Skip to main content
Gut Microbes logoLink to Gut Microbes
. 2025 Jul 2;17(1):2526134. doi: 10.1080/19490976.2025.2526134

The accessory type III secretion system effectors collectively shape intestinal inflammatory infection outcomes

Priyanka Biswas a, Julia Sanchez-Garrido a, Zuzanna Kozik b, Vishwas Mishra a, David Ruano-Gallego a,*, Rita Berkachy a, Sarah Jordan a, Joshua L C Wong a, Jyoti S Choudhary b, Gad Frankel a,
PMCID: PMC12233879  PMID: 40599135

ABSTRACT

Injection of effectors via a type III secretion system (T3SS) is an infection strategy shared by various Gram-negative bacterial pathogens, many infecting mucosal surfaces. While individual T3SS effectors are well characterized, their network-level organization and the distinction between core and accessory effectors remain incompletely understood. Here, by systematically dissecting the T3SS effector network of the enteric mouse pathogen Citrobacter rodentium (CR) we identified a subset of 12 accessory effectors that, while dispensable for colonization, significantly alter infection outcomes. A strain lacking the accessory effectors (CRM12) remained virulent in susceptible mouse hosts yet resulted in reduced epithelial barrier damage, inflammation, and immune cell infiltration in resistant mice. Deep proteomic analysis specifically targeting CR-attached colonic epithelial cells revealed that, despite lacking 39% of its effector repertoire, infection with CRM12 results in similar changes to global protein expression as seen in mice infected with the wild-type strain, though key regulators of barrier integrity were differentially expressed. Using a host with impaired barrier repair (Il22− /− mice), we confirmed that accessory effectors collectively shape infection outcomes without significantly impacting virulence. This study refines the concept of core and accessory effectors, providing a basis for further studies into effector-driven host adaptation.

KEYWORDS: Citrobacter rodentium, Type III secretion system effectors, gut infection, mucosal immune responses, barrier disruption

Introduction

Many Gram-negative bacterial pathogens infecting humans, animals, and plants execute their infection strategies via injection of type III secretion system (T3SS) effectors into the infected eukaryotic cells. The T3SS apparatus and its cognate effectors, which are frequently encoded in pathogenicity islands, prophages and/or plasmids, are found in pathogens like Enteropathogenic Escherichia coli (EPEC), Enterohemorrhagic E. coli (EHEC), Citrobacter rodentium (CR), Salmonella enterica, Shigella spp., Pseudomonas spp., and Yersinia spp.1–3 While the T3SS injectisome is structurally conserved across these pathogens, the number and function of the effectors change dramatically from one pathogen to the other. Moreover, the effector composition varies considerably even among closely related pathotypes. For instance, Salmonella enterica serovar Typhimurium encodes twice as many effectors as S. enterica serovar Typhi,4,5 while clinical EPEC isolates possess between 21 and 40 effectors.6 Despite this variation, EPEC strains induce diarrheal diseases, characterized by effacement of the brush border microvilli, intimate bacterial attachment to the apical surface of intestinal epithelial cells (IECs), and the formation of actin-rich pedestals at the host-pathogen interface.7,8

CR is a mouse-specific pathogen that shares a virulence strategy and effectors with EPEC and EHEC. In resistant mice (e.g., C57BL/6), CR causes a mild self-limiting infection, whereas susceptible mice (e.g., C3H/HeN and C57BL/6 Il22-/-) succumb to the infection.9–14 The CR infection cycle in C57BL/6 mice progresses through four distinct phases: Establishment (1–3 days post-infection [dpi]) – a small proportion of the inoculum colonizes the cecal lymphoid patch. Expansion (4–8 dpi) – CR colonizes and rapidly expands in the distal colon; first signs of histopathological mucosal damage (including disruption of tight junctions) appear, leading to colonic crypt hyperplasia (CCH), group 3 innate lymphoid cells (ILC3) produce IL-22 and IL-22-regulated antimicrobial proteins (e.g. Reg3γ, Reg3β, LCN2) are detected.15 Steady-state (8–13 dpi) – shedding plateaus at approximately 109 colony-forming units (CFUs) per gram of feces (GoF) and IL-17A and IL-22 are secreted from neutrophils and Th17/Th22 cells.14,16,17 In the absence of IL-22 (i.e., infection of Il22-/- mice) CR-infected mice succumb.14,18 Clearance (14–20 dpi) – CD4+ T cells transition from secretion of IL-17A/IL-22 to predominant IFN-γ production,19,20 a shift that appears beneficial to the host as Ifng–/– mice exhibit delayed pathogen clearance,21 CR is cleared via IgG-mediated opsonization and neutrophil-driven phagocytosis, and subsequent bacterial out competition by commensal microbiota.22,23 Infection of C3H/HeN mice follow an accelerated trajectory, progressing rapidly through the initial three phases but failing to enter the clearance phase. Instead, these mice succumb to infection around 10 dpi,10 underscoring the critical role of host factors in determining infection outcomes.24

CR encodes 31 T3SS effectors which induce actin polymerization and changes to the cytoskeleton, subvert immune signaling, and disrupt epithelial barrier integrity.25 While early studies focused on characterizing individual T3SS effectors, they often overlooked the broader network-level interactions that allow pathogens to retain virulence despite effector deletions. Using a systematic sequential effector deletion program, we have recently showed that T3SS effectors function as interdependent networks.26 The effector network concept has later been expanded to S. Typhimurium.27,28 In CR, Tir, EspZ, and NleA are essential effectors, as deletion of any one of them individually rendered CR noninfectious.26 However, a mutant strain encoding an effector network lacking 19 of the 31 effector genes (CR14) maintained colonization, with bacterial shedding above our set threshold of 107 CFU/GoF.26 Similarly, a strain lacking 10 effectors involved in immune subversion (NleB, NleC, NleE, NleD1/2, NleF, NleH, EspJ, EspL, and EspT), designated CRi9, was also shed above the set threshold. To describe scenarios where an effector becomes essential only in a specific perturbed network, we introduced the concept of context-dependent effector essentiality (CDEE).26

Despite significant progress in understanding T3SS effectors in vivo, key questions remain regarding their functional network interactions. It is still unclear what is the role of the accessory effectors, and why seemingly nonessential effectors are evolutionarily maintained. Here, using multiple minimal effector networks, we define a subset of 12 accessory CR effectors that are dispensable for colonization yet shape infection outcomes. By generating a strain lacking these 12 effectors (CRM12), we reveal their role in modulating immune responses, epithelial barrier integrity, and disease severity across host backgrounds. These findings suggest that maintenance of accessory effectors within a network is shaped by host-driven evolutionary pressure and highlight the presence of a core effector network essential for pathogenesis. Our study advances the understanding of T3SS effector network flexibility, revealing how accessory effectors shape infection dynamics. These findings provide broader insights into bacterial adaptation and host-pathogen interactions.

Results

Identification of the accessory CR effectors

To determine the makeup of the accessory effectors within the CR effector network, we generated additional mutants by sequentially deleting effector genes (Figure 1(a)), which were tested for their ability to colonize C57BL/6 mice (Figure 1(b)). Using our set shedding threshold of 107 CFUs/GoF, we generated the effector network CRi17, (an extension of the previously reported CRi926) missing 18 effectors, which reached the robustness limit (i.e. deletion of any of the remaining effector genes resulted in shedding below the threshold). We also generated the network CRP20 lacking 20 effectors, which also reached the robustness limit (Figure 1(c–e)). While a triple nleG mutant (CRΔnleG1/7/8) colonized C57BL/6 mice robustly (Fig. S1A), NleG8, but not NleG1 or NleG7, displayed CDEE in the CRi and CRP network intermediates (Figure 1(c–e)).

Figure 1.

Figure 1.

Generation of minimal effector networks. (a) a schematic illustrating construction of the effector networks using sequential effector deletion. (b) a schematic depicting infection of C57BL/6 mice with CRWT or isogenic mutants. At 8 dpi, infection outcomes were assessed by quantification of CFUs/gof, fecal LCN2 and CCH. (c) CFUs/GoF of the CRi17 and CRP20 intermediates. Results show median from biological replicates (n ≥ 4 mice per group). (d and e) pictorial representations of the effectors deleted in each round of sequential deletion; gray boxes represent CRi9,27 white and black boxes represent that network mutant shedding above or below the threshold, respectively. (f) Temporal fecal bacterial shedding in mice infected with CRWT, CRP20, and CRi17. Lines represent the mean bacterial load with each point representing geometric mean ± geometric S.D. from biological replicates (N ≥ 2). (g) Fecal CRWT shedding 8 days after reinfection of mice pre-infected with CRWT, CRi17 or CRP20. Shown are geometric mean of biological replicates (N ≥ 2). Each data point represents a single mouse. In c, f, and g, limit of detection (LoD) and the colonization threshold are indicated by dotted black lines. For c, statistical significance was determined by nonparametric Kruskal-Wallis test. For F, area under curve was calculated, and statistical significance was determined by one-way ANOVA with Tukey’s multiple comparison test. For g, statistical significance was determined by one-way ANOVA with Tukey’s multiple comparison test. *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001; ns, not significant. Refer to Table S2 for the exact number of mice used for experimental groups.

CRi17 and CRP20 retained 13 and 11 of the 31 CR effectors, respectively. A direct correlation between fecal shedding, fecal LCN2 levels and CCH was observed following infection with the CRi17 and CRP20 intermediates (Fig. S1B-C). CRi17 and CRP20 transitioned through the four infection phases similar to CRWT, with peak shedding at 8 dpi, rapid clearance from 12 dpi, and infection resolution by 22 dpi (Figure 1(f)). Moreover, mice infected with either CRi17 or CRP20 were protected from a secondary challenge with CRWT, suggesting that infection with CRi17 and CRP20 triggered protective immunity (Figure 1(g)).

