Skip to main content
Cancer Biology & Therapy logoLink to Cancer Biology & Therapy
. 2025 Jul 6;26(1):2529652. doi: 10.1080/15384047.2025.2529652

USP44 promotes chemotherapeutic drug resistance of triple negative breast cancer through EZH2 protein stability

Pu Wu a,b,*, Wanting Xiao c,*, Junjie Ni c, Yuming Lou c, Chaoyang Xu c,
PMCID: PMC12233816  PMID: 40619273

ABSTRACT

Triple negative breast cancer (TNBC), a highly invasive breast cancer, is one of the leading causes of cancer-related mortality worldwide. Although chemotherapy remains the standard of care for TNBC, the development of chemotherapy resistance significantly limits its clinical efficacy. In this study, we identified the deubiquitinating enzyme USP44 as a contributor to chemoresistance in TNBC and investigated the potential regulatory feedback mechanisms involved. In this experimental study, we investigated the sensitivity of TNBC cells MDA-MB-231 and BT-549 to chemotherapy drugs after overexpression and knockdown of USP44 using CCK-8 reagent kit and flow cytometry analysis, respectively. Western blot was performed to evaluate the expression levels of relevant proteins. In vivo xenograft models were established to examine the effects of USP44 and its downstream targets on chemosensitivity. Co-immunoprecipitation assay and ubiquitination assay were conducted to identify interacting proteins and elucidate the underlying molecular mechanisms. Knockdown of USP44 increased the sensitivity of MDA-MB-231 and BT-549 cells to chemotherapeutic agents, accompanied by elevated levels of Cleaved PARP. In contrast, USP44 overexpression reduced drug sensitivity. Mechanistically, USP44 was found to interact with EZH2, preventing its ubiquitination and subsequent proteasomal degradation. Notably, treatment with GSK126, a specific EZH2 inhibitor, reversed the chemoresistance induced by USP44 overexpression. USP44/EZH2 signaling pathway is one of the key to causing the drug resistance of TNBC, warranting further clinical investigation.

KEYWORDS: Triple-negative breast cancer, drug resistance, USP44, EZH2

Introduction

Triple negative breast cancer (TNBC) is a subtype of breast cancer with negative expression of estrogen receptor (ER), progesterone receptor (PR) and human epidermal growth factor receptor 2 (HER2), accounting for 15–20% of breast cancer cases.1,2 TNBC has no effect on endocrine therapy of hormone receptor and targeted therapy of blocking HER2. Compared with other types of breast cancer, TNBC is highly invasive, biologically heterogeneous, and associated with a poor prognosis.3,4 Despite recent advances in targeted therapy and immunotherapy, chemotherapy remains the primary treatment modality for TNBC across all stages.5 However, the development of chemoresistance, coupled with complex biological mechanisms and adverse drug reactions, significantly limit the clinical efficacy of chemotherapy in TNBC.6 Therefore, finding targets and molecular pathways that limit the efficacy of chemotherapy drugs has become a key factor affecting the therapeutic effect of TNBC.

Deubiquitinating enzymes (DUBs) are proteases that act on peptide or isopeptide bonds between ubiquitin molecules or between ubiquitin and the modified protein. Deubiquitination enzymes can be involved in a variety of physiological processes, including cell proliferation, DNA damage repair, chromosome separation, gene expression, immune response, kinase activation, etc.7–10 Based on this, deubiquitination enzymes are considered to be a promising drug target.11 Ubiquitin-specific protease 44 (USP44) is located on human chromosome 12, found early in human embryonic stem cells to regulate the transcriptional activity of downstream genes by modifying histone H2B with deubiquitination, thus achieving the role of regulating cell differentiation.12 Studies suggested that USP44 is a tumor suppressor that regulates the spindle assembly checkpoint protein by deubiquitinating CDC20-MAD2 complex to prevent the premature onset of mitotic postphase.13 It can also prevent chromosome missegregation by adjusting centrosome separation, positioning and spindle geometry, thus inhibiting tumor occurrence and development.14,15 We also reported a review of the physiological and pathological effects of USP44.16 However, the role of USP44 in TNBC chemoresistance remains largely unexplored.

In this study, we found that USP44 can induce resistance of TNBC to chemotherapy drugs (doxorubicin (DOX) and cisplatin (DDP)). This process may be mediated by EZH2 (Enhancer of zeste homolog) and inhibition of EZH2 could restore the sensitivity of USP44 to the drugs. Our findings suggest that targeting the USP44-EZH2 axis may provide a novel therapeutic strategy for overcoming chemoresistance in TNBC.

Materials and methods

Cell culture, transfection, lentivirus infection

Human TNBC cell lines MDA-MB-231 and BT-549 were purchased from Beijing zhongkezhijian Biotechnology Co.Ltd. The authenticity of all cells was verified by short tandem repeat (STR) profiling. BT-549 was cultured in RPMI 1640 medium (bidepharm) supplemented with 10% fetal bovine serum (bidepharm) at 37°C in a humidified atmosphere containing 5% CO2. MDA-MB-231 was the same as above, except for changing the RPMI 1640 medium to DMEM medium with high glucose. PolyJet transfection reagent was used for transient DNA transfections following manufacturer’s protocol (SignaGen). Lentivirus shRNA against USP44 and overexpression of USP44 are packaged by lentiviral plasmids (obtained from Shandong Vigenebio Co., Ltd., Jinan, China). The multiplicity of infection (MOI) value of virus infection is 20 or 30. Purinomycin hydrochloride (2 μg/mL) was used to screen cells that stably expressed USP44. Then, cells were collected for gene expression assays. The sequences are provided as follows:

shRNA: GCCAACTTCACAGTACATTTCTTCAAGAGAGAAATGTACTGTGAAGTTGGCTTTTTT

Cell viability assay

Human TNBC cell lines MDA-MB-231 and BT-549 were seeded onto 96-well plates with 50% confluent cultures. After 24 hours, the cells were treated with a specified concentration of DOX or DDP (MCE, China), with or without GSK126 (MCE, China) for another 48 hours. According to the instructions, the supernatant was discarded and the cell viability was measured with CCK-8 kit (Fdbio science, FD3788). Then, the optical density value reflecting cell viability was measured at 450 nm using an enzyme-linked immunosorbent assay (Synergy HTZX-22; Bio-Tek Instruments, USA).

