α, IL-10, and mBD-2 was significantly increased in the LPS group, whereas the expression of these inflammatory factors was significantly inhibited in the LPS + E2 and LPS + P4 groups, suggesting that E2 and P4 can significantly suppress the expression of inflammatory factors induced by LPS. The ELISA results revealed that IL-1β levels were significantly elevated in the LPS group but were significantly inhibited in the LPS + E2 and LPS + P4 groups, indicating that E2 and P4 can significantly suppress the release of IL-1β induced by LPS. Western blot analysis revealed that the expression of NF-κB, MAPK, and PI3K/Akt pathway members was upregulated in the LPS group but significantly downregulated in the LPS + E2 and LPS + P4 groups compared with the LPS group, suggesting that E2 and P4 can downregulate inflammatory mediator expression in mouse oviduct epithelial cells induced by LPS by inhibiting the NF-κB, MAPK, and PI3K/Akt pathways. In the in vivo experiments, the HE staining results demonstrated that both E2 and P4 effectively alleviated the pathological damage caused by LPS. Furthermore, immunohistochemical analysis revealed that E2 and P4 significantly downregulated the expression levels of the inflammatory markers IL-10 and mBD-2 during inflammation.
Clinically, menopausal women are more prone to various types of reproductive system inflammation due to a decrease in estrogen levels. Estradiol and progesterone are the two most important hormones among female estrogens and have multiple biological functions. In this study, inflammation in mouse fallopian tube epithelial cells was induced via the use of LPS to simulate the inflammatory response in women’s fallopian tubes. In vivo and in vitro experiments demonstrated that estradiol and progesterone can effectively inhibit LPS-induced inflammatory responses, providing new ideas and methods for clinical treatment and subsequent related experiments.
Conclusion
The results of this study indicate that estrogen and progesterone have a protective effect on LPS-induced mouse salpingitis, which may be attributed to the inhibition of inflammatory responses. The mechanism may be related to the inhibition of the NF-κB, MAPK, and PI3K/Akt signaling pathways and the regulation of the levels of the inflammatory factors IL-1β, TNF-α, IL-10, and mBD-2. On the basis of these experimental results, it is speculated that estrogen and progesterone have certain alleviating effects on inflammation.
Electronic supplementary material
Below is the link to the electronic supplementary material.
Acknowledgements
Not applicable.
Author contributions
Performed research, data collection and analyzed were performed by Qianqian Li and Bayaer Nashun and Sarina Bai and Xiaozhen Guo and Ling Wu. The first draft of the manuscript was written by Jianqi Liu. Tuya Bao critically reviewed and edited the manuscript and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.
Funding
This study was funded by the Inner Mongolia Autonomous Region Health Commission’s 2022 Autonomous Region Health Science and Technology Plan Project (No.202201194) and the Inner Mongolia Medical University General Project (YKD2023MS032) and the Inner Mongolia Natural Science Foundation Project (2022LHMS03001).
Data availability
No datasets were generated or analysed during the current study.
Declarations
Ethics approval and consent to participate
The study involving mouse was conducted in accordance with the revised Animals (Scientific Procedures) Act 1986 in the UK, and approved by the Inner Mongolia Medical University Medical Ethics Committee (No: YKD202403007).
Consent for publication
Not applicable.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Qianqian Li and Jianqi Liu contributed equally to this work.