Comparing the effector network compositions of CRi17, CRP20, and CR1426 revealed the absence of 12 shared effectors – Map, NleD1/NleD2, NleH, NleF, EspJ, NleG1, NleG7, EspV, EspK, NleN, and NleK— (Figure 2(a)). The functions and interacting partners of these effectors are summarized in Table S1 and Figure S1D. To determine the collective impact of these accessory effectors, we generated CRM12, a strain lacking the 12 effector genes (Figure 2(b)). CRM12 maintained robust colonization, which followed a similar infection trajectory as CRWT (Figure 2(c)), and displayed protection against secondary challenge with CRWT (Figure 2(d)).

Figure 2.

Figure 2.

Identification of the accessory effectors. (a) Table (left) and Venn diagram (right) representing effectors present in the CRWT, CR14, CRP20, and CRi17 networks. The essential effectors are shown at the top of the table and center of the Venn diagram. The common effectors EspF, NleG8 and EspM2 are shown in pink. Effectors missing from CR14, CRP20, and CRi17 networks are listed in the light blue box. (b) Pictorial representation of the rounds of sequential deletion toward the generation of CRM12. (c) Temporal fecal bacterial shedding of mice infected with CRWT or CRM12. Lines represent the mean bacterial load with each point representing geometric mean ± geometric S.D. from biological replicates (N = 3). (d) Fecal CRWT shedding 8 days after reinfection of mice pre-infected with CRWT or CRM12. Shown are geometric mean of biological replicates (N ≥ 2). Each data point represents a single mouse. In C and D, LoD and the colonization threshold are indicated by dotted black lines. For C, area under curve was calculated, and statistical significance was determined by two-tailed unpaired t-test. For D, statistical significance was determined by one-way ANOVA with Tukey’s multiple comparison test. **p < 0.01; ns, not significant. Refer to Table S2 for the exact number of mice used for experimental groups.

CRM12 is virulent in a susceptible mouse strain

Given that the accessory effectors are dispensable for colonization in C57BL/6 mice, we next assessed if CRM12 remains virulent in C3H/HeN mice, where CR infection induces severe weight loss, watery diarrhea, dehydration, and colonic barrier damage.10,24,29 100% of CRWT-infected C3H/HeN mice reached the humane endpoint of 15% weight loss and predicted mortality by 10 dpi; in contrast 15/18 (83%) of the mice infected with CRM12 reached the humane endpoint and predicted mortality (Figure 3(a,b)). Both CRWT and CRM12 exhibited comparable bacterial shedding (Figure 3(c)) and induced similar increases in fecal water content compared to uninfected (UI) mice (Figure 3(d)). Necropsy at the humane endpoint revealed that infection with both CRWT and CRM12 induced severe colonic inflammation, characterized by colon shortening, thickening, and an increased weight-to-length ratio (Figure 3(e–g)). Histological analysis of CRM12-infected colons revealed extensive mucosal hyperplasia, dense immune cell infiltration, and submucosal thickening, consistent with colonic pathology observed in CRWT-infected C3H/HeN mice (Figure 3(h,i)). These findings show that while 3/15 C3H/HeN mice survived the infection, CRM12 retains its pathogenic potential in a susceptible mouse strain, confirming the accessory ascription of the 12 effectors.

Figure 3.

Figure 3.

CRM12 is virulent in C3H/HeN mice. C3H/HeN mice were infected with either CRWT or CRM12. (a) Temporal weight loss of mice infected with the indicated strains and UI control and (b) Probability of survival. Data represents mean ± SEM from biological replicates (N = 3). (c) Temporal fecal bacterial shedding. Results show geometric mean ± geometric S.D. from biological replicates (N ≥ 3). The colonization threshold and LoD CFUs/GoF are indicated by dotted lines. (d) Fecal water content at 8 dpi (N = 3). (e) Representative images of distal colons from mice harvested at humane endpoint and UI controls (N ≥ 2). (f) Colon length. (g) Colon weight-to-length ratio. (H) Representative hematoxylin and eosin (H&E)-stained colon sections, and (I) crypt-length measurements (scale bars, 200 μm). For d, f, g and i, each data point represents a single mouse, and results show mean ± S.D. from biological replicates (N ≥ 2). For A and C, area under curve was calculated, and statistical significance was determined by one-way ANOVA with Tukey’s multiple comparison test (for a) two-tailed unpaired t-test (for c). Statistical significance was determined by log-rank (Mantel-Cox) test (for B); and by one-way ANOVA with Tukey’s multiple comparison test (for d, f, g and i). *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001; ns, not significant. Refer to Table S2 for the exact number of mice used for experimental groups.

CRM12 induces lower inflammation in C57BL/6 mice

While CRM12 retained its ability to drive severe disease in a susceptible host, we next investigated infection outcome in resistant C57BL/6 mice. At 8 dpi, mucosal-associated bacterial loads were comparable between CRWT- and CRM12- infected mice (Figure 4(a)), and both strains induced similar increases in fecal water content compared to UI mice (Figure 4(b)), along with similar changes in body weight and similar colon shortening at 4 dpi (Fig. S2A-B). However, colon weight-to-length ratios were significantly lower in CRM12-infected mice compared to CRWT-infected controls at 8 dpi (Figure 4(c)), indicating a reduced inflammatory response.30 Additionally, CRM12 did not induce CCH or expansion of the PCNA-positive zone, indicative of reduced epithelial proliferation,15 and showed a lower histological score than CRWT (Figure 4(d–g), and S2C). In agreement to the role of neutrophils in damage of the intestinal barrier,29 fecal levels of LCN2 and S100A8, antimicrobial proteins mainly expressed by neutrophils, were significantly lower following CRM12 infection (Figure 4(h,i)). These results suggest that despite similar level of attachment to the colonic mucosa, CRM12 infection triggers reduced tissue damage and inflammation.

Figure 4.

Figure 4.

CRM12 induces mild tissue damage in C57BL/6 mice. C57BL/6 mice infected with CRWT or CRM12, and UI controls, were harvested at 8 dpi. (a) Tissue-associated CR (CFUs/cm colon). Results show geometric mean ± geometric S.D. from biological replicates (N = 4). LoD is indicated by dotted black line. (b) Fecal water content. (c) colon weight-to-length ratio. (d) Crypt length measurements and (E) representative H&E-stained colon sections (scale bars, 200 μm) (N = 4). In d, each dot represents the mean per mouse. (f) Representative immunostaining images of colonic sections, and (g) quantification of PCNA staining as a percentage of total crypt length (N = 4). Each dot represents the mean per mouse; CR (green), DAPI (blue), PCNA (red) (scale bars, 100 μm). Fecal (H) LCN2 and (I) S100A8 levels. For a-d, g-i, each data point represents a single mouse, and results show mean ± S.D. from biological replicates (N = 4). Statistical significance was determined by a two-tailed unpaired t-test for A, and one-way ANOVA with Tukey’s multiple comparison test for b-d, and g-i. *p < 0.05; ***p < 0.001; ****p < 0.0001; ns, not significant. Refer to Table S2 for the exact number of mice used for experimental groups.

Compared to CRWT, infection with CRM12 triggered reduced colonic secretion of Th1 and Th17 cytokines IFN-γ, IL-22, IL-17A, and inflammasome-dependent IL-1β, involved in stimulating IL-22 responses,31 correlating with the observed lower tissue damage (Figure 5(a–d)). However, comparable levels of TNF, IL-6, IL-10, CXCL1, CCL3, GM-CSF, and G-CSF were observed upon CRWT and CRM12 infection (Fig. S3A-G). Interestingly, colonic IL-18 levels, an inflammasome-dependent cytokine that can also be released by nonprofessional immune cells like IECs,32 were significantly higher in CRM12-infected mice compared to CRWT-infected mice (Figure 5(e)). Therefore, despite maintaining similar colonization dynamics to CRWT, CRM12 induces significantly lower levels of pro-inflammatory cytokines compared to CRWT infection.

Figure 5.

Figure 5.

CRM12 triggers lower inflammation in C57BL/6 mice. C57BL/6 mice infected with CRWT, or CRM12, and UI controls were harvested at 8 dpi. Mucosal secretion of (a–e) IFN-γ, IL-22, IL-17A, IL-1β, and IL-18 cytokines in colonic explant cultures. Results show mean ± S.D. from biological replicates (N = 4). Total numbers of (f) neutrophils, (h) macrophages, (i) pDcs, (j) cDcs, (k) monocytes, and (l) iMonocytes per 200 μl of colon homogenate. Results show mean ± S.D. from biological replicates (N = 3). (g) Representative immunostaining images of colonic sections showing neutrophil influx to the colonic mucosa (N = 4). The intestinal epithelial cells express E-cadherin (green) and are DAPI+ (blue), whereas neutrophils are Ly6Ghi (violet) and DAPI+, but E-cadherin (scale bars, 50 μm). The upper panel is a merged image of E-cadherin and Ly6G and the lower panel shows merged images of all three channels (DAPI, E-cadherin, and Ly6G). For A-F, and H-L, each data point represents a single mouse; statistical significance was determined by one-way ANOVA with Tukey’s multiple comparison test. *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001; ns, not significant. Refer to Table S2 for the exact number of mice used for experimental groups.