Wound healing assay

The cells were grown to confluency in a monolayer and were scratched with the pipette tip to create a nicked gap. The monolayer was irrigated twice with PBS and incubated in low-serum(2%) media. The “wounded” area was photographed immediately after wounding and at specified time points afterward (24 h and 48 h), and cell migration was quantified and expressed as the average percentage of closure of the scratched area.17 The quantization formula was as follows: Wound healing rate=(initial wound width−final wound width)/initial wound width × 100%.

Western blot analysis and co-immunoprecipitation assay

After treatment, cells were lysed using RIPA lysis (Beyotime, P0013B) buffer containing 1% PMSF (Beyotime, ST506) at a specified time, total cell proteins were extracted and quantified using BCA reagent kit (Fdbio science, FD2001). Finally, a protein sample was prepared by boiling and denaturing with loading buffer. The protein samples are separated by SDS-PAGE and transferred from the gel to the poly vinylidene fluoride (PDVF). After blocking the membrane with 5% (m/v) skimmed milk in TBST (tris buffered saline containing 0.1% Tween-20) for one hour, the membrane was rinsed with TBST. Then the target band was incubated with the diluted antibody at 4°C overnight, and then incubated with the HRP conjugated second antibody at room temperature for one hour. The band was then observed by chemiluminescence. The antibodies used in this study include mouse anti-human USP44 (Santa cruz, sc -377,203), rabbit anti-human EZH2 (Proteintech 21,800–1-AP) for co-immunoprecipitation and mouse anti-human EZH2 (Abcam, ab283270), rabbit anti-human PARP1(Proteintech 13,371–1-AP), mouse anti human UB (CST, 3936), anti-FLAG tag (sigma, F1084) and rabbit anti-human β- Actin (Abclonal, AC026). All antibodies were blotted in TBST buffer containing 5% bovine serum albumin at the appropriate dilution according to the manufacturer’s protocol. For the co-immunoprecipitation assay, MDA-MB-231 cells were lysed using RIPA and the lysates were pretreated with protein A/G beads (Thermo Fisher Scientific, United States) at 4°C for one hour. The cell lysates were then treated with protein A/G beads containing anti-USP44 (5 µg) or anti-EZH2 (5 µg) antibodies at 4°C overnight. Then, the supernatant was discarded and loading buffer was added to crack the magnetic beads.

LC-MS/MS analysis

TNBC cells were lysed using RIPA and the lysates were pretreated with protein A/G beads at 4 C for one hour. The cell lysates were then treated with protein A/G beads containing anti-USP44 (5 µg) antibodies at 4 C overnight. The supernatant was discarded and loading buffer was added to crack the magnetic beads. 10% SDS-PAGE gel was used to load 100 μg of protein and stained with Coomassie brilliant blue. The proteins in the gel were digested and the polypeptides were extracted for LC-MS/MS analysis. The Mass Spectra were acquired in data-dependent scan mode. Data processing was carried out using Proteome Discoverer (version 2.4, Thermo Scientific) against the human Swissprot protein database (release 2022_01).

Ubiquitination assay

Stable expression of USP44 in TNBC cells were planted in a 10 cm plate with 50% confluent cultures. After 24 h incubation, cells were transfected with pLent-puro-ubiquitin. After continuing to incubate for 48 h, the cells were lyzed with RIPA (medium) lysate and MG132 (MCE) was added 2 hours before this step. The cracking solution contains 1% PMSF and 2% SDS. After sufficient dissolution and centrifugation, boil the supernatant at 95 ℃ for 5 minutes to denature the protein. Co-immunoprecipitation and western blot were performed as described above.

Flow cytometric analysis for cell apoptosis

To evaluate the effects on induction of apoptosis, the cells were examined using the Annexin V-APC/7-AAD Apoptosis Kit (Multi Sciences) according to the manufacturer’s protocols. MDA-MB-231 and BT-549 cells were seeded into six-well plates (50% confluency). The cells were trypsinized, washed with cold PBS, and suspended in 1x binding buffer. Then, the cells were stained using 5 μL of Annexin V-APC and 7 μL of 7-Aminoactinomycin D (7-AAD) and were incubated at 37 C for 30 min in the dark. Finally, the cells were analyzed using BD Accuri C6 Plus flow cytometer.