References
- 1.Infertility Workup for the Women’s Health Specialist. ACOG committee opinion, number 781. Obstet Gynecol. 2019;133(6):e377–84. [DOI] [PubMed] [Google Scholar]
- 2.Zhang C, Liao W, Li W, et al. Human umbilical cord mesenchymal stem cells derived extracellular vesicles alleviate salpingitis by promoting M1-to-M2 transformation. Front Physiol. 2023;14:1131701. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Li Z, Zhang Z, Chen X, et al. Treatment evaluation of Wharton’s jelly-derived mesenchymal stem cells using a chronic salpingitis model: an animal experiment. Volume 8. Stem cell research & therapy; 2017. p. 232. 1. [DOI] [PMC free article] [PubMed]
- 4.Coy P, García-Vázquez FA, Visconti PE et al. Roles of the oviduct in mammalian fertilization. Reproduction (Cambridge, England), 2012, 144(6): 649–660. [DOI] [PMC free article] [PubMed]
- 5.Yang J, Chi C, Liu Z, et al. Ultrastructure damage of oviduct telocytes in rat model of acute salpingitis. J Cell Mol Med. 2015;19(7):1720–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.AbdullGaffar B, Almulla A. Eosinophilic salpingitis. Int J Gynecol Pathology: Official J Int Soc Gynecol Pathologists, 2025. [DOI] [PubMed]
- 7.Barkwill D, Tobler KJ. Salpingitis Isthmica Nodosa [M]. StatPearls. 2025. [PubMed]
- 8.Minoyama H, Hida K, Fujii E, et al. Peritonitis after endometrial cytology in a woman with Hydrosalpinx caused by chronic Chlamydia trachomatis infection. J Med Cases. 2025;16(1):37–42. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Ge W, Duan H, Xiao L, et al. 17β-estradiol protects sheep oviduct epithelial cells against lipopolysaccharide-induced inflammation in vitro. Mol Immunol. 2020;127:21–30. [DOI] [PubMed] [Google Scholar]
- 10.Crane-Godreau MA, Wira CR. Effects of estradiol on lipopolysaccharide and Pam3Cys stimulation of CCL20/macrophage inflammatory protein 3 alpha and tumor necrosis factor alpha production by uterine epithelial cells in culture. Infect Immun. 2005;73(7):4231–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Pfeilschifter J, Köditz R, Pfohl M, et al. Changes in Proinflammatory cytokine activity after menopause. Endocr Rev. 2002;23(1):90–119. [DOI] [PubMed] [Google Scholar]
- 12.Cui L, Wang H, Lin J, et al. Progesterone inhibits inflammatory response in E.coli- or LPS-Stimulated bovine endometrial epithelial cells by NF-κB and MAPK pathways. Dev Comp Immunol. 2020;105:103568. [DOI] [PubMed] [Google Scholar]
- 13.Flores-Espinosa P, Pineda-Torres M, Vega-Sánchez R et al. Progesterone elicits an inhibitory effect upon LPS-induced innate immune response in pre-labor human amniotic epithelium. American journal of reproductive immunology (New York, NY: 1989), 2014, 71(1): 61–72. [DOI] [PubMed]
- 14.Azeez JM, Susmi TR, Remadevi V, et al. New insights into the functions of progesterone receptor (PR) isoforms and progesterone signaling. Am J Cancer Res. 2021;11(11):5214–32. [PMC free article] [PubMed] [Google Scholar]
- 15.Mauvais-Jarvis F, Klein SL, Levin ER, Estradiol. Progesterone, immunomodulation, and COVID-19 outcomes. Endocrinology. 2020;161(9):bqaa127. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Giannoni E, Guignard L, Knaup Reymond M, et al. Estradiol and progesterone strongly inhibit the innate immune response of mononuclear cells in newborns. Infect Immun. 2011;79(7):2690–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Yan P, Liu J, Huang Y, et al. Lotus leaf extract can attenuate salpingitis in laying hens by inhibiting apoptosis. Poult Sci. 2023;102(10):102865. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Lu H, Yao H, Zou R et al. Galangin Suppresses Renal Inflammation via the Inhibition of NF-κB, PI3K/AKT and NLRP3 in Uric Acid Treated NRK-52E Tubular Epithelial Cells. Biomed Res Int, 2019, 2019:3018357. [DOI] [PMC free article] [PubMed]
- 19.Al-Qahtani AA, Pantazi I, Alhamlan FS, et al. SARS-CoV-2 modulates inflammatory responses of alveolar epithelial type II cells via PI3K/AKT pathway. Front Immunol. 2022;13:1020624. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Liu Ling S, Liang Z, Ling-li, et al. Effects of activating blood circulation and dredging blood stasis on the TLR4/MyD88/NF-κB signal pathway in tubal inflammatory infertile rats[J]. China J Traditional Chin Med Pharm. 2022;37(03):1652–5. [Google Scholar]