Since CRM12 infection resulted in lower tissue damage and attenuated immune responses, we next examined immune cell recruitment to the colon at the peak of infection. While B cells were recruited at similar levels (Fig. S4A-B), neutrophil and macrophage infiltration was significantly lower following CRM12 infection (Figure 5(f–h), S5A-B). This was validated by Ly6G staining of thin colonic sections, which showed reduced neutrophil accumulation (Figure 5(g)). Additionally, CRM12-infected colons did not trigger expansion of CD4+, CD8+, and total T cells (S4B-F), plasmacytoid dendritic cells (pDCs), conventional dendritic cells (cDCs), monocytes, and inflammatory Ly6C+ monocytes (iMonocytes) which were observed in CRWT infection (Figure 5(i–l), and S6A-C). Together, these findings suggest that while not affecting colonization, the 12 accessory effectors alter infection outcomes, impacting on tissue damage and host immune responses.

CRM12 causes lower epithelial barrier disruption

Given the observed reduction in tissue damage and immune activation in CRM12 infected mice, we next determined whether this phenotype was linked to effector-mediated modulation of colonic IECs (cIECs). To this end, we specifically FACS sorted cIECs colonized by CRM12 and CRWT (EpCAM+/CR+) at 6 dpi (Figure 6(a)). We selected this time point as the expansion phase is associated with T3SS activity and effector translocation.15 Deep quantitative proteomic analysis of EpCAM+/CR+ cIECs was performed (Figure 6(a)) and principal component analysis (PCA) revealed distinct clustering between infected and UI mice (PC1, 80.7% variance), with additional separation between CRWT and CRM12 infection (PC2, 5.5% variance) (Figure 6(b)). We quantified the abundance of 8040 mouse proteins, with hierarchical clustering analysis showing that our biological replicates clustered by treatment (UI vs CRWT vs CRM12) (Figure 6(c)). We recorded no global differences in protein abundances, with only 126 proteins being different between CRWT and CRM12 infection (p < 0.05, |log2FC| > 0.5) (Figure 6(c,d)). This suggests that CRM12 infection largely mirrors CRWT at the cellular level despite lacking ~ 39% of its T3SS effector repertoire, emphasizing the robust nature of the effector network.

Figure 6.

Figure 6.

CRM12 triggers lower epithelial barrier disruption in infected IECs. (a) A schematic illustrating sample preparation leading to proteomics analyses of EpCAM+/CR+ IECs (Bb) PCA of mouse proteins in EpCAM+/CR+ isolated from UI mice and mice infected with CRWT and CRM12 (N = 3). (c) Hierarchical clustering (one minus cosine similarity) of relative abundance of 4197 proteins significantly changing with CRWT and/or CRM12 infection compared to UI. (d) Volcano plot (Log2FC of CRWT vs CRM12) showing significantly (y-axis), and differentially (x-axis) regulated proteins between CRWT and CRM12 infection. (e) Heatmap of selected proteins involved in regulation of barrier integrity. (f) Intestinal permeability was measured at 8 dpi by determining FITC-dextran levels in the serum (N = 4). (g) Representative immunostaining images of colonic sections from N = 4 biological repeats showing epithelial barrier disruption. The intestinal epithelial cells express E-cadherin (green) and are DAPI+ (blue), (scale bars, 100 μm). Panels show E-cadherin and zoomed-in E-cadherin inset, DAPI staining, and merged images of E-cadherin and DAPI, respectively. White arrows indicate erosion of colonic epithelial layer in the E-cadherin staining channel. Extraintestinal dissemination of CRWT or CRM12 to (H) liver, and (I) spleen (N = 2). LoD is indicated by a dotted black line. For F, H and I, each data point represents a single mouse, results show mean ± S.D. from biological replicates. Statistical significance was determined by one-way ANOVA with Tukey’s multiple comparison test for F, and by nonparametric Mann-Whitney test for H and I. **p < 0.01; ***p < 0.001; ns, not significant. Refer to Table S2 for the exact number of mice used for experimental groups.

We focused our pathway analysis on processes that might explain the observed differences in infection outcomes. This revealed that both CRWT and CRM12 inhibited cIEC cell death (apoptotic, pyroptotic and necroptotic) (Fig. S7A). While we detected higher abundance of Fas, the levels of the downstream death adaptor proteins TRADD and FADD, targeted by NleB33 were reduced in cIECs infected with either CRWT or CRM12. In contrast, the abundance of the anti-apoptotic factors BIRC5 and HSP90B was enriched. Consistent with the reduced immune cell infiltration and cytokine secretion, CRM12-infected IECs exhibited lower expression of cytokine-regulated pro-inflammatory and antimicrobial proteins (Fig. S7B). In particular, lower expression of IL-22-regulated proteins S100A9, LCN2, REG3β, SAA4 and IFN-γ-regulated CD74,34 GBP2 and GBP535 was observed in CRM12- compared to CRWT-infected IECs (Figure 6(d), Fig. S7B).

Proteomics analysis was indicative of CRM12 infection resulting in a comparatively milder disruption of barrier function than CRWT (Figure 6(e)). Particularly, CRWT infection was characterized by loss of key structural proteins – CLDN2, CLDN436 and their regulators such as TGM3, & FMO5 involved in mucus barrier formation and stabilization;37,38 SLC26A3, SLC5A6, and SOD3 involved in maintaining the integrity and stability of epithelial tight junction barrier39–43 and an increase in barrier-disrupting factor GABRA3.44 The changes in these markers observed in CRM12-infected cIECs were less dramatic, suggesting reduced barrier disruption (Figure 6(e)). To validate these results, we performed the FITC-dextran intestinal permeability assay.45 This revealed that infection with CRM12 resulted in significantly lower levels of FITC-dextran permeating into the serum compared to those in CRWT-infected mice (Figure 6(f)); moreover, immunofluorescence staining for E-cadherin revealed lower epithelial damage (Figure 6(g), and S8A). Concomitantly, CRM12 infection resulted in lower systemic dissemination to liver and spleen compared to CRWT (Figure 6(h,i)). These results suggest that infection of CRM12 causes less disruption of the cIEC monolayer, which in turn may result in lower IL-22 responses.

CRM12 is virulent in mouse model of impaired intestinal barrier repair

Since the level of barrier disruption and IL-22 differentiates infection with CRWT and CRM12, we investigated infection outcomes in C57BL/6 Il22-/-mice, which have impaired barrier repair mechanisms and succumb to CRWT infection.13,14 Importantly, Il22-/- mice survive infection with a CR strain lacking EspF, which does not disrupt the epithelial barrier.13 We therefore investigated how the barrier disruption caused by CRM12 impacts disease progression in Il22-/- mice.

While 100% of CRWT-infected Il22-/- mice reached the humane endpoint and succumbed to infection, CRM12 infection resulted in a predicted mortality of 67% (Figure 7(a,b)). However, both CRWT and CRM12 exhibited comparable bacterial shedding and induced similar increases in fecal water content (Figure 7(c,d)). Necropsy at the humane endpoint revealed severe colonic inflammation, substantial shortening and thickening of the colon, and an increased colon weight-to-length ratio, indicating that CRM12-infected mice that succumb to infection likely suffer from the same unresolved damage to the barrier as CRWT-infected mice (Figure 7(e–g)). Consistently, histological analysis showed extensive CCH, large immune cell infiltration, and submucosal thickening, confirming severe intestinal pathology (Figure 7(h,i)). Moreover, CRWT and CRM12 infections resulted in comparable systemic dissemination to liver and spleen (Fig. S9A-B). Likewise, both infections triggered splenic inflammation and spleen weight gain, further indicating systemic immune activation (Fig. S9C-D). These findings suggest that CRM12 can induce disease and inflammation when the ability to restore the barrier integrity is compromised.

Figure 7.

Figure 7.

CRM12 infection results in mortality of mice with impaired barrier repair. C57BL/6 Il22-/- mice were infected with either CRWT or CRM12. (a) Temporal weight loss of infected mice and UI control. Data represents mean ± SEM from biological replicates (N = 2). (b) Probability of survival. (c) Temporal fecal bacterial shedding. Results show geometric mean ± geometric S.D. from biological replicates (N = 2). The colonization threshold and LoD are indicated by dotted black lines. (d) Fecal water content at 7 dpi. (e) Representative images of distal colons from mice harvested at humane endpoint and of UI controls (N = 2). (f) Colon length. (g) Colon weight-to-length ratio. (h) Representative H&E-stained colon sections, and (I) crypt-length measurements (scale bars, 200 μm). Each dot represents the mean per mouse. For D, F, G and I, each data point represents a single mouse, and results show mean ± S.D. from biological replicates (N ≥ 2). For a and c, area under curve was calculated, and statistical significance was determined by one-way ANOVA with Tukey’s multiple comparison test (for A) two-tailed unpaired t-test (for c). Statistical significance was determined by log-rank (Mantel-Cox) test (for B); and by one-way ANOVA with Tukey’s multiple comparison test (for D, F, G and I). *p < 0.05; ***p < 0.001; ****p < 0.0001; ns, not significant. Refer to Table S2 for the exact number of mice used for experimental groups.

Discussion

Defining the minimal set of genes required for bacterial survival and pathogenesis has been a central theme in bacterial evolution and pathogen-host interactions.27,28,46–52 In this study, we further demonstrated the flexibility of T3SS effector networks, which challenge the traditional view of a fixed set of essential virulence factors. Instead, our data highlights a modular, adaptable effector network where different effectors assume context-dependent roles.

By generating the minimal effector networks CRP20, CRi17 and CR1426, we uncovered that NleG8 exhibits CDEE. NleG8’s essentiality in specific effector networks may stem from its interaction with GOPC, a regulator of tight junction integrity and mucosal homeostasis, enabling it to modulate host signaling pathways.53 While dispensable in CRWT, NleG8 became critical in CRi17 and CRP20 intermediates, illustrating the compensatory dynamics within the effector network. Moreover, EspF, which exhibited CDEE in the CR14 network,26 also showed essentiality during the construction of CRP20 and CRi17 network. EspF, like the 12-effector network absent in CRM12, plays a pivotal role in disrupting tight junctions, cytoskeletal remodeling, and immune evasion.54 Taken together, these data show that disruption of tight junctions during infection with A/E pathogens is a key trigger of inflammatory responses. Yet, compared to deletion of espF alone,13 deleting the 12 accessory effectors has a milder effect on infection outcomes as was illustrated by infection of Il22-/- mice. Importantly, while EspF seems to play the dominant role in disruption of the epithelial barrier, we see less damage following CRM12 infection comparted to CRWT, even though EspF was maintained in this strain, highlighting the potential hierarchy of effectors in terms of essentiality during infection.

