Skip to main content
NCBI home page

This is a preprint.

It has not yet been peer reviewed by a journal.

The National Library of Medicine is running a pilot to include preprints that result from research funded by NIH in PMC and PubMed.

bioRxiv logoLink to bioRxiv
[Preprint]. 2025 Jun 12:2025.06.09.658633. [Version 1] doi: 10.1101/2025.06.09.658633

NDR kinase SAX-1 controls dendrite branch-specific elimination during neuronal remodeling in C. elegans

Paola V Figueroa-Delgado 1, Shaul Yogev 1,2,*
PMCID: PMC12259037  PMID: 40661618

Abstract

Neuronal remodeling is crucial for proper nervous system development and function, and can be initiated by developmental programs, activity-dependent mechanisms, or stress. Despite significant advances, the underlying mechanisms that govern this process remain poorly understood. Here, we adapted C. elegans IL2 sensory dendrites as a model system to study developmental and stress-mediated dendrite pruning. Upon entering a stress-induced developmental diapause, IL2 dendrites grow a complex dendritic arbor, which is later pruned when reproductive development resumes. We identified unexpected specificity in the pruning process, with distinct genetic requirements to direct branch-specific elimination of secondary, tertiary, and quaternary branches. The serine/threonine kinase SAX-1/NDR promotes elimination of secondary and tertiary, but not quaternary, dendrites. SAX-1 functions with its conserved interactors SAX-2/Furry and MOB-2 in the removal of both dendritic branches. The guanine-nucleotide exchange factor RABI-1/Rabin8 and the small GTPase RAB-11.2 mediate the elimination of secondary branches with SAX-1, but their effect on tertiary branches is minimal. Consistent with the known roles of RABI-1 and RAB-11.2 in regulating membrane dynamics, we find that SAX-1 promotes endocytosis during remodeling. Together, our findings reveal distinct mechanisms for branch-specific elimination under stress-induced and developmentally regulated neuronal remodeling.

Keywords: neuronal remodeling, dendrite pruning, dauer, SAX-1/NDR, SAX-2/Fry, MOB-2/Mob, membrane trafficking, RABI-1/Rabin8, small GTPase RAB-11.2

Introduction

Neuronal remodeling is essential for proper nervous system development and function. Dendrite remodeling can be initiated by stereotyped developmental programs, activity-dependent mechanisms or stress (Brunson et al. 2005; Schuldiner and Yaron 2015; Riccomagno and Kolodkin 2015; McEwen, Nasca, and Gray 2016; Furusawa and Emoto 2021). For example, in Drosophila, dendrite pruning is regulated by developmental ecdysone signaling in the mushroom body and in peripheral sensory neurons during morphogenesis (Lee et al. 2000; Kuo, Jan, and Jan 2005). In contrast, in mammalian hippocampal neurons, chronic stress has been shown to promote dendrite retraction (Magariños et al. 1996; Vyas et al. 2002; Christian et al. 2011; McEwen, Nasca, and Gray 2016). Although deregulated neuronal remodeling has been suggested to be involved in neurodevelopmental and neuropsychiatric disorders such as Autism Spectrum Disorder and Schizophrenia (Riccomagno and Kolodkin 2015), the mechanisms that govern this process remain poorly understood.

A myriad of cell biological mechanisms cooperate to direct dendrite pruning, including protease activation, transport, cytoskeletal dynamics, and membrane dynamics (Williams and Truman 2005; Kuo et al. 2006; Lin et al. 2015; Riccomagno and Kolodkin 2015; Schuldiner and Yaron 2015; Krämer, Rode, and Rumpf 2019; Rumpf, Wolterhoff, and Herzmann 2019; Furusawa and Emoto 2021; Rui 2024). Evidence for the role of membrane dynamics comes primarily from Drosophila class IV da neurons, where localized endocytic events at proximal dendrites correlate with membrane thinning and precede pruning of the dendritic arbor (Kanamori et al. 2013; H. Zhang et al. 2014; Kanamori et al. 2015). In the same system, the recycling endosome protein Rab11 is required for dendrite pruning, at least partially through the removal of the cell surface protein Neuroglian (H. Zhang et al. 2014; Krämer, Rode, and Rumpf 2019; Lin et al. 2020). Rab11 can bind the guanine-nucleotide exchange factor (GEF) Rabin8, which can activate Rab8 and Rab10 (Knödler et al. 2010; Westlake et al. 2011; Feng et al. 2015; Homma and Fukuda 2016). Although Rab11 has been implicated in membrane retrieval and removal of surface Neuroglian, whether Rabin8, and its associated GTPases, function in dendrite pruning has not been investigated.