Animal experiment

Animal experiments are necessary to further verify the findings and improve the research system. BALB/c nude mice (female, 3–5 weeks old) were purchased from Ziyuan Laboratory Animal Technology Co., Ltd. (Hangzhou, China) and were accommodated in an animal facility under proper administration (temperature (22 ± 2 C), humidity (50 ± 5 %) and a 12-h light/dark cycle). To establish 4T1 tumor model, BALB/c nude mice were subjected to subcutaneous inoculation of 4T1 cells (hycyte biology, China) at a concentration of 1 × 106 cells into the flanks. After the tumor volume reached around 100 mm3, all mice were randomly divided into the four groups, each consisting of six mice and were administered by intraperitoneal injection of DOX (3 mg/kg, MCE) and GSK126 (100 mg/kg, Psaitong) alone or in combination every two days for 14 consecutive days. Tumor size was monitored using callipers every 3 days, and the tumor volume was measured the according to the formula (a × b2 ×0.5, a: length, b: width). After 14 days, the mice were euthanized with cervical dislocation, and the xenograft tumors were isolated and weighted. To establish MDA-MB-231 tumor model, BALB/c nude mice were subjected to subcutaneous inoculation of MDA-MB-231 cells with (+) or without (-) USP44 knockdown (shUSP44) at a concentration of 5 × 106 cells into the flanks. After the tumor volume reached around 100 mm3, all mice were randomly divided into the four groups, each consisting of four mice and were administered by intraperitoneal injection of DOX (3 mg/kg) every two days for 14 consecutive days. Tumor size was monitored using callipers every 3 days, and the tumor volume was measured the according to the formula (a × b2 ×0.5, a: length, b: width). After 14 days, the mice were euthanized with cervical dislocation, and the xenograft tumors were isolated and weighted. The study for the animals was approved by the Experimental Animal Welfare and Ethics Committee of Affiliated Jinhua Hospital, Zhejiang University School of Medicine (Approval No. AL-JHYY202408).

Immunohistochemistry (IHC) assay

The paraffin-embedded tissue was cut into 4–5 μm sections, de-paraffinized, and hydrated with ethanol and xylene. The tissues were incubated with H2O2 for 10 min followed by blocking with 5% BSA for 30 minutes. Then the slides were incubated overnight with the corresponding primary antibody at 4°C: anti-H3K27me3 (ABclonal, A22396), Ki-67 (MXB, RMA-0542) and anti-USP44 (Santa cruz, sc -377,203).

Data download

Gene expression data of USP44 in normal and primary tumors from 833 patients was from UALCAN. Overall survival data evaluating the prognostic value of USP44 was from bc-GenExMiner bc-GenExMiner v4.9.

Statistical analysis

Statistical analyses were performed using the GraphPad Prism 8 and SPSS V.25.0 statistical software. The significance of differences between groups was determined using Student’s t-test. Values of p < .05 were considered significantly to refect a statistically difference. For survival analysis, overall survival was estimated using the Kaplan-Meier method. The gray value of the Western Blot data of key proteins in the was determined using Image J.

Results

USP44 expression is not correlated with survival in TNBC

To explore the impact of USP44 on TNBC, we first used the TCGA database to investigate the expression of USP44 in TNBC. The results showed that USP44 expression was significantly reduced in luminal (n = 566), HER2 (n = 37) and TNBC (n = 116) breast cancer compared with normal tissues (n  = 114), and was also reduced in each segment of TNBC. In addition, the USP44 expression levels based on different nodal metastasis status were compared (Figure 1(a)). All results indicated that USP44 was underexpressed in breast cancer. Kaplan – Meier survival analyses are performed with breast cancer Gene-Expression Miner (bc-GenExMiner V4.9., a web-based tool including a MySQL relational database).18 Data evaluation (Figure 1(b)) showed that USP44 had no significant prognostic value for all types of TNBC. Subsequently, we constructed MDA-MB-231 and BT-549 cells with (+) or without (−) USP44 overexpression (OE-USP44) and USP44 knockdown (shUSP44) to further investigate whether USP44 had other effects on TNBC (Figure 1(c)). Wound healing measurements showed that USP44 had no significant effect on the migration of TNBC cells compared to the corresponding untreated control group (Figure 1(d)).

Figure 1.

Figure 1.

Expression of USP44 protein in TNBC and its effect on TNBC prognosis and migration. (a) Expression of USP44 in breast cancer tissues and different TNBC subtypes in TCGA database. (b) Overall survival data evaluating the prognostic value of USP44 in different types of TNBC by bc-GenExMiner v4.9. C1: molecular apocrine tumours (or luminal androgen receptor); C2: basal-like tumours infiltrated by immune suppressive cells and high neurogenesis activity; C3: basal-like tumours triggering an ineffective immune response. (c) Western blot was used to detect the USP44 protein in TNBC cells with stable overexpression (OE-USP44) or knockdown (shUSP44). (d) Wound-healing assays was used to detect the migration ability of TNBC cells with OE-USP44 treatment and controls (NC). The cells were observed and photographed under a microscope at 0, 24, and 48 hours after the scratch, respectively. Percentages of wound healing were calculated (n=3). Boxplots are shown as mean ± SD. ns: non-significant difference, p > .05; *p < .05; **p < .01; ***p < .001.

Inhibition of USP44 promotes sensitivity to chemotherapeutic drugs in TNBC cells

In order to explore whether USP44 has other effects on TNBC, we found that USP44 was closely related to cell stemness,19 while cancer cell stemness has a significant impact on drug resistance. Then, we performed a series of functional experiments to confirm the role of USP44 in chemotherapeutic drugs resistance in TNBC cells. CCK-8 assays revealed that USP44 knockdown significantly increased the sensitivity of MDA-MB-231 and BT-549 cells to DOX (Figure 2(a,c)), as well as to DDP (See Supplementary Information Figure S1). The results of western blot analysis confirmed that inhibiting USP44 could increase the expression of Cleaved PARP in TNBC cells after DOX treatment (Figure 2(b,d)). Next, we used flow cytometry to detect the apoptotic response of USP44 to DOX in TNBC cells. The results showed that USP44 depletion could significantly induce cell apoptosis (See Supplementary Information Figure S2). Also, we constructed cell-derived xenograft models using TNBC cells MDA-MB-231 with or without shUSP44. After treatment with DOX, the tumor growth and Ki67 expression in the shUSP44 group was significantly lower than that of in the control group (See Supplementary Information Figure S3a–e). Overall, the above results remind us that USP44 may be involved in the DOX resistance process of TNBC, and inhibiting USP44 can antagonize the DOX resistance of TNBC cells.

Figure 2.

Figure 2.