By systematically identifying a subset of effectors dispensable for infection, this study takes a step toward defining the core effector network required for pathogenesis. While the accessory effectors are not essential for colonization, their deletion significantly altered immune responses, and epithelial integrity. The evolutionary persistence of accessory effectors such as Map, NleD, EspJ, NleH, and NleF, also typically found in EPEC and EHEC isolates,8,26,55 suggests that they provide a selective advantage in optimizing pathogen-host interactions and/or dissemination, rather than serving as redundant elements. Proteomic profiling of infected cIECs revealed significant shifts in barrier integrity regulators, which we validated functionally. The increase in IL-18 secretion observed in CRM12-infected mice likely results from the deletion of NleF, which normally suppresses this cytokine’s processing and secretion.56 This increase combined with the lower tissue damage could make CRM12 a good tool to study the effect of local IL-18 responses in colitis, given its role in intestinal tolerance.57 Similarly, the absence of Map in CRM12 may contribute to the observed milder disruption of gut barrier function.58

Despite CRM12’s attenuated immune activation in resistant hosts, it retained pathogenic potential in susceptible models of infection, albeit with lower mortality rates likely ensuing from its reduced tissue damage capability. This adaptability, illustrated by the fact that the remaining 61% of effectors in CRM12 are sufficient to trigger disease, mirrors findings in other pathogens, such as Salmonella Typhimurium, where cooperation between effector genes within a network govern tissue tropism.27

Effector network plasticity is a key determinant of host adaptation, enabling pathogens to exploit novel immune landscapes and establish infection in new hosts.8,26,27,59,60 The variability of T3SS effector repertoires across pathogenic bacteria further illustrates the adaptability of these systems. Human pathogens such as EPEC and EHEC share homologous effectors with CR yet exhibit differences in effector composition, reflecting host- and tissue-specific adaptations. For instance, while effectors like Tir and EspF are conserved and important for host colonization, others are variably present or exhibit mutations that modulate their functionality.55,61 Moreover, clinical isolates of EPEC and EHEC often lack certain effectors or carry nonfunctional alleles yet retain pathogenic potential.8 Notably, NleG, EspM and EspJ, are more commonly found in EPEC and EHEC isolates that are linked to severe human infections.6,8

In conclusion, our study highlights bacterial pathogenesis as a highly adaptable, host-responsive process shaped by a flexible effector network. By identifying a subset of 12 accessory effectors, we refine the framework for distinguishing essential from accessory virulence determinants, establishing a foundation for future research aimed at fully defining the core effector network. Understanding the selective pressures governing effector composition variability may provide insights into host adaptation, pathogen evolution, and effector-driven immune evasion. These findings also have broad implications for developing targeted therapeutics, including effector-based interventions that disrupt virulence pathways at critical regulatory nodes.

Materials & Methods

Strains

The bacterial strains employed in this study are listed in Table S3. The CR strains were grown at 37 °C in Lysogeny broth (LB), or LB agar plates (15% v/v). Nalidixic acid (Nal, 50 μg/ml), streptomycin (Sm, 50 μg/ml), gentamicin (10 μg/ml), kanamycin (Kan, 20 μg/ml) were added for plasmid or strain selection, as required.

Generation of mutants

Escherichia coli CC118-λpir harboring pSEVA612S recombinant plasmid was used for propagation of plasmids. Specific deletion of effector genes via homologous recombination was performed as described in Ruano-Gallego et al. .26 Briefly, 300 base pairs (bp) upstream and downstream flanking region (henceforth named HRΔgene) of the target gene was cloned into pSEVA612S and E. coli CC118-λpir was electroporated with the recombinant plasmid pSEVA612S-HRΔgene to generate the donor strain for conjugation. Genes were deleted via tri-parental conjugation, where the helper strain (E. coli 1047 pRK2013) was incubated with specific donor strain (E. coli CC118-λpir-pSEVA612S HRΔgene) on LB agar at 37 °C, followed by incubation with recipient strain (CR strain carrying pACBSR). Conjugants were selected on LB + Gm + Sm plate. To remove the Gm resistance and for enhanced homologous recombination required for gene deletion, conjugants were grown in LB + Sm + 0.4% L-arabinose for 6–8 h to induce the expression of I-SceI endonuclease from pACBSR and streaked on LB + Sm plates. To remove pACBSR, strains were passaged several times in LB followed by selection of Sm-sensitive bacteria. Deletion mutants were screened by PCR for confirmation of the deletion using Taq 2X Master Mix (NEB) and primers listed in Table S3. All deletion mutants were confirmed by sequencing (Eurofin) (Figure 1(a)).

Mouse experiments

All animal experiments complied with the Animals Scientific Procedures Act 1986 and U.K. Home Office guidelines and were approved by the local ethical review committee. Experiments were designed in agreement with the ARRIVE guidelines62 for the reporting and execution of animal experiments, including sample randomization and blinding. Mouse experiments were conducted with five mice per group. Pathogen-free female 18-20 g C57BL/6 mice and 8–10-week-old C3H/HeN mice were purchased from Charles River Laboratories. C57BL/6 ll22−/− mice were housed and bred in dedicated animal facilities of Imperial College London. All mice were housed in pathogen-free conditions, at 20–22 °C, 30–40% humidity on 12 h of light/dark cycle in high-efficiency particulate air (HEPA)-filtered cages with sterile corn cob bedding, nesting material, and enhancements (chewing toy, and opaque and transparent cylinders), and were fed with RM1 (E) rodent diet (SDS diet) and water ad libitum. All C57BL/6 IL22-/- mice were genotyped and tested for the presence of iCre using multiplex PCR as previously described.19 Primer sequences (5’ to 3’) used: Forward, CAGGCTCTCCTCTCAGTTATCA; Wildtype reverse, TCCTGAAGG CCAAAATAGG; Mutant reverse, CCTCAGGTTCAGCAGGGAAC.

CR infection

Wild type CR (strain ICC169) or its isogenic mutants were grown overnight in LB supplemented with 50 μg/ml nalidixic acid at 37 °C at 180 rpm, were centrifuged at 3000 ×g for 10 min, and resuspended in sterile 1X phosphate buffered saline (PBS). Mice weight were recorded (d0) and they were infected with approximately 3 × 109 CFUs in 200 μl sterile PBS by oral gavage as previously described.63 For mock infection (UI mice), mice received 200 μl sterile PBS. The inocula CFUs were confirmed by CFU quantification as previously described.63 Infections were followed by plating mouse stools at 2–3 dpi onwards on LB + Nal plates as previously described.63 For experiments (Figure 1(f,g); Figure 2(c,d)), mice infection kinetics were followed until total clearance of the bacteria, defined as two consecutive CR negative stool samples; mice were then reinfected with CRWT strain ICC169 to follow bacterial shedding for an additional 8 days.

Fecal water content analysis

To determine the fecal water content, feces were freshly collected in pre-weighed 1.5 mL tubes with punctured cap. The tubes with wet feces were weighed and incubated at 55°C. The tubes were weighed everyday till the weight did not change and were recorded. The wet weight and dry weight of feces was determined by subtracting the weight of the tube and fecal water content was estimated using the following equation:

%watercontent=wetweightdryweightwetweight×100

Postmortem analyses

Mice were monitored for changes in weight every day. Non-susceptible C57BL/6 mice were culled at indicated across various experiments, while susceptible C3H/HeN and immunocompromised Il22-/- C57BL/6 mice were culled at humane endpoint (Humane end point was met when a mouse lost 15% of its d0 body weight). Postmortem, the large intestine of mice consisting of the cecum and colon was excised, laid on a clean surface in parallel to a mm scale to estimate the colon length, and its picture was taken using a digital camera. Colon was removed from cecum, feces removed and weighed using a digital scale. The weight of the colon was normalized to its length and recorded. From the distal side of the colon, 0.5 cm was stored in 4% paraformaldehyde (PFA) used for histological analysis, next 0.5 cm was used for colon explant (described below). For enumeration of tissue-associated bacteria in colons of infected mice, distal colon was excised, longitudinally cut, feces removed with care without affecting the mucus layer, homogenized in sterile PBS using gentleMACS dissociator (Miltenyi Biotec.), and plated on LB + Nal plates. Similarly, to estimate systemic dissemination of CR, the liver and spleen was harvested, weighed, homogenized in sterile PBS, and plated on LB + Nal plates.