Nuclear Dbf2-related (NDR) kinases are AGC family serine/threonine kinases that are evolutionarily conserved from yeast to humans (Tamaskovic, Bichsel, and Hemmings 2003; Hergovich et al. 2006; Santos et al. 2023). NDR kinases regulate cell shape, growth, and polarity (Verde, Wiley, and Nurse 1998; Zallen et al. 2000; Geng et al. 2000; Hergovich et al. 2006; Chen et al. 2019). Mutations in NDR kinases lead to ectopic membrane growth in C. elegans and mammalian neurons (Gallegos and Bargmann 2004; Zallen et al. 2000; Roşianu et al. 2023), and to excessive dendrite branching in Drosophila, consistent with a role in restricting cellular growth (Emoto et al. 2004). The mechanism by which NDR kinases restrict cellular growth remains unclear, although several NDR substrates, including Rabin8, regulate membrane dynamics (Ultanir et al. 2012; Roşianu et al. 2023). Whether NDR kinases, in addition to restricting neurite growth, promote neurite elimination is unknown.

Here, we establish C. elegans inner labia 2 dorsal and ventral (IL2Q) neurons as a genetically tractable model for dendrite pruning. IL2Q primary dendrites elaborate new branches when C. elegans enters a stress-induced and developmentally encoded quiescence-state known as dauer arrest (Schroeder et al. 2013; Androwski, Flatt, and Schroeder 2017). These newly generated branches are then eliminated upon return to favorable conditions (Schroeder et al. 2013). We find that IL2Q pruning shows branch-specific and stress-specific genetic requirements: the NDR kinase SAX-1 is required for pruning secondary and tertiary, but not quaternary branches. SAX-1 promotes branch elimination in post dauer larvae induced by the daf-7/TGF-β or daf-2/Insulin-receptor pathways, but not by starvation. SAX-1 functions with its conserved interactors SAX-2/Furry and MOB-2 to regulate membrane dynamics during IL2Q pruning. SAX-1 functions with the guanine-nucleotide exchange factor RABI-1/Rabin8 and the small GTPase RAB-11.2, which are primarily required for secondary dendrite elimination. These results provide insights into cell-biological mechanisms that underlie remodeling of complex dendritic arbors during development and stress.

Results

shy87 mutants disrupt dendrite remodeling

To study dendrite remodeling we adapted the Inner Labial 2 (IL2) sensory neurons of C. elegans as an experimental model. IL2s extend an anterior primary dendrite that terminates in a sensory cilium at the tip of the nose, and project short axons that run posteriorly to the nerve ring, where they turn circumferentially (White et al. 1986). The IL2 dendrite is unbranched in well-fed animals undergoing reproductive development. However, two IL2 pairs (IL2D and IL2V, together referred to as IL2Q) undergo extensive and stereotypic branching during dauer arrest – an alternative developmental diapause that is induced by stress conditions such as overpopulation or starvation (Figure 1A, B). In dauer, IL2Q primary (1°) dendrites extend secondary (2°), tertiary (3°), and quaternary (4°) branches at roughly 90° to each other, forming a characteristic dendrite arbor (Figure 1C; Supplemental Figure 1A). Upon re-exposure to favorable conditions, IL2Q eliminate most of their dauer-generated dendritic branches (Figure 1B; 1D; Supplemental Figure 1A–B), leaving primary dendrites intact (Schroeder et al. 2013). The factors that control IL2Q dendrite elimination following dauer recovery are unknown.

Figure 1. shy87 mutants exhibit a remodeling defect in post dauer adults.

Figure 1.