Regulation of USP44 drives DOX sensitivity in TNBC cells. TNBC cells with or without OE-USP44 were treated with different concentrations of DOX for 48 hours. Then, (a) cell viability was measured with the CCK-8 kit (n=3). (b) Cleaved PARP protein was detected by western blot in two TNBC cell lines cultured. β-actin was used as the loading control for western blot. Similarly, the same TNBC cells with or without shUSP44 were treated with different concentrations of DOX for 48 hours. Then, (c) cell viability was measured with the CCK-8 kit (n=3). (d) Cleaved PARP protein was detected by western blot in two TNBC cell lines. β-actin was used as the loading control for western blot. Boxplots are shown as mean ± SD. *p < .05; **p < .01; ***p < .001.

USP44 promotes chemotherapeutic drug resistance of TNBC through EZH2 protein stability

To identify potential binding partners of USP44 involved in drug sensitivity regulation, we performed protein mass spectrometry experiments and identified EZH2 as a candidate protein to interact with USP44 (Figure 3(a)).The occurrence and progression of tumors are related to the expression imbalance of oncogenes and tumor suppressor genes, while EZH2 can inhibit the expression and transcription of tumor suppressor genes. EZH2 can control various endogenous and exogenous drug resistance mechanisms in tumor cells. Western Blot shows that the content of EZH2 changed with the change of USP44 (Figure 3(b)). Then we added GSK126 (a EZH2 inhibitor) to TNBC cells that stably expressed USP44 to down-regulate EZH2 expression, and detected changes in cell sensitivity to chemotherapy. Notably, GSK126 treatment reversed the chemoresistance to DOX induced by USP44 overexpression (Figure 3(c)), and similar results were observed with DDP (See Supplementary Information Figure S4). Western Blot experiment also showed that after adding GSK126, the decrease of Cleaved PARP content caused by USP44 overexpression was restored (Figure 3(d)). Taken together, USP44 may exert chemotherapy drug resistance to TNBC through EZH2.

Figure 3.

Figure 3.

USP44 produces chemotherapy resistance to TNBC via EZH2. (a) BT-549 cells with or without OE-USP44 were lysed using RIPA and the lysates were pretreated with protein A/G beads at 4 C for one hour. The cell lysates were then treated with protein A/G beads containing anti-USP44 (5 µg) antibodies at 4 C overnight. Then, the supernatant was discarded and loading buffer was added to crack the magnetic beads. 10% SDS-PAGE gel was used to load 100 μg of protein and stained with Coomassie brilliant blue. Mass spectrometry showed the spectrogram of EZH2 in BT-549 cells pulled down by the USP44 antibody. (b) Expression of EZH2 in TNBC cells with or without OE-USP44/shUSP44 was detected by western blot. C) TNBC cells with OE-USP44 were treated with different concentration of DOX with or without GSK126 (2 μM) for 48 hours. Then, cell viability was measured with the CCK-8 kit (n = 3). (d) Under the same conditions as (c), Cleaved PARP and H3K27ME3 protein was detected by western blot in two TNBC cell lines. β-actin was used as the loading control for western blot. Boxplots are shown as mean ± SD. *p < .05; **p < .01; ***p < .001.

USP44 stabilizes EZH2 protein by impeding ubiquitination

The ubiquitination reaction catalyzed by specific ubiquitinases can effectively mediate target proteins into 26S proteasomes to complete degradation reactions, and has always been considered a key determinant of protein fate.20 We further detected the effect of USP44 on EZH2 protein stability. To this end, we appeared the results of the interaction between USP44 and EZH2 proteins in TNBC (Figure 4(a)). Subsequently, we made further efforts to explore whether USP44 influenced EZH2 expression through the deubiquitination pathway. We treated stable overexpression and knockdown of USP44 in TNBC cell lines with cycloheximide (CHX). The half-life results showed that the level of EZH2 protein in USP44 overexpressing cells was relatively stable, while the decrease in EZH2 protein was faster in USP44 deficient cells (Figure 4(b,c)). To further verify whether the ubiquitin proteasome pathway is involved in the regulation of EZH2 stability by USP44, we used proteasome inhibitor MG132 to treat USP44 deficient cells. The results showed that MG132 treatment successfully restored the previously reduced EZH2 protein abundance due to USP44 deficiency (Figure 4(d)). Meanwhile, the presence of USP44 can weaken the ubiquitination of EZH2 (Figure 4(e)). In summary, these results indicated that USP44 stabilizes EZH2 through deubiquitination enzyme activity.

Figure 4.

Figure 4.

USP44 stabilizes EZH2 through deubiquitinase activity. (a) Extracts from MDA-MB-231 cells were isolated for co-immunoprecipitation using an anti-USP44 antibody or anti-EZH2 antibody. Specifically, MDA-MB-231 cells were lysed using RIPA and the lysates were pretreated with protein A/G beads at 4 C for one hour. The cell lysates were then treated with protein A/G beads containing anti-USP44 (5 µg) or anti-EZH2 (5 µg) antibodies at 4°C overnight. Then, the supernatant was discarded and loading buffer was added to crack the magnetic beads. The interaction of endogenous USP44 and EZH2 was tested. Normal mouse IgG was used as a control. (b) BT-549 cells with or without OE-USP44 were treated with CHX (25 µg/mL) and harvested at the indicated times (0,2,4,8 hours), then protein levels of USP44 amd EZH2 were analyzed by western blot. (c) Similarly, the same BT-549 cells with or without shUSP44 were treated as above, then protein levels of USP44 amd EZH2 were analyzed by western blot. (d) BT-549 cells with or without shUSP44 were treated with or without MG132 (1 μM) for 24 hours. The protein expression levels of USP44 and EZH2 were confirmed followed by western blot. β-actin was used as the loading control. (e) pLent-puro-ubiquitin plasmids was transfected into BT-549 cells with or without OE-USP44. After continuing to incubate for 48 h, the cells were lyzed with RIPA lysate and MG132 (10 μM) was added 2 hours before this step. Then the lysates were pretreated with protein A/G beads at 4 C for one hour. The cell lysates were then treated with protein A/G beads containing anti-EZH2 (5 µg) antibody at 4°C overnight. Then, the supernatant was discarded and loading buffer was added to crack the magnetic beads. USP44 ubiquitination was detected by western blot with anti-UB antibody. The protein expression levels of USP44 and EZH2 in BT-549 cells were confirmed. Boxplots are shown as mean ± SD. *p < .05; **p < .01; ***p < .001.