Histological analysis and immunostaining

Colonic samples were fixed in 4% PFA for 150 min, followed by immersion in 70% ethanol. The fixed tissues were embedded in paraffin, and sectioned at 5 μm. The sections were then stained either with hematoxylin and eosin (H&E) or processed for immunofluorescence. Crypt hyperplasia was quantified in each mouse by measuring >12 well-oriented crypts. The histological sections were blindly evaluated, and the mean crypt length from each mouse was plotted. For immunofluorescence, sections were dewaxed by immersion in Histoclear solution for 10 min x2, followed by immersion in 100% ethanol, for 10 min x2, 95% ethanol for 3 min x2, 80% ethanol for 3 min, and 1X PBS-0.1% Tween-20–0.1% saponin (PBS-TS), for 3 min x2. The sections were heated for 30 min in 0.3% trisodium citrate-0.05% Tween-20 in distilled H2O (demasking solution). The slides were washed in PBS-TS, followed by blocking in PBS-TS supplemented with 10% normal donkey serum (NDS) for 20 min. The slides were incubated overnight at 4 °C with anti-CR rabbit polyclonal antibody (1:50), mouse anti-PCNA antibody (1:500), anti- E-cadherin (1:50), and/or anti-Ly6G (1:200) antibody. The following day the slides were washed in PBS-TS, 10 min x2, and incubated with the appropriate secondary antibody (1:100) or DAPI (1:1000) to stain DNA (Table S4). The slides were washed and mounted with ProLong Gold antifade mountant. The sections were imaged and analyzed on Zen 2.3 Blue Version (Carl Zeiss Microimaging GmbH, Germany). PCNA measurements were obtained from >10 well-oriented crypts per mouse. PCNA staining was represented as a percentage of the respective crypt length. Colon sections with less than 10 well-oriented crypts observed were excluded from the analysis. E-cadherin staining was quantified by normalizing total E-cadherin intensity to crypt length. The histological sections were scored for four parameters: colonic epithelial damage, immune cell infiltration, sub-mucosal thickening and mucus layer depletion; scores ranged from 1 to 5, wherein 1 scores for a healthy colonic histology.

Extraction of CR-attached/infected cIecs for proteomics

Female, 8–10 weeks old, C57BL/6 were infected with either CRWT or CRM12 (~3 × 109 CFUs). UI mice of same age were used as control. The experiment was performed in biological triplicates. In each experiment, at 6 dpi, cIECs were extracted from five or more well-colonized mice or UI controls, pooled and the further processed. Briefly, after necropsy 2 cm distal colon was excised, sliced open longitudinally, feces removed, placed in 4 ml enterocyte dissociation buffer (1X HBSS without Mg and Ca with 10 mM HEPES, 1 mM EDTA, and 0.5% of β-mercaptoethanol) and incubated at 37 °C with shaking at 180 rpm for 45 min. The remaining tissue was removed. Dissociated cIECs were collected by centrifugation (3000 rpm for 10 min, at RT), washed once with ice-cold 1X PBS (2000 × g for 10 min at 4 °C) and resuspended in Mg and Ca-free Dulbecco’s phosphate buffered saline (DPBS) containing 50 µg/ml DNAse I (Thermo Fisher Scientific) and incubated 10 min at room temperature. cIECs were then passed through 70 μM cell strainer to disrupt the tissue, collected by centrifugation, washed with FACS buffer (DPBS supplemented with 5% fetal bovine serum [FBS] and 2 mM EDTA), and incubated in 10% Fc Block (Miltenyi Biotec) in FACS buffer for 10 min on ice. cIECs were stained by anti-CR rabbit polyclonal antibody (at 1:1000 dilution) for 20 min on ice, followed by two washes in MACS (Magnetic activated cell sorting) buffer (DPBS supplemented with 2 mM EDTA and 5% bovine serum albumin [BSA]; filtered). The cells were resuspended in MACS buffer and incubated with anti-rabbit beads for 15–20 min on ice, followed by two washes in MACS buffer and resuspension in the same. LS column fitted to the magnetic field of MACS separator was activated by passing MACS buffer. Cell suspension was then applied into the column followed by three washes with MACS buffer. Magnetically labeled CR+ IECs were eluted from the LS column in 5 ml MACS buffer. MACS eluate, enriched in CR+ IECs were washed twice in ice-cold PBS, once with FACS buffer, followed by incubation in FACS buffer containing anti-CR rabbit polyclonal antibody (at 1:2000) for 20 min on ice to relabel CR+ IECs. Cells were washed and incubated in FACS buffer with anti-rabbit PE and anti-EpCAM-APC antibodies for 30 min on ice. Cells were washed twice in sorting buffer (DPBS without Mg and Ca, supplemented with 1% FBS and 2 mM EDTA) and resuspended in the same. The sample from UI control was used for gating of CR+ cells. From MACS eluate, EpCAM+/CR+ single cells were sorted, (~[6.1–7.9] x 105 for CRWT and [4.6–6.9] x 105 for CRM12) representing CR-attached/infected IECs. From UI control, ~106 EpCAM+/CR IECs were sorted which was used as a negative control. The sorted cells were collected by centrifugation and stored at −80 °C until proteomics analysis.

Sample preparation and TMT labeling

EpCAM+/CR+ IECs from CRWT or CRM12-infected mice and EpCAM+/CR IECs from UI mice from three biologically repeats were solubilized in lysis buffer (100 mM triethylammonium bicarbonate [TEAB], 1% sodium deoxycholate (SDC), 10% isopropanol, 50 mM NaCl) supplemented with Protease and Phosphatase inhibitor cocktail (Thermo Fisher Scientific), boiled for 5 min, and re-sonicated. Protein concentration was determined with Quick Start™ Bradford protein assay (BioRad) according to the manufacturer’s protocol. 15 μg of protein were reduced in 5 mM Tris 2-carboxyethyl phosphine (TCEP) for 1 h, followed by alkylation with 10 mM iodoacetamide (IAA) for 30 min. The samples were digested with trypsin (Pierce; 75 ng/μl) for 18 h at RT. Peptides were labeled with tandem mass tag 18-plex (TMTpro) multiplex reagent (Thermo Fisher Scientific) following manufacturer’s protocol. SDC was precipitated with formic acid (FA) at final concentration of 2% (v/v) and centrifugation for 5 min at 10,000 rpm. Supernatant containing TMT-labeled peptides was dried.

Mass spectrometry analysis

TMT-labeled peptides were fractionated using Waters XBridge C18 column (2.1 × 150 mm, 3.5 μm) and Dionex ultimate 3000 HPLC system. Mobile phase A consisted of 0.1% ammonium hydroxide; mobile phase B consisted of 100% acetonitrile and 0.1% ammonium hydroxide. Stepwise separation of peptides was achieved with a gradient elution at 200 μl/min: isocratic for 5 min at 5% phase B, gradient for 40 min to 35% phase B, gradient to 80% phase B in 5 min, isocratic for 5 min, and re-equilibrated to 5% phase B. Fractions were gathered in a 96-well plate every 42 sec, dried, and reconstituted in 50 μl 0.1% formic acid. The samples were analyzed on an Orbitrap Ascend mass spectrometer. A Dionex Ultimate 3000 system and mass spectrometer (Thermo Fisher Scientific) were used for data acquisition.

Analysis was performed as previously26 with some modifications. The samples were analyzed using a Real-Time Search-SPS-MS3 method. Ca. 3 µg of peptides/fraction were injected into a C18 column (Acclaim PepMap 100, 100 µm × 2 cm, 5 µm, 100 Å) at a 10 µl/min flow rate. Separation was achieved via a 120-min low-pH gradient on a nanocapillary reversed-phase column (Acclaim PepMap C18, 75 µm × 50 cm, 2 µm, 100 Å) at 50°C. MS1 scans were collected over a 400–1600 m/z range using an Orbitrap at 120,000 resolution, with standard AGC and auto injection time, and included 2–6 precursor charge states. A dynamic exclusion window of 45 sec was applied with a repeat count of 1, mass tolerance of 10 ppm, and isotope exclusion permitted.

MS2 spectra were acquired in the ion trap at a turbo scan rate with HCD collision energy set to 32% and a maximum injection time of 35 ms. These spectra were explored versus the Mus musculus and CR proteomes using the Comet search engine. Static modifications included cysteine carbamidomethylation (+57.0215) and N-terminal/lysine TMTpro (+304.2071), with variable modifications including Asn/Gln deamidation (+0.984) and Met oxidation (+15.9949), allowing up to two variable modifications and a maximum of four peptides per protein. Precursors meeting these parameters were chose for SPS10-MS3 scans, performed at an Orbitrap resolution of 45,000 with normalized HCD collision energy set to 55%, AGC at 200%, and a maximum injection time of 200 ms.

Proteomics data normalization, analysis, and visualization

To compare the results between sample batches, the datasets were normalized in various steps. For mouse proteins, normalization factor for each condition was calculated by the sum of all raw abundances in each TMT channel and dividing it by the maximum sum within given TMT-plex. For proteins with at least 60% of the TMT channels present, the remaining missing values were imputed using the minimum intensity observed within the corresponding TMT batch. To correct for potential batch effects, the data were scaled within each biological group. PCA analysis was performed using log2(scaled abundance) of proteins in the Perseus software version 2.0.11.64 Log2 fold changes (log2FC) were calculated by comparing CR-infected samples to their corresponding UI controls. Differential protein expression between CRWT and CRM12 was assessed using two-sample t-tests (p < 0.05) in Perseus. Two-sample t-tests were also performed for differential protein expression between CRWT and UI, or CRM12 and UI. Proteins were considered significantly up- or down-regulated if they met the statistical threshold (p < 0.05) and a fold-change cutoff (|log2FC| ≥ 0.5). For data visualization, heatmaps and hierarchical clustering, the online Phantasus tool version v1.25.4 was used.65 Volcano graph was prepared using VolcaNoseR online tool.66

Fecal sample ELISA

Fecal samples were weighed, suspended in 1 ml PBS/0.1% Triton X-100 per 100 mg and homogenized for ~15 min. Following brief centrifugation the supernatant was stored at −80 °C. The concentrations of LCN2/NGAL and S100A8 was determined using DuoSet mouse Lipocalin-2 and S100A8 ELISA (R&D systems; Table S4) according to the manufacturer’s recommendations. Colorimetric readings were obtained using a FLUOstar Omega microplate reader (BMG biotech).