Open in a new tab

(A) Schematic depicting C. elegans life cycle. Adapted from WormAtlas. Under unfavorable conditions, the nematode arrests into an alternative developmental molt (dauer). Upon re-exposure to favorable conditions, reproductive development is resumed into adulthood. (B) Oblique transverse schematic of IL2Q neurons (magenta) at dauer arrest (top) and in a post dauer adult worm (bottom). Pharynx (green); Head muscles (purple); Hypodermis (yellow). At dauer, the IL2Q neurons extend a stereotypical dendritic arbor characterized by a 2° dendrite extending from a 1° dendrite towards the dorsal midline; 3° dendrites bifurcate from 2° dendrite towards the anterior and posterior in parallel to 1° dendrite; 4° dendrites extending into the head muscle quadrants (purple). When reproductive development is resumed, post dauer adult worms remove the higher-order dendrites, leaving the 1° dendrite intact. (C-D) Z-projection of control dauer (C) and post dauer adult (D) expressing tba-6p::tagRFP in IL2s (top). Zoomed inset of select IL2 dorsal neuron (bottom, dashed box). (E-F) Maximum intensity Z-projection of shy87 mutant dauer (E) and post dauer adult (F) expressing cytosolic tagRFP under tba-6p (top). Zoomed inset of select IL2 dorsal neuron (bottom, dashed box). Scale bar, 10μm. (G) Quantification of the number of IL2Q 2°-4° dendrites at dauer comparing shy87 mutants (n = 15) to control animals (n = 15). Unpaired t-test. (H) Quantification of the number of IL2Q higher-order dendrites in control (n = 8) versus shy87 mutants post dauer adults (n = 11). Unpaired t-test with Welch’s correction (2°) or Mann-Whitney U test (3°-4°). Error bars are ±SEM.

To uncover new regulators of neuronal remodeling, we first optimized conditions for an unbiased visual genetic screen for IL2Q remodeling-defective mutants. IL2 neurons were visualized by expressing a cytosolic TagRFP driven by the tba-6 promoter, an α-tubulin isoform that is enriched in IL2s (Hurd et al. 2010; Schroeder et al. 2013; Nishida et al. 2021). We synchronized dauer entry and exit using a temperature-sensitive allele of the TGF-β homolog daf7(e1372), which causes constitutive dauer entry at 25°C and allows recovery from dauer and the resumption of reproductive development at 15°C (Riddle, Swanson, and Albert 1981; Ren et al. 1996). IL2Q morphology at dauer and in post dauer adults was qualitatively similar in daf-7(e1372) and wildtype N2 animals (Supplemental Figure 1D). Hence, unless otherwise noted, we use daf7(e1372) as a control strain.

From a screen of roughly 3,000 haploid genomes (screen strategy outlined in Supplemental Figure 1C), we isolated a mutant, shy87, that exhibited a striking maintenance of IL2Q dendrite branches as post dauer adults. shy87 mutants eliminated 4° dendritic branches but showed excessive 2° and 3° dendritic branches compared to control (Figure 1C–H), suggesting that shy87 is required for the elimination of secondary and tertiary dendritic branches. To test whether this defect reflects a failure to eliminate dauer-generated branches or an earlier developmental defect, we quantified the total number of IL2Q dendrites across 2°-4° branch orders in control and shy87 mutants at dauer (Figure 1G). shy87 mutant dauers showed a minor reduction in secondary and tertiary branches compared to control (Figure 1G). These results indicate that shy87 is specifically required for the elimination of dauer-generated dendrite branches.

The conserved serine/threonine kinase sax-1/NDR is required for dendrite branch-specific elimination

We next used whole-genome sequencing and SNP mapping to identify a signature Ethyl Methanesulfonate (EMS) mutation (G>A) that converts a glycine to an asparagine at position 316 of the conserved serine/threonine kinase SAX-1 in shy87 mutants (Figure 2A). We validated sax-1(shy87) as the causal mutation for pruning defects with three complimentary approaches. First, we tested a partial deletion allele, sax-1(ky491), and found that it phenocopied shy87 (Figure 2EF). Second, we generated an early stop codon in sax-1 in control animals using CRISPR-Cas9, which led to pruning defects indistinguishable from shy87 (Figure 2C;2E–F). Lastly, we reverted the mutated asparagine 316 back to glycine in shy87 mutants and found that this rescued the mutant phenotype (Figure 2D–F). Together, these results indicate that shy87 is a mutation in sax-1, and that sax-1 is required for IL2Q dendrite remodeling.

Figure 2. SAX-1/NDR promotes IL2Q remodeling in a cell-specific and kinase activity-dependent manner.

Figure 2.