- 21.Li Su-min, Tong L, Chen F, et al. Exploring the mechanism of Shaofu Zhuyu Decoction in treating tubal infertility based on the P38/MAPK pathway. Acta Chin Med Pharmacol. 2022;50(11):56–9. [Google Scholar]
- 22.Shao L, Yan Y, Wang N, et al. Betulonic acid regulates oviduct epithelial cell inflammation through the TLR4, MAPK, and JAK/STAT signalling pathways. Reprod Fertil Dev. 2023;35(8):480–91. [DOI] [PubMed] [Google Scholar]
- 23.Li B, Xi P, Wang Z, et al. PI3K/Akt/mTOR signaling pathway participates in Streptococcus uberis-induced inflammation in mammary epithelial cells in concert with the classical TLRs/NF-ĸB pathway. Vet Microbiol. 2018;227:103–11. [DOI] [PubMed] [Google Scholar]
- 24.Ma B, Athari SS, Mehrabi Nasab E, et al. PI3K/AKT/mTOR and TLR4/MyD88/NF-κB signaling inhibitors attenuate pathological mechanisms of allergic asthma. Inflammation. 2021;44(5):1895–907. [DOI] [PubMed] [Google Scholar]
- 25.Rinne N, Christie EL, Ardasheva A, et al. Targeting the PI3K/AKT/mTOR pathway in epithelial ovarian cancer, therapeutic treatment options for platinum-resistant ovarian cancer. Cancer Drug Resist. 2021;4(3):573–95. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Jiang K, Cai J, Jiang Q, et al. Interferon-tau protects bovine endometrial epithelial cells against inflammatory injury by regulating the PI3K/AKT/β-catenin/FoxO1 signaling axis. J Dairy Sci. 2024;107(1):555–72. [DOI] [PubMed] [Google Scholar]
- 27.Yang N, Zhang H, Cai X, et al. Epigallocatechin-3-gallate inhibits inflammation and epithelial–mesenchymal transition through the PI3K/AKT pathway via upregulation of PTEN in asthma. Int J Mol Med. 2018;41(2):818–28. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Adachi A, Honda T, Egawa G, et al. Estradiol suppresses psoriatic inflammation in mice by regulating neutrophil and macrophage functions. J Allergy Clin Immunol. 2022;150(4):909–e9198. [DOI] [PubMed] [Google Scholar]
- 29.Armstrong CM, Billimek AR, Allred KF, et al. A novel shift in Estrogen receptor expression occurs as estradiol suppresses inflammation-associated colon tumor formation. Endocrine-related Cancer. 2013;20(4):515–25. [DOI] [PubMed] [Google Scholar]
- 30.Son HJ, Kim N, Song CH, et al. 17β-Estradiol reduces inflammation and modulates antioxidant enzymes in colonic epithelial cells. Korean J Intern Med. 2020;35(2):310–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Cui L, Shao X, Sun W, et al. Anti-inflammatory effects of progesterone through NF-κB and MAPK pathway in lipopolysaccharide- or Escherichia coli-stimulated bovine endometrial stromal cells. PLoS ONE. 2022;17(4):e0266144. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Gutzeit O, Segal L, Korin B, et al. Progesterone attenuates brain inflammatory response and Inflammation-Induced increase in immature myeloid cells in a mouse model. Inflammation. 2021;44(3):956–64. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Hong Y, Liu Y, Zhang G, et al. Progesterone suppresses Aβ(42)-induced neuroinflammation by enhancing autophagy in astrocytes. Int Immunopharmacol. 2018;54:336–43. [DOI] [PubMed] [Google Scholar]
- 34.Cao W, Zhang W, Liu J, et al. Paeoniflorin improves survival in LPS-challenged mice through the suppression of TNF-α and IL-1β release and augmentation of IL-10 production. Int Immunopharmacol. 2011;11(2):172–8. [DOI] [PubMed] [Google Scholar]
- 35.Li H, Chen C, Huang W et al. Long-term expanded hepatic progenitor cells ameliorate D-GalN/LPS-induced acute liver failure through repolarizing M1 macrophage to M2-Like phenotype via activation of the IL-10/JAK2/STAT3 signaling pathway. Int Immunopharmacol, 2024, 142(Pt A): 113127. [DOI] [PubMed]
- 36.Ciesielska A, Hromada-Judycka A, Ziemlińska E, et al. Lysophosphatidic acid up-regulates IL-10 production to inhibit TNF-α synthesis in Mϕs stimulated with LPS. J Leukoc Biol. 2019;106(6):1285–301. [DOI] [PubMed] [Google Scholar]
- 37.Limin L. Study of 17β-estradiol on lipopolysaccharide-induced interleukin-10 production in mouse bone marrow-derived macrophages. China Med Pharm. 2013;3(19):24–6. [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
No datasets were generated or analysed during the current study.