Explant cytokines and chemokines

0.5 cm distal colon were weighed, immersed in RPMI medium with 100 μg/ml streptomycin and 100 U/ml penicillin, and incubated for 2 h at RT. The tissue was washed in complete RPMI media (containing 10 mM HEPES, 1 mM sodium pyruvate, 10% FBS and 100 μg/ml streptomycin and 100 U/ml penicillin and was assessed), followed by culturing in the same medium for 24 h at 37 °C, 5% CO2. The supernatant was centrifuged for 20 min at 3000 ×g at RT and stored at −80°C. The level of cytokine and chemokine was determined according to the manufacturer’s protocol. The panel included IL-22, Il-17A, IFN-γ, IL-1β, TNF, IL-18, CXCL1, IL-6, IL-10, CCL3, IL-23, G-CSF, and GM-CSF. Cytokine and chemokine levels were acquired using a FACSCalibur flow cytometer (BD Biosciences). The analysis was done using LEGENDplex data analysis software (BioLegend). Cytokines which showed values below the limit of detection in 90% of the samples were excluded.

Isolation of lamina propria immune cells from mouse colon

Antibodies and blocking agents used for flow cytometry are listed in Table S4.

Lamina propria cells were isolated from mice colons as previously described.67 The 3.5 cm distal colons from infected or UI mice were excised, cleaned, cut opened longitudinally, and then incubated for 20 min at 37 °C in a shaking incubator in 1X HBSS (Ca2+ and Mg2+ free) supplemented with 2% FBS, 10 mM EDTA, and 1 mM DTT. The cell suspension was centrifuged to separate lamina propria from IECs. Supernatants containing IECs were separated, and residual tissues were digested by incubating them at 37 °C for 40–50 min in RPMI 1640 media supplemented with 62.5 μg/ml Liberase, 50 μg/ml DNAse I (Sigma-Aldrich), and 2% FBS, passed through 100 μM cell strainer to obtain single cells.

Flow cytometry

To stain for extracellular markers, single-cell suspensions or stimulated cells were plated in a 96 well V bottomed plate and stained for 10 min with LIVE/DEAD fixable blue (diluted in D-PBS) to detect and exclude dead cells from subsequent analysis. Cells were then treated for 20 min with Fcγ receptor block (BD Biosciences) followed by surface marker staining using fluorophore-conjugated monoclonal antibodies. All incubations were performed at 4°C in the dark unless otherwise stated. Negative (unstained and live/dead) along with fluorescent-minus-one (FMO) controls were considered to estimate background fluorescence. Cells were then washed and fixed for 20 min with using the eBioscience Forkhead box protein 3 (Foxp3)/transcription factor fixation buffer set. Fixed cells were kept in the dark at 4°C until analysis.

Single stain controls for compensation were prepared using UltraComp eBeadsTM Compensation Beads. Cells were then washed prior to flow cytometry analysis on 50,000 live cells on an Aurora flow cytometer (Cytek Biosciences). Flow cytometry data were analyzed using FlowJo software (v10.8.1, Tree Star).

In the CD45+ population of live and single cells, neutrophils were defined as CD11b+ Ly6G+ cells, monocytes as CD11b+ CD11c F4/80 Ly6C or iMonocytes (Ly6C+) cells, macrophages as CD11b+ CD11c+ MHCII+ F4/80+ CD64+, cDCs as CD64 MHCII+ CD11c+ Ly6c, pDCs as CD11b CD11c+ F4/80 Ly6C+ cells, B cells as B220+ CD3, and T cells as B220 CD3+ (either CD4+ or CD8+) (gating strategy shown in Fig. S10).

Statistics

Investigates were designed as randomized block of 4–5 mice per group per experiment; each experiment was repeated at least twice, unless specified. The number of mice used for each experiment is listed in Table S2. Results from all mouse investigations were pooled and analyzed. Flow cytometry data were analyzed using FlowJo software (v10.8.1, Tree Star). Two technical replicates were used for ELISA to determine the experimental mean. Statistical significance between two normally distributed groups was assessed by two-tailed t test; when normality was not achieved, a nonparametric Mann-Whitney test was performed. Statistical significance among three or more groups was assessed by analysis of variance (ANOVA) with indicated posttest. When data was not normally distributed (based on Shapiro-Wilk or Kolmogorov-Smirnov normality tests), a nonparametric test was applied (Kruskal-Wallis test followed by Dunn’s test). False discover rate (FDR; Q = 5%) was used to correct for multiple comparisons (Tukey’s or Sidak’s correction), or as implemented by GraphPad Prism 10.4.0. Data plotting and statistical analysis were performed using Prism 10.4.0 (GraphPad Software Inc.). Statistical details of experiments are described in the figure legends.

Supplementary Material

Table S3.xlsx
Table S4.xlsx
Table S1.docx
Supplementary figures_.pdf
Source data_.xlsx
KGMI_A_2526134_SM8050.xlsx (110.3KB, xlsx)
Table S2.xlsx

Acknowledgments

We thank Prof. Brigitta Stockinger, The Francis Crick Institute, for providing the C57BL/6 Il22-/- mice used to establish the colony at Imperial College London. We thank Jessica Rowley and Larissa Zarate Garcia for their technical assistance with Flow Cytometry.

Funding Statement

The work was supported by Wellcome Trust Investigator Award grants [107057/Z/15/Z] and [224282/Z/21/Z], and Medical Research Council program grant [MR/R02671], and grant [RYC2021-031342-I] funded by MICIU/AEI/10.13039/501100011033 and by European Union Next Generation EU/PRTR.

Disclosure statement

No potential conflict of interest was reported by the author(s).

Data availability statement

Identifier for the PRIDE dataset: PXD062886

Link: https://www.ebi.ac.uk/pride/archive/projects/PXD062886.

The supporting the finding of this study are available as follows:

Table S2: Mice numbers.

Table S3: Bacterial strains, plasmids, and primers.

Table S4: Key resources.

Key resources data: raw measurements shown in all the main and supplementary figures.

Generative artificial intelligence

We declare the usage of Chat GPT-4o model for improving Grammer, readability and clarity of text.

Supplementary material

Supplemental data for this article can be accessed online at https://doi.org/10.1080/19490976.2025.2526134.