Open in a new tab

(A) AlphaFold predicted structure of SAX-1 with key functional domains indicated: N-terminal regulatory domain (1–79AA, orange), kinase catalytic domain I-VII (80–270AA, dark green), auto-inhibitory sequence (270–310AA, dark purple), kinase catalytic domain VIII-IX (310–370AA, light green), and the AGC family kinase C-terminal domain (370–446AA, magenta). Close-up view of glycine316 (red), which is conserved across species from yeast to human homologs of NDR1/2 kinases and mutated into an asparagine in shy87 mutants. (B-D) Maximum intensity Z-projection of control (B), early stop (C), and engineered repair of the shy87 allele (D) post dauer adult animals, demonstrating that loss of sax-1 function is responsible for the pruning defects in shy87 mutants. Zoomed inset of select IL2Q are shown for early stop (C) and shy87 engineered repair (D) with a dashed box. Scale bars, 10μm. (E, F) Quantifications of IL2Q 2° dendrite (E) and 3° dendrite number in post dauer adults of control and indicated sax-1 alleles. Brown-Forsythe and Welch ANOVA with Dunnett’s correction (E) or Kruskal-Wallis test with Dunn’s correction (F), all genotypes compared to control and shy87 mutants, n = 8–22. All sax-1 mutant alleles phenocopied shy87. Repair of the shy87 missense point mutation rescued the mutant phenotype back to control numbers. (G-H) Maximum intensity Z-projection of shy87 post dauer adult mutants expressing wildtype SAX-1 cDNA (G) and a kinase-dead (S279) construct (H) under an IL2-specific promoter (tba-6p). Scale bars, 10μm. (I, J) Quantifications comparing the total number of IL2Q 2° dendrites (I) and 3°dendrites (J) in post dauer adults of control, sax-1 mutants, and indicated rescue transgenes. Brown-Forsythe and Welch ANOVA with Dunnett’s multiple comparison (I) and Kruskal-Wallis with Dunn’s correction (J), n = 8–21. Error bars are ±SEM.

NDR kinases are required to restrict cell size across organisms (Tamaskovic, Bichsel, and Hemmings 2003; Gallegos and Bargmann 2004; Emoto et al. 2004; Hergovich et al. 2006; Yd et al. 2019; Roşianu et al. 2023). In C. elegans and mice, NDR mutants show excessive growth of neuronal membranes, and in Drosophila, mutations in the NDR homolog Tricornered lead to excessive dendrite branching and loss of self-avoidance (Zallen et al. 2000; Gallegos and Bargmann 2004; Emoto et al. 2004; Roşianu et al. 2023). It is therefore unexpected that in IL2Q sax-1 is required to eliminate existing processes rather than to restrict growth. To confirm that dendrite branch-maintenance in sax-1 mutants is not caused by ectopic regrowth after initial elimination, we systematically characterized the time course of dendrite remodeling following recovery from dauer arrest. In control animals, 4° dendrites were mostly eliminated by 16 hours. Most 3° branches were eliminated between 16–22 hours (Supplemental Figure 2A), whereas 2° branches were eliminated closer to the L4 molt. Examination of sax-1 mutants at 16–20 hours, when most 3° branches undergo elimination, revealed that these branches are maintained in the mutants (Supplemental Figure 2B). This result strongly argues that excessive dendrite branches in sax-1 mutant adults reflect a failure to eliminate dauer-born branches rather than ectopic branch regrowth.

Dauer entry involves drastic changes to animal physiology (Cassada and Russell 1975; Riddle 1977; Golden and Riddle 1984; Gerisch et al. 2001; Burnell et al. 2005). Furthermore, the method of dauer induction can affect the characteristics of the dauer larvae (Golden and Riddle 1982; Karp 2018; Hu 2018). We therefore asked whether the requirement for sax-1 in controlling IL2Q dendrite morphology depends on the selected method of dauer induction. We found that sax-1 mutants that have not undergone dauer arrest (i.e. normal development) exhibit normal IL2Q morphology, suggesting that sax-1 only plays a role post dauer (data not shown). Next, we tested whether the requirement for sax-1 is specific to dauers induced by the temperature-sensitive daf-7/TGF-β mutation. For this, we examined IL2Q morphology in sax-1 mutants following dauer arrest induced by starvation or by using a mutant allele of the insulin receptor daf2(e1370) (Supplemental Figure 2C), which promotes dauer entry through a different pathway than daf-7(e1372) (Riddle, Swanson, and Albert 1981; Gottlieb and Ruvkun 1994; Ren et al. 1996; Hu 2018; Karp 2018). Interestingly, starved animals did not require sax-1 for dendrite remodeling, whereas in daf-2 mutants, similar to daf-7 mutants, sax-1 was required for dendrite remodeling (Supplemental Figure 2C–D). These results suggest that the requirement for sax-1 in IL2Q dendrite morphology is not universal but relies on specific physiological states of the dauer stage.