In vivo validity of targeting EZH2 on the chemotherapeutic efficacy of TNBC

In order to study the regulatory effect of EZH2 on chemotherapy resistance of TNBC in vivo, we established cell-derived xenograft models using murine TNBC cells 4T1 into BALB/C nude mice. After subcutaneous tumor formation, the mice were administered by intraperitoneal injection of DOX (3 mg/kg) and GSK126 (100 mg/kg) alone or in combination every two days for 14 consecutive days (Figure 5(a)). It was found that GSK126 combined with DOX led to significant inhibition of tumor growth compared with that in the control or single drug group (Figure 5(b–d)). Immunohistochemical experiments indicated that GSK126 significantly reduced the expression of H3K27me3 catalyzed by EZH2. Additionally, Ki67 staining showed a significant decrease in the combination drug-treated tumor tissues (Figure 5(e)). In a nutshell, these findings suggest that EZH2 may be an effective therapeutic target for overcoming DOX resistance in TNBC patients (Figure 6).

Figure 5.

Figure 5.

In vivo validity of targeting EZH2 to sensitize TNBC cells to DOX. (a) Nude BALB/C mice were subcutaneously xenografted with 4T1cells (1×106 cells) into the flanks and injected intraperitoneally with DOX (3 mg/kg) and GSK126 (100 mg/kg) alone or in combination every two days for consecutive 14 days. (b) After 14 days, the mice were executed and the xenograft tumors were isolated. (c) Tumor weighing analysis. (d) Tumor growth curves for each group. (e) Representative IHC images showing H3K27me3 and Ki-67 expression in tumors from each group of mice. Boxplots are shown as mean ± SD. *p < .05; **p < .01; ***p < .001.

Figure 6.

Figure 6.

A graphic abstract of USP44-EZH2 axis regulating DOX resistance in TNBC.

Discussion

TNBC is the most aggressive subtype of breast cancer. In the past few decades, despite many advances in the diagnosis and treatment of TNBC, the occurrence of chemotherapy drug resistance still limits the therapeutic effect of TNBC, which is also a key challenge in the current treatment of TNBC.21

The loss of protein homeostasis plays an important role in the progression of diseases such as malignant tumors.22 The abnormality of the ubiquitin proteasome pathway is an important factor leading to the loss of protein homeostasis.23 In this process, the deubiquitinase responsible for removing the ubiquitin chain from the protein substrate is crucial. Due to its abnormal activity or expression, it can lead to functional changes in key carcinogenic/tumor suppressor proteins, directly leading to tumor development and malignant progression. Based on this, small molecule inhibitors targeting ubiquitin have become a hot field of anti-tumor candidate drugs.24 Numerous studies have confirmed that de ubiquitinase USP7,25 USP14,26 USP22,27 USP2828 and others are associated with tumor progression.

USP44 was discovered in early human embryonic stem cells to regulate the transcriptional activity of downstream genes through de ubiquitination modification of histone H2B, thereby achieving a regulatory effect on cell differentiation.29 USP44+ CSC subclones may contribute to the prediction of VM formation and aggressive behavior in breast cancer.30 USP44 hypermethylation promoted proliferation and metastasis of breast cancer cells.31 Although so many struggles have been made to explore the effect of USP44 on breast cancer, their role in TNBC chemotherapy is still unclear. Recently, Wang et al. reported that USP44 can enhance the chemosensitivity of cisplatin in neuroblastoma by stabilizing STUB1.32 Therefore, we intend to explore the role of USP44 in TNBC chemotherapy. In this study, we found that USP44 can promote the resistance of TNBC cells to chemotherapy drugs. Similarly, compared to normal TNBC cells, USP44 can enhance the tolerance to chemotherapy drugs and inhibit their apoptosis, thereby weakening the therapeutic effect of chemotherapy drugs. Also the influence of USP44 on the chemotherapy efficacy of TNBC was confirmed at the in vivo experiments.

At present, epigenetic plasticity and somatic mutations are considered to be two important mechanisms leading to chemotherapy resistance in tumor cells, among which epigenetic modification of histones is one of the important factors causing chemotherapy resistance.33 EZH2 is a histone methyltransferase that can affect the normal physiological function of cells by catalyzing the methylation of histone H3 lysine 27 (H3K27).34 EZH2 is significantly overexpressed in a variety of cancers, including breast cancer and prostate cancer, and a large number of studies have shown that EZH2 is closely related to DNA damage repair and chemotherapy resistance.35–37 In breast cancer, there are also studies suggesting that EZH2 can cause cisplatin resistance in breast cancer through epigenetic inhibition of miR-381 expression.38 And the dual targeting of the PI3K-mTOR pathway leads to the exhaustion of EZH2, thereby overcoming the metastasis and immunotherapy resistance of TNBC.39 In conclusion, H3K27me3 catalyzed by EZH2 is one of the important mechanisms that cause tumor chemoresistance. Given the high expression of EZH2 in breast cancer, targeting EZH2 and its upstream and downstream regulatory pathways may become an effective strategy to reverse chemoresistance in breast cancer. In our study, we identified EZH2 as a leading candidate for the protein interacting with USP44 through mass spectrometry analysis. Using Co-IP experiments, we verified for the first time, to the best of our knowledge, that USP44 interacts with EZH2 in TNBC cells. In vivo experiments have proved that the inhibition of EZH2 can restore the sensitivity of TNBC to DOX. In order to investigate the potential molecular mechanism of USP44 promoting TNBC cell resistance to chemotherapy drugs, we found that USP44 can stabilize the protein level of EHZ2. At the same time, inhibiting EZH2 and reducing H3K27me3 can restore the drug resistance level caused by USP44. Our experimental results also confirmed that after adding the protein synthesis inhibitor CHX, EZH2 decreased more slowly in TNBC cells stably expressed in USP44. After treating USP44 deficient TNBC cells with proteasome inhibitor MG132, we restored the previously suppressed EZH2 protein abundance. The above results indicate that USP44 regulates the sensitivity of TNBC to chemotherapy drugs by stabilizing EZH2 through deubiquitination.