References

  • 1.Deng W, Marshall NC, Rowland JL, McCoy JM, Worrall LJ, Santos AS, Strynadka NCJ, Finlay BB.. Assembly, structure, function and regulation of type III secretion systems. Nat Rev Microbiol. 2017;15(6):323–23. doi: 10.1038/nrmicro.2017.20. [DOI] [PubMed] [Google Scholar]
  • 2.Puhar A, Sansonetti PJ.. Type III secretion system. Curr Biol CB. 2014;24(17):R784–R791. doi: 10.1016/j.cub.2014.07.016. [DOI] [PubMed] [Google Scholar]
  • 3.Pinaud L, Sansonetti PJ, Phalipon A. Host cell targeting by enteropathogenic bacteria T3SS effectors. Trends Microbiol. 2018;26(4):266–283. doi: 10.1016/j.tim.2018.01.010. [DOI] [PubMed] [Google Scholar]
  • 4.Jennings E, Thurston TLM, Holden DW. Salmonella SPI-2 type III secretion system effectors: molecular mechanisms and physiological consequences. Cell Host & Microbe. 2017;22(2):217–231. doi: 10.1016/j.chom.2017.07.009. [DOI] [PubMed] [Google Scholar]
  • 5.Johnson R, Mylona E, Frankel G. Typhoidal Salmonella: distinctive virulence factors and pathogenesis. Cellular Microbiol. 2018;20(9):e12939. doi: 10.1111/cmi.12939. [DOI] [PubMed] [Google Scholar]
  • 6.Arbeloa A, Blanco M, Moreira FC, Bulgin R, López C, Dahbi G, Blanco JE, Mora A, Alonso MP, Mamani RC, et al. Distribution of espM and espT among enteropathogenic and enterohaemorrhagic Escherichia coli. J Med Microbiol. 2009;58(8):988–995. doi: 10.1099/jmm.0.010231-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Chen HD, Frankel G. Enteropathogenic Escherichia coli: unravelling pathogenesis. FEMS Microbiol Rev. 2005;29(1):83–98. doi: 10.1016/j.femsre.2004.07.002. [DOI] [PubMed] [Google Scholar]
  • 8.Hazen TH, Donnenberg MS, Panchalingam S, Antonio M, Hossain A, Mandomando I, Ochieng JB, Ramamurthy T, Tamboura B, Qureshi S, et al. Genomic diversity of EPEC associated with clinical presentations of differing severity. Nat Microbiol. 2016;1(2):15014. doi: 10.1038/nmicrobiol.2015.14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Mundy R, Girard F, FitzGerald AJ, Frankel G. Comparison of colonization dynamics and pathology of mice infected with enteropathogenic Escherichia coli, enterohaemorrhagic E. coli and citrobacter rodentium. FEMS Microbiol Lett. 2006;265(1):126–132. doi: 10.1111/j.1574-6968.2006.00481.x. [DOI] [PubMed] [Google Scholar]
  • 10.Carson D, Barry R, Hopkins EGD, Roumeliotis TI, García‐Weber D, Mullineaux‐Sanders C, Elinav E, Arrieumerlou C, Choudhary JS, Frankel G, et al. Citrobacter rodentium induces rapid and unique metabolic and inflammatory responses in mice suffering from severe disease. Cellular Microbiol. 2020;22(1):e13126. doi: 10.1111/cmi.13126. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Papapietro O, Teatero S, Thanabalasuriar A, Yuki KE, Diez E, Zhu L, Kang E, Dhillon S, Muise AM, Durocher Y, et al. R-spondin 2 signalling mediates susceptibility to fatal infectious diarrhoea. Nat Commun. 2013;4(1):1898. doi: 10.1038/ncomms2816. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Mundy R, MacDonald TT, Dougan G, Frankel G, Wiles S. Citrobacter rodentium of mice and man. Cellular Microbiol. 2005;7(12):1697–1706. doi: 10.1111/j.1462-5822.2005.00625.x. [DOI] [PubMed] [Google Scholar]
  • 13.Xia X, Liu Y, Hodgson A, Xu D, Guo W, Yu H, She W, Zhou C, Lan L, Fu K, et al. EspF is crucial for citrobacter rodentium-induced tight junction disruption and lethality in immunocompromised animals. PLOS Pathogens. 2019;15(6):e1007898. doi: 10.1371/journal.ppat.1007898. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Zheng Y, Valdez PA, Danilenko DM, Hu Y, Sa SM, Gong Q, Abbas AR, Modrusan Z, Ghilardi N, de Sauvage FJ, et al. Interleukin-22 mediates early host defense against attaching and effacing bacterial pathogens. Nat Med. 2008;14(3):282–289. doi: 10.1038/nm1720. [DOI] [PubMed] [Google Scholar]
  • 15.Hopkins EGD, Roumeliotis TI, Mullineaux-Sanders C, Choudhary JS, Frankel G, Rappuoli R. Intestinal epithelial cells and the microbiome undergo swift reprogramming at the inception of colonic citrobacter rodentium infection. mBio. 2019;10(2). doi: 10.1128/mBio.00062-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Mullineaux-Sanders C, Sanchez-Garrido J, Hopkins EGD, Shenoy AR, Barry R, Frankel G. Citrobacter rodentium-host-microbiota interactions: immunity, bioenergetics and metabolism. Nat Rev Microbiol. 2019;17(11):701–715. doi: 10.1038/s41579-019-0252-z. [DOI] [PubMed] [Google Scholar]
  • 17.Basu R, O’Quinn D, Silberger D, Schoeb T, Fouser L, Ouyang W, Hatton R, Weaver C. Th22 cells are an important source of IL-22 for host protection against enteropathogenic bacteria. Immunity. 2012;37(6):1061–1075. doi: 10.1016/j.immuni.2012.08.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Frankel G, Mishra V, Biswas P, Wong J, Kozik Z, Choudhary J. Rehydration rescues Il22-/- mice from lethal citrobacter rodentium infection. PREPRINT (Version 1) available at Research Square. 2025. doi: 10.21203/rs.3.rs-6122641/v1. [DOI]
  • 19.Ahlfors H, Morrison PJ, Duarte JH, Li Y, Biro J, Tolaini M, Di Meglio P, Potocnik AJ, Stockinger B. IL-22 fate reporter reveals origin and control of IL-22 production in homeostasis and infection. J Immunol. 2014;193(9):4602–4613. doi: 10.4049/jimmunol.1401244. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Omenetti S, Bussi C, Metidji A, Iseppon A, Lee S, Tolaini M, Li Y, Kelly G, Chakravarty P, Shoaie S, et al. The intestine harbors functionally distinct homeostatic tissue-resident and inflammatory Th17 cells. Immunity. 2019;51(1):77–89.e6. doi: 10.1016/j.immuni.2019.05.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Simmons CP, Goncalves NS, Ghaem-Maghami M, Bajaj-Elliott M, Clare S, Neves B, Frankel G, Dougan G, MacDonald TT. Impaired resistance and enhanced pathology during infection with a noninvasive, attaching-effacing enteric bacterial pathogen, citrobacter rodentium, in mice lacking IL-12 or IFN-gamma. J Immunol. 2002;168(4):1804–1812. doi: 10.4049/jimmunol.168.4.1804. [DOI] [PubMed] [Google Scholar]
  • 22.Kamada N, Kim Y-G, Sham HP, Vallance BA, Puente JL, Martens EC, Núñez G. Regulated virulence controls the ability of a pathogen to compete with the gut microbiota. Science. 2012;336(6086):1325–1329. doi: 10.1126/science.1222195. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Kamada N, Sakamoto K, Seo S-U, Zeng M, Kim Y-G, Cascalho M, Vallance B, Puente J, Núñez G. Humoral immunity in the gut selectively targets phenotypically virulent attaching-and-effacing bacteria for intraluminal elimination. Cell Host & Microbe. 2015;17(5):617–627. doi: 10.1016/j.chom.2015.04.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Sanchez-Garrido J, Baghshomali YN, Kaushal P, Kozik Z, Perry RW, Williams HRT, Choudhary J, Frankel G. Impaired neutrophil migration underpins host susceptibility to infectious colitis. Mucosal Immunol. 2024;17(5):939–957. doi: 10.1016/j.mucimm.2024.06.008. [DOI] [PubMed] [Google Scholar]
  • 25.Sanchez-Garrido J, Ruano-Gallego D, Choudhary JS, Frankel G. The type III secretion system effector network hypothesis. Trends Microbiol. 2022;30(6):524–533. doi: 10.1016/j.tim.2021.10.007. [DOI] [PubMed] [Google Scholar]
  • 26.Ruano-Gallego D, Sanchez-Garrido J, Kozik Z, Núñez-Berrueco E, Cepeda-Molero M, Mullineaux-Sanders C, Naemi Baghshomali Y, Slater SL, Wagner N, Glegola-Madejska I, et al. Type III secretion system effectors form robust and flexible intracellular virulence networks. Science. 2021;371(6534). doi: 10.1126/science.abc9531. [DOI] [PubMed] [Google Scholar]
  • 27.Chen D, Burford WB, Pham G, Zhang L, Alto LT, Ertelt JM, Winter MG, Winter SE, Way SS, Alto NM, et al. Systematic reconstruction of an effector-gene network reveals determinants of salmonella cellular and tissue tropism. Cell Host & Microbe. 2021;29(10):1531–1544 e1539. doi: 10.1016/j.chom.2021.08.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Newson JPM. Salmonella multimutants enable efficient identification of SPI-2 effector protein function in gut inflammation and systemic colonization. bioRxiv. 2024; doi: 10.1101/2024.12.14.628483. [DOI] [Google Scholar]
  • 29.Barry R, Ruano-Gallego D, Radhakrishnan ST, Lovell S, Yu L, Kotik O, Glegola-Madejska I, Tate EW, Choudhary JS, Williams HRT, et al. Faecal neutrophil elastase-antiprotease balance reflects colitis severity. Mucosal Immunol. 2020;13(2):322–333. doi: 10.1038/s41385-019-0235-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Kim SH, Kwon D, Son SW, Jeong TB, Lee S, Kwak J-H, Cho J-Y, Hwang DY, Seo M-S, Kim KS, et al. Inflammatory responses of C57BL/6NKorl mice to dextran sulfate sodium-induced colitis: comparison between three C57BL/6 N sub-strains. Lab Anim Res. 2021;37(8). doi: 10.1186/s42826-021-00084-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Seo SU, Kuffa P, Kitamoto S, Nagao-Kitamoto H, Rousseau J, Kim Y-G, Núñez G, Kamada N. Intestinal macrophages arising from CCR2(+) monocytes control pathogen infection by activating innate lymphoid cells. Nat Commun. 2015;6(1):8010. doi: 10.1038/ncomms9010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Harrison OJ, Srinivasan N, Pott J, Schiering C, Krausgruber T, Ilott NE, Maloy KJ. Epithelial-derived IL-18 regulates Th17 cell differentiation and Foxp3(+) Treg cell function in the intestine. Mucosal Immunol. 2015;8(6):1226–1236. doi: 10.1038/mi.2015.13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Pearson JS, Giogha C, Ong SY, Kennedy CL, Kelly M, Robinson KS, Lung TWF, Mansell A, Riedmaier P, Oates CVL, et al. A type III effector antagonizes death receptor signalling during bacterial gut infection. Nature. 2013;501(7466):247–251. doi: 10.1038/nature12524. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Muzaki AR, Tetlak P, Sheng J, Loh SC, Setiagani YA, Poidinger M, Zolezzi F, Karjalainen K, Ruedl C. Intestinal CD103(+)CD11b(-) dendritic cells restrain colitis via IFN-gamma-induced anti-inflammatory response in epithelial cells. Mucosal Immunol. 2016;9(2):336–351. doi: 10.1038/mi.2015.64. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Huang S, Meng Q, Maminska A, MacMicking JD. Cell-autonomous immunity by IFN-induced GBPs in animals and plants. Curr Opin Immunol. 2019;60:71–80. doi: 10.1016/j.coi.2019.04.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Guttman JA, Li Y, Wickham ME, Deng W, Vogl AW, Finlay BB. Attaching and effacing pathogen-induced tight junction disruption in vivo. Cellular Microbiol. 2006;8(4):634–645. doi: 10.1111/j.1462-5822.2005.00656.x. [DOI] [PubMed] [Google Scholar]