SAX-1/NDR acts cell-autonomously and is kinase activity dependent

To determine whether SAX-1 functions cell autonomously in IL2Q to promote elimination, we expressed sax-1 cDNA driven by the IL2-specific tba-6 promoter in shy87 mutants (Figure 2G). This led to a robust decrease in the number of IL2Q 2° and 3° dendrites, suggesting that sax-1 functions cell-autonomously in IL2Q to mediate dendrite pruning (Figure 2I–J). NDR kinases are phosphorylated at conserved serine and threonine residues, residing in the hydrophobic motif (S279 in C. elegans) and the T-loop, which are essential for kinase activity (Millward, Hess, and Hemmings 1999; Tamaskovic et al. 2003). To test whether SAX-1 function requires its kinase activity, we next expressed SAX-1 cDNA with a S279A mutation (Figure 2H), which suppresses NDR kinase activity in vitro (Millward, Hess, and Hemmings 1999; Tamaskovic et al. 2003). SAX-1(S279A) expression did not rescue dendrite remodeling defects in sax-1(shy87) mutants in multiple transgenic lines tested (Figure 2I–J). Together, these data indicate that SAX-1/NDR functions cell-autonomously in IL2Q in a kinase-activity-dependent manner.

MOB-2 and SAX-2/Furry function with SAX-1/NDR to direct IL2Q dendrite elimination

To identify proteins that function with SAX-1 in IL2Q dendrite elimination, we conducted a candidate genetic screen (Table 1). From this screen, we found that the conserved NDR activator MOB-2 and the binding partner SAX-2/Furry were required for the elimination of IL2Q branches. Similar to sax-1 mutants (Figure 3B), sax-2 (Figure 3C) and mob-2 (Figure 3E) mutants exhibited selective retention of secondary and tertiary branches in adults, while quaternary branches were efficiently eliminated (Figure 3G–I). Mps1-binder-related (MOB) proteins bind the N-terminal Regulatory (NTR) region of NDR kinases and promote their activation (Devroe et al. 2004; Bichsel et al. 2004; Hergovich 2011; Gógl et al. 2015). SAX-2/Furry is a ~300 kD protein containing Armadillo repeats that may act as a scaffold for SAX-1/NDR (Cong et al. 2001; Chiba et al. 2009; Nagai and Mizuno 2014) and functions with NDR kinases in neurite growth and dendrite tiling (Zallen et al. 2000; Emoto et al. 2004; Gallegos and Bargmann 2004). To assess if sax-1, mob-2, and sax-2 function in the same genetic pathway, we generated sax-1;mob-2 and sax-1;sax-2 double-mutants and compared their phenotypes to those of single mutants and controls (Figure 3D; 3F–I). Double-mutants did not show an additive effect, suggesting that they act within the same genetic pathway. These results suggest that a conserved SAX-1/SAX-2/MOB-2 complex is required for IL2Q dendrite pruning.

Table 1.

Candidate genetic screen for SAX-1/NDR kinase interactors and substrates.

Gene Allele(s) Mammalian Ortholog Phenotype References
Cell Growth and Size Regulators
sax-2 ky216 Furry IL2Q pruning defect post dauer (He et al. 2005; Fang et al. 2010; Nagai and Mizuno 2014; Cervino et al. 2021 ; Roşianu et al. 2023)
F09A5.4/mob-2 ok3273 Mob2 IL2Q pruning defect post dauer (Devroe et al. 2004)
yap-1 tm1416 YAP1 No phenotype observed (L. Zhang et al. 2015; Irie, Nagai, and Mizuno 2020)
rict-1 mg360 Rictor No phenotype observed (Koike-Kumagai et al. 2009; Wu et al. 2013)
unc-82 e1323 NUAK1 No phenotype observed (Suzuki, Ogura, and Esumi 2006)
Actin Regulators
unc-43 e408 CaMKII No phenotype observed (Zallen et al. 2000; Rehberg et al. 2014)
wsp-1 gm324 WASP No phenotype observed (Natarajan et al. 2015)
Endocytosis and Membrane Trafficking
sel-5 ok363 Aak1 No phenotype observed (Ultanir et al. 2012; Roşianu et al. 2023)
pifk-1 tm2348 PI4KB No phenotype observed (Roşianu et al. 2023)
mig-10 ok2499 Raph1 No phenotype observed (Roşianu et al. 2023)
F58G6.1/amph-1 tm1060 BIN1 No phenotype observed (Roşianu et al. 2023)
F54C9.11/rabi-1 tm2518 Rabin8 IL2Q pruning defect post dauer (Ultanir et al. 2012; Chiba et al. 2013; Deretic et al. 2023; Fresquez et al. 2025)
rab-11.1 tm2251 Rab11A No phenotype observed (Chiba et al. 2013; Roşianu et al. 2023; Burguete, Song, and Ghabrial 2024)
rab-11.2 tm2081 Rab11A IL2Q pruning defect post dauer (Chiba et al. 2013; Roşianu et al. 2023; Burguete, Song, and Ghabrial 2024)
rab-10 ok1494 Rab10 IL2Q branching defect at dauer (Chiba et al. 2013; Homma and Fukuda 2016; Fresquez et al. 2025)
rab-8 tm2991 Rab8B ILQ branching defect at dauer and post dauer (Chiba et al. 2013; Homma and Fukuda 2016; Fresquez et al. 2025)
Mitochondrial Quality Control
pink-1 ok3538 PINK1 No phenotype observed (Wu et al. 2013)
Open in a new tab