Our research expanded the understanding of the chemotherapy resistance mechanism of TNBC by introducing the USP44-EZH2 axis as a new regulatory module. Although previous studies have mainly focused on EZH2 as a direct therapeutic target, our data suggest that targeting its upstream stabilizer USP44 may be a complementary or synergistic approach. Furthermore, Praja1 is the E3 ubiquitin ligase of EZH2 that was first discovered in breast cancer.40 It can directly ubiquitinate EZH2 and cause its proteasome degradation in MCF7 breast cancer cells. Multiple E3 ubiquitin ligases of EZH2 have also been discovered in breast cancer in recent years.41–43 Given the role of EZH2 in chemotherapy resistance, simultaneously targeting USP44 and its opposite E3 ligases may provide a powerful combination strategy to precisely regulate the homeostasis of the EZH2 protein. Finally, the development of selective USP44 inhibitors remains a challenge, but it may have substantial therapeutic prospects. Our work supports the fundamental principle of pursuing small molecules that disrupt the activity of the USP44 enzyme or its interaction with EZH2, thereby making TNBC tumors sensitive to conventional chemotherapy.

Conclusion

In summary, the present study mainly found that USP44 is related to the chemotherapy resistance of TNBC. We elucidated the mechanism by which USP44 can stabilize EZH2 without being degraded by ubiquitination. Therefore, targeting USP44 is a promising strategy for reversing TNBC inhibition of drug resistance, and more relevant clinical research is needed.

Supplementary Material

Manuscript Clean.docx
Supplementary Materials Clean.docx

Acknowledgments

Chaoyang Xu contributed to the study design and conception. Pu Wu contributed to article writing, data collection, analysis and interpretation. Wanting Xiao, Junjie Ni and Yuming Lou made important revisions to the manuscript. All authors read and approved the final manuscript.

Funding Statement

The work was supported by Jinhua Science and Technology Research Program ([2022-3-073] and [2021-3-084]), Zhejiang Provincial Natural Science Foundation of China [LTGG24H310001], Basic Research Foundation Project of Jinhua Central Hospital [JY2022-6-02] and Zhejiang Provincial Medical and Health Technology Project [2023KY1284].

Data availability statement

The raw data in this study may be obtained from the corresponding author upon reasonable request.

Disclosure statement

No potential conflict of interest was reported by the author(s).

Supplementary material

Supplemental data for this article can be accessed online at https://doi.org/10.1080/15384047.2025.2529652