  • 37.Sharpen JDA, Dolan B, Nyström EEL, Birchenough GMH, Arike L, Martinez-Abad B, Johansson MEV, Hansson GC, Recktenwald CV. Transglutaminase 3 crosslinks the secreted gel-forming mucus component mucin-2 and stabilizes the colonic mucus layer. Nat Commun. 2022;13(1):45. doi: 10.1038/s41467-021-27743-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Schaller ML. Fmo5 plays a sex-specific role in goblet cell maturation and mucus barrier formation. bioRxiv. 2024; doi: 10.1101/2024.04.05.588360. [DOI] [PubMed] [Google Scholar]
  • 39.Yang Y, Miao J, Du J, Xu S, Zhang K, Wu T, Tao C, Wang Y, Fang M, Yang S, et al. Deficiency of SLC26A3 promotes jejunal barrier damage in metabolic disease-susceptible transgenic pigs. Int J Biol Macromol. 2024;281:136245. doi: 10.1016/j.ijbiomac.2024.136245. [DOI] [PubMed] [Google Scholar]
  • 40.Kumar A, Priyamvada S, Ge Y, Jayawardena D, Singhal M, Anbazhagan AN, Chatterjee I, Dayal A, Patel M, Zadeh K, et al. A novel role of SLC26A3 in the maintenance of intestinal epithelial barrier integrity. Gastroenterology. 2021;160(4):1240–1255.e3. doi: 10.1053/j.gastro.2020.11.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Ding X, Li D, Li M, Wang H, He Q, Wang Y, Yu H, Tian D, Yu Q. SLC26A3 (DRA) prevents TNF-alpha-induced barrier dysfunction and dextran sulfate sodium-induced acute colitis. Lab Investigation. 2018;98(4):462–476. doi: 10.1038/s41374-017-0005-4. [DOI] [PubMed] [Google Scholar]
  • 42.Sabui S, Bohl JA, Kapadia R, Cogburn K, Ghosal A, Lambrecht NW, Said HM. Role of the sodium-dependent multivitamin transporter (SMVT) in the maintenance of intestinal mucosal integrity. Am J Physiol Gastro Liver Physiol. 2016;311(3):G561–G570. doi: 10.1152/ajpgi.00240.2016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Tak LJ, Kim H-Y, Ham W-K, Agrahari G, Seo Y, Yang JW, An E-J, Bang CH, Lee MJ, Kim H-S, et al. Superoxide dismutase 3-transduced mesenchymal stem cells preserve epithelial tight junction barrier in murine colitis and attenuate inflammatory damage in epithelial organoids. Int J Mol Sci. 2021;22(12):6431. doi: 10.3390/ijms22126431. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Seifi M, Rodaway S, Rudolph U, Swinny JD. GABA(A) receptor subtypes regulate stress-induced colon inflammation in mice. Gastroenterology. 2018;155(3):852–864.e3. doi: 10.1053/j.gastro.2018.05.033. [DOI] [PubMed] [Google Scholar]
  • 45.Gerkins C, Hajjar R, Oliero M, Santos MM. Assessment of gut barrier integrity in mice using fluorescein-isothiocyanate-labeled dextran. J Visualized Experiments: Jove. 2022;(189). doi: 10.3791/64710. [DOI] [PubMed] [Google Scholar]
  • 46.Hutchison CA, Chuang R-Y, Noskov VN, Assad-Garcia N, Deerinck TJ, Ellisman MH, Gill J, Kannan K, Karas BJ, Ma L, et al. Design and synthesis of a minimal bacterial genome. Science. 2016;351(6280):aad6253. doi: 10.1126/science.aad6253. [DOI] [PubMed] [Google Scholar]
  • 47.McCutcheon JP, Moran NA. Extreme genome reduction in symbiotic bacteria. Nat Rev Microbiol. 2011;10(1):13–26. doi: 10.1038/nrmicro2670. [DOI] [PubMed] [Google Scholar]
  • 48.Maniloff J. The minimal cell genome: “on being the right size”. Proc Natl Acad Sci USA. 1996;93(19):10004–10006. doi: 10.1073/pnas.93.19.10004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Moran NA, Bennett GM. The tiniest tiny genomes. Annu Rev Microbiol. 2014;68(1):195–215. doi: 10.1146/annurev-micro-091213-112901. [DOI] [PubMed] [Google Scholar]
  • 50.Bittencourt DMC, Brown DM, Assad-Garcia N, Romero MR, Sun L, Palhares de Melo LAM, Freire M, Glass JI. Minimal bacterial cell JCVI-syn3B as a chassis to investigate interactions between bacteria and mammalian cells. ACS Synth Biol. 2024;13(4):1128–1141. doi: 10.1021/acssynbio.3c00513. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Raghunathan A, Reed J, Shin S, Palsson B, Daefler S. Constraint-based analysis of metabolic capacity of salmonella typhimurium during host-pathogen interaction. BMC Syst Biol. 2009;3(38). doi: 10.1186/1752-0509-3-38. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Reed P, Atilano ML, Alves R, Hoiczyk E, Sher X, Reichmann NT, Pereira PM, Roemer T, Filipe SR, Pereira-Leal JB, et al. Staphylococcus aureus survives with a minimal peptidoglycan synthesis machine but sacrifices virulence and antibiotic resistance. PLOS Pathogens. 2015;11(5):e1004891. doi: 10.1371/journal.ppat.1004891. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Popov G, Fiebig-Comyn A, Syriste L, Little DJ, Skarina T, Stogios PJ, Birstonas S, Coombes BK, Savchenko A. Distinct molecular features of NleG type 3 secreted effectors allow for different roles during citrobacter rodentium infection in mice. Infect Immun. 2023;91(1):e0050522. doi: 10.1128/iai.00505-22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Hua Y, Yan K, Wan C. Clever cooperation: interactions between EspF and Host proteins. Front Microbiol. 2018;9:2831. doi: 10.3389/fmicb.2018.02831. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Shenoy AR, Furniss RCD, Goddard PJ, Clements A. Modulation of host cell processes by T3SS effectors. Curr Top Microbiol Immunol. 2018;416:73–115. doi: 10.1007/82_2018_106. [DOI] [PubMed] [Google Scholar]
  • 56.Pallett MA, Crepin VF, Serafini N, Habibzay M, Kotik O, Sanchez-Garrido J, Di Santo JP, Shenoy AR, Berger CN, Frankel G, et al. Bacterial virulence factor inhibits caspase-4/11 activation in intestinal epithelial cells. Mucosal Immunol. 2017;10(3):602–612. doi: 10.1038/mi.2016.77. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Mertens RT, Misra A, Xiao P, Baek S, Rone JM, Mangani D, Sivanathan KN, Arojojoye AS, Awuah SG, Lee I, et al. A metabolic switch orchestrated by IL-18 and the cyclic dinucleotide cGAMP programs intestinal tolerance. Immunity. 2024;57(9):2077–2094.e12. doi: 10.1016/j.immuni.2024.06.001. [DOI] [PubMed] [Google Scholar]
  • 58.Ma C, Wickham ME, Guttman JA, Deng W, Walker J, Madsen KL, Jacobson K, Vogl WA, Finlay BB, Vallance BA, et al. Citrobacter rodentium infection causes both mitochondrial dysfunction and intestinal epithelial barrier disruption in vivo: role of mitochondrial associated protein (Map). Cellular Microbiol. 2006;8(10):1669–1686. doi: 10.1111/j.1462-5822.2006.00741.x. [DOI] [PubMed] [Google Scholar]
  • 59.Donnenberg MS, Hazen TH, Farag TH, Panchalingam S, Antonio M, Hossain A, Mandomando I, Ochieng JB, Ramamurthy T, Tamboura B, et al. Bacterial factors associated with lethal outcome of enteropathogenic Escherichia coli infection: genomic case-control studies. PLOS Neglected Trop Dis. 2015;9(5):e0003791. doi: 10.1371/journal.pntd.0003791. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Xu Y. High prevalence of virulence genes in specific genotypes of atypical enteropathogenic Escherichia coli. Front Cell Infect Microbiol. 2017;7:109. doi: 10.3389/fcimb.2017.00109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Petty NK, Bulgin R, Crepin VF, Cerdeño-Tárraga AM, Schroeder GN, Quail MA, Lennard N, Corton C, Barron A, Clark L, et al. The citrobacter rodentium genome sequence reveals convergent evolution with human pathogenic Escherichia coli. J Bacteriol. 2010;192(2):525–538. doi: 10.1128/JB.01144-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Kilkenny C, Browne WJ, Cuthill IC, Emerson M, Altman DG. Improving bioscience research reporting: the ARRIVE guidelines for reporting animal research. PLOS Biol. 2010;8(6):e1000412. doi: 10.1371/journal.pbio.1000412. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Crepin VF, Collins JW, Habibzay M, Frankel G. Citrobacter rodentium mouse model of bacterial infection. Nat Protoc. 2016;11(10):1851–1876. doi: 10.1038/nprot.2016.100. [DOI] [PubMed] [Google Scholar]
  • 64.Tyanova S, Temu T, Sinitcyn P, Carlson A, Hein MY, Geiger T, Mann M, Cox J. The Perseus computational platform for comprehensive analysis of (prote)omics data. Nat Methods. 2016;13(9):731–740. doi: 10.1038/nmeth.3901. [DOI] [PubMed] [Google Scholar]
  • 65.Kleverov M, Zenkova D, Kamenev V, Sablina M, Artyomov MN, Sergushichev AA. Phantasus, a web application for visual and interactive gene expression analysis. Elife. 2024;13. doi: 10.7554/eLife.85722. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Goedhart J, Luijsterburg MS. VolcaNoseR is a web app for creating, exploring, labeling and sharing volcano plots. Sci Rep. 2020;10(1):20560. doi: 10.1038/s41598-020-76603-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Kim E, Tran M, Sun Y, Huh JR. Isolation and analyses of lamina propria lymphocytes from mouse intestines. STAR Protoc. 2022;3(2):101366. doi: 10.1016/j.xpro.2022.101366. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Table S3.xlsx
Table S4.xlsx
Table S1.docx
Supplementary figures_.pdf
Source data_.xlsx
KGMI_A_2526134_SM8050.xlsx (110.3KB, xlsx)
Table S2.xlsx

Data Availability Statement

Identifier for the PRIDE dataset: PXD062886

Link: https://www.ebi.ac.uk/pride/archive/projects/PXD062886.

The supporting the finding of this study are available as follows:

Table S2: Mice numbers.

Table S3: Bacterial strains, plasmids, and primers.

Table S4: Key resources.

Key resources data: raw measurements shown in all the main and supplementary figures.


Articles from Gut Microbes are provided here courtesy of Taylor & Francis

RESOURCES