References

  • 1.Li Y, Zhang H, Merkher Y, Chen L, Liu N, Leonov S, Chen Y.. Recent advances in therapeutic strategies for triple-negative breast cancer. J Hematol Oncol. 2022;15(1):121. doi: 10.1186/s13045-022-01341-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Manjunath M, Choudhary B. Triple-negative breast cancer: a run-through of features, classification and current therapies. Oncol Lett. 2021;22(1):512. doi: 10.3892/ol.2021.12773. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Dees S, Ganesan R, Singh S, Grewal IS. Bispecific antibodies for triple negative breast cancer. Trends Cancer. 2021;7(2):162–15. doi: 10.1016/j.trecan.2020.09.004. [DOI] [PubMed] [Google Scholar]
  • 4.Bianchini G, De Angelis C, Licata L, Gianni L. Treatment landscape of triple-negative breast cancer-expanded options, evolving needs. Nat Rev Clin Oncol. 2022;19(2):91–113. doi: 10.1038/s41571-021-00565-2. [DOI] [PubMed] [Google Scholar]
  • 5.Ou X, Tan Y, Xie J, Yuan J, Deng X, Shao R, Song C, Cao X, Xie X, He R, et al. Methylation of GPRC5A promotes liver metastasis and docetaxel resistance through activating mTOR signaling pathway in triple negative breast cancer. Drug Resist Updat. 2024;73:101063. doi: 10.1016/j.drup.2024.101063. [DOI] [PubMed] [Google Scholar]
  • 6.Liu X, Ma Z, Jing X, Wang G, Zhao L, Zhao X, Zhang Y. The deubiquitinase OTUD5 stabilizes SLC7A11 to promote progression and reduce paclitaxel sensitivity in triple-negative breast cancer. Cancer Lett. 2024;604:217232. doi: 10.1016/j.canlet.2024.217232. [DOI] [PubMed] [Google Scholar]
  • 7.Han F, Qi G, Li R, Peng J, Yan S, Yuan C, Kong B, Ma H. USP28 promotes PARP inhibitor resistance by enhancing SOX9-mediated DNA damage repair in ovarian cancer. Cell Death Dis. 2025;16(1):305. doi: 10.1038/s41419-025-07647-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Qin J, Zhou Z, Chen W, Wang C, Zhang H, Ge G, Shao M, You D, Fan Z, Xia H, et al. BAP1 promotes breast cancer cell proliferation and metastasis by deubiquitinating KLF5. Nat Commun. 2015;6(1):8471. doi: 10.1038/ncomms9471. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Dai P, Sun Y, Huang Z, Liu YT, Gao M, Liu HM, Shi J, He C, Xiang B, Yao Y, et al. USP2 inhibition unleashes CD47-restrained phagocytosis and enhances anti-tumor immunity. Nat Commun. 2025;16(1):4564. doi: 10.1038/s41467-025-59621-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Feng T, Ling S, Xu C, Ying L, Su D, Xu X. Ubiquitin-specific peptidase 22 in cancer. Cancer Lett. 2021;514:30–37. doi: 10.1016/j.canlet.2021.05.004. [DOI] [PubMed] [Google Scholar]
  • 11.Park J, Cho J, Song EJ. Ubiquitin-proteasome system (UPS) as a target for anticancer treatment. Arch Pharm Res. 2020;43(11):1144–1161. doi: 10.1007/s12272-020-01281-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Fuchs G, Shema E, Vesterman R, Kotler E, Wolchinsky Z, Wilder S, Golomb L, Pribluda A, Zhang F, Haj-Yahya M, et al. RNF20 and USP44 regulate stem cell differentiation by modulating H2B monoubiquitylation. Mol Cell. 2012;46(5):662–673. doi: 10.1016/j.molcel.2012.05.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Stegmeier F, Rape M, Draviam VM, Nalepa G, Sowa ME, Ang XL, Mcdonald Iii ER, Li MZ, Hannon GJ, Sorger PK, et al. Anaphase initiation is regulated by antagonistic ubiquitination and deubiquitination activities. Nature. 2007;446(7138):876–881. doi: 10.1038/nature05694. [DOI] [PubMed] [Google Scholar]
  • 14.Huang T, Zhang Q, Ren W, Yan B, Yi L, Tang T, Lin H, Zhang Y. USP44 suppresses proliferation and enhances apoptosis in colorectal cancer cells by inactivating the Wnt/beta-catenin pathway via Axin1 deubiquitination. Cell Biol Int. 2020;44(8):1651–1659. doi: 10.1002/cbin.11358. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Holland AJ, Cleveland DW. The deubiquitinase USP44 is a tumor suppressor that protects against chromosome missegregation. J Clin Invest. 2012;122(12):4325–4328. doi: 10.1172/JCI66420. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Lou Y, Ye M, Xu C, Tao F. Insight into the physiological and pathological roles of USP44, a potential tumor target (Review). Oncol Lett. 2022;24(6):455. doi: 10.3892/ol.2022.13575. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Pastar I, Stojadinovic O, Yin NC, Ramirez H, Nusbaum AG, Sawaya A, Patel SB, Khalid L, Isseroff RR, Tomic-Canic M, et al. Epithelialization in wound healing: a comprehensive review. Adv Wound Care (New Rochelle). 2014;3(7):445–464. doi: 10.1089/wound.2013.0473. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Jézéquel P, Campone M, Gouraud W, Guérin-Charbonnel C, Leux C, Ricolleau G, Campion L. Bc-GenExMiner: an easy-to-use online platform for gene prognostic analyses in breast cancer. Breast Cancer Res Treat. 2012;131(3):765–775. [DOI] [PubMed] [Google Scholar]
  • 19.Tropel P, Jung L, André C, Ndandougou A, Viville S. CpG island methylation correlates with the use of alternative promoters for USP44 gene expression in human pluripotent stem cells and testes. STEM Cells Devel. 2017;26(15):1100–1110. doi: 10.1089/scd.2017.0057. [DOI] [PubMed] [Google Scholar]
  • 20.Deng L, Meng T, Chen L, Wei W, Wang P. The role of ubiquitination in tumorigenesis and targeted drug discovery. Signal Transduct Targeted Ther. 2020;5(1):11. doi: 10.1038/s41392-020-0107-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Obidiro O, Battogtokh G, Akala EO. Triple negative breast cancer treatment options and limitations: future outlook. Pharmaceutics. 2023;15(7):1796. doi: 10.3390/pharmaceutics15071796. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Costa-Mattioli M, Walter P. The integrated stress response: from mechanism to disease. Science. 2020;368(6489). doi: 10.1126/science.aat5314. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Mani A, Gelmann EP. The ubiquitin-proteasome pathway and its role in cancer. J Clin Oncol. 2005;23(21):4776–4789. doi: 10.1200/JCO.2005.05.081. [DOI] [PubMed] [Google Scholar]
  • 24.Harrigan JA, Jacq X, Martin NM, Jackson SP. Deubiquitylating enzymes and drug discovery: emerging opportunities. Nat Rev Drug Discov. 2018;17(1):57–78. doi: 10.1038/nrd.2017.152. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Turnbull AP, Ioannidis S, Krajewski WW, Pinto-Fernandez A, Heride C, Martin ACL, Tonkin LM, Townsend EC, Buker SM, Lancia DR, et al. Molecular basis of USP7 inhibition by selective small-molecule inhibitors. Nature. 2017;550(7677):481–486. doi: 10.1038/nature24451. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Shi D, Wu X, Jian Y, Wang J, Huang C, Mo S, Li Y, Li F, Zhang C, Zhang D, et al. USP14 promotes tryptophan metabolism and immune suppression by stabilizing IDO1 in colorectal cancer. Nat Commun. 2022;13(1):5644. doi: 10.1038/s41467-022-33285-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Ling S, Shan Q, Zhan Q, Ye Q, Liu P, Xu S, He X, Ma J, Xiang J, Jiang G, et al. USP22 promotes hypoxia-induced hepatocellular carcinoma stemness by a HIF1alpha/USP22 positive feedback loop upon TP53 inactivation. Gut. 2020;69(7):1322–1334. doi: 10.1136/gutjnl-2019-319616. [DOI] [PubMed] [Google Scholar]
  • 28.Chen L, Xu Z, Li Q, Feng Q, Zheng C, Du Y, Yuan R, Peng X. USP28 facilitates pancreatic cancer progression through activation of Wnt/beta-catenin pathway via stabilising FOXM1. Cell Death Dis. 2021;12(10):887. doi: 10.1038/s41419-021-04163-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Lan X, Atanassov BS, Li W, Zhang Y, Florens L, Mohan RD, Galardy PJ, Washburn MP, Workman JL, Dent SYR, et al. USP44 is an integral component of N-CoR that contributes to gene repression by deubiquitinating histone H2B. Cell Rep. 2016;17(9):2382–2393. doi: 10.1016/j.celrep.2016.10.076. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Liu T, Sun B, Zhao X, Li Y, Zhao X, Liu Y, Yao Z, Gu Q, Dong X, Shao B, et al. USP44+ cancer stem cell subclones contribute to breast cancer aggressiveness by promoting vasculogenic mimicry. Mol Cancer Ther. 2015;14(9):2121–2131. doi: 10.1158/1535-7163.MCT-15-0114-T. [DOI] [PubMed] [Google Scholar]
  • 31.Chen X, Wu X, Lei W. USP44 hypermethylation promotes cell proliferation and metastasis in breast cancer. Future Oncol. 2021;17(3):279–289. doi: 10.2217/fon-2020-0415. [DOI] [PubMed] [Google Scholar]
  • 32.Zeng L, Li YQ, He SW, Xu H, Zhang R, Chen K, Qin LJ, Zhu XH, Li YL, Li L, et al. The deubiquitinase USP44 enhances cisplatin chemosensitivity through stabilizing STUB1 to promote LRPPRC degradation in neuroblastoma. Neuro Oncol. 2025;27(2):492–507. doi: 10.1093/neuonc/noae175. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Flavahan WA, Gaskell E, Bernstein BE. Epigenetic plasticity and the hallmarks of cancer. Science. 2017;357(6348). doi: 10.1126/science.aal2380. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Duan R, Du W, Guo W. EZH2: a novel target for cancer treatment. J Hematol Oncol. 2020;13(1):104. doi: 10.1186/s13045-020-00937-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Wang J, Wang GG. No easy way out for EZH2: its pleiotropic, noncanonical effects on gene regulation and cellular function. Int J Mol Sci. 2020;21(24):21. doi: 10.3390/ijms21249501. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Zhou L, Mudianto T, Ma X, Riley R, Uppaluri R. Targeting EZH2 enhances antigen presentation, antitumor immunity, and circumvents anti-PD-1 resistance in head and neck cancer. Clin Cancer Res. 2020;26(1):290–300. doi: 10.1158/1078-0432.CCR-19-1351. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Han B, Meng X, Wu P, Li Z, Li S, Zhang Y, Zha C, Ye Q, Jiang C, Cai J, et al. ATRX/EZH2 complex epigenetically regulates FADD/PARP1 axis, contributing to TMZ resistance in glioma. Theranostics. 2020;10(7):3351–3365. doi: 10.7150/thno.41219. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Dou D, Ge X, Wang X, Xu X, Zhang Z, Seng J, Cao Z, Gu Y, Han M. EZH2 contributes to cisplatin resistance in breast cancer by epigenetically suppressing miR-381 expression. Onco Targets Ther. 2019;12:9627–9637. doi: 10.2147/OTT.S214104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Melino M, Tu WJ, Bielefeldt-Ohmann H, Proctor M, Ahuja T, Vandermeide J, Bain AL, Nallan G, Goh SL, Prasanna T, et al. Depleting the action of EZH2 through PI3K-mTOR inhibition to overcome metastasis and immunotherapy resistance in triple-negative breast cancer. Mol Cancer Ther. 2025;10:1535–7163. doi: 10.1158/1535-7163.MCT-24-0693. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Zoabi M, Sadeh R, de Bie P, Marquez VE, Ciechanover A. PRAJA1 is a ubiquitin ligase for the polycomb repressive complex 2 proteins. Biochem Biophys Res Commun. 2011;408(3):393–398. doi: 10.1016/j.bbrc.2011.04.025. [DOI] [PubMed] [Google Scholar]
  • 41.Chang LC, Lin HY, Tsai MT, Chou RH, Lee FY, Teng CM, Hsieh MT, Hung HY, Huang LJ, Yu YL, et al. YC-1 inhibits proliferation of breast cancer cells by down-regulating EZH2 expression via activation of c-Cbl and ERK. Br J Pharmacol. 2014;171(17):4010–4025. doi: 10.1111/bph.12708. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Li Z, Wang D, Lu J, Huang B, Wang Y, Dong M, Fan D, Li H, Gao Y, Hou P, et al. Methylation of EZH2 by PRMT1 regulates its stability and promotes breast cancer metastasis. Cell Death Differ. 2020;27(12):3226–3242. doi: 10.1038/s41418-020-00615-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Wang C, Chen X, Liu X, Lu D, Li S, Qu L, Yin F, Luo H, Zhang Y, Luo Z, et al. Discovery of precision targeting EZH2 degraders for triple-negative breast cancer. Eur J Med Chem. 2022;238:114462. doi: 10.1016/j.ejmech.2022.114462. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Manuscript Clean.docx
Supplementary Materials Clean.docx

Data Availability Statement

The raw data in this study may be obtained from the corresponding author upon reasonable request.


Articles from Cancer Biology & Therapy are provided here courtesy of Taylor & Francis

RESOURCES