Figure 3. MOB-2 and SAX-2/Furry function with SAX-1/NDR to direct IL2Q dendrite elimination.

Figure 3.

Open in a new tab

Post dauer adult confocal images of (A) control and (B) sax-1 loss-of-function, (C) mob-2, (D) sax-1;mob-2 double mutants, (E) sax-2, and (F) sax-1; sax-2 double-mutants. Zoomed inset of select IL2Q are shown for mob-2 and sax-2 single mutants with a dashed box. Scale bars, 10μm. (G-H) Quantification of the total number of 2° (G), 3° (H), and 4° dendrites (I) in post dauer adults for genotypes shown in A-F. Brown-Forsythe and Welch ANOVA with Dunnett’s correction (2°) or Kruskal-Wallis test with Dunn’s correction (3°-4°), n = 8–39. Error bars are ±SEM, with individual data points shown.

SAX-2/Furry localization depends on SAX-1

To gain insights into the functions of SAX-1 and SAX-2 in dendrite remodeling, we inserted three copies of spGFP11 (3xspGFP11) at the endogenous C-terminus of SAX-2 with CRISPRCas9 and visualized it in IL2Q by expressing spGFP1–10 under the tba-6 promoter. Tagging of SAX-2 with spGFP11 did not lead to dendrite remodeling defects, suggesting that the tag is functional (data not shown). In control animals, SAX-2 was mostly concentrated in the cell body (data not shown), with occasional dendritic puncta observed at dauer (Figure 4B; 4F). The punctate distribution of SAX-2 in IL2s closely resembles its appearance in other neurons and tissues (Gallegos and Bargmann 2004; Park et al. 2024). Interestingly, 16–20 hours after shifting dauer animals to 15°C, there was an increase in SAX-2 puncta in 1° dendrites (Figure 4D; 4F), suggesting that SAX-2 may function locally during dendrite pruning. In sax-1 mutants, we observed a robust increase of dendritic SAX-2 puncta (Figure 4E; 4G–H), mostly around the 2° and 3° branchpoints, which would have been eliminated 16–20 hours following dauer recovery in control animals. This phenotype is underestimated in the quantifications (Figure 4F–H), in which we only measured SAX-2 puncta in the 1° dendrite, to avoid comparing dendritic arbors of different sizes. These results indicate that sax-1 is required for the localization of SAX-2. The localization of SAX-2 in sax-1 mutants is consistent with a failure to progress beyond an intermediate step in the branch elimination process.

Figure 4. SAX-2/Furry localization depends on SAX-1 kinase.

Figure 4.

Open in a new tab

(A) Schematic illustrating the strategy to endogenously label SAX-2 in IL2 neurons using split-GFP, with GFP1–10 expressed under IL2 specific promoter. (B-C) Representative images of endogenous SAX-2::GFP (pseudo-colored yellow) in IL2 neurons (pseudo-colored magenta) at dauer arrest in control (B) and sax-1 mutants (C). Scale bar, 10μm. (D-E) Representative IL2Q inset maximum intensity Z-projection of endogenous SAX-2::GFP in IL2 neurons 16–20 hours post dauer in control (D) and sax-1 mutants (E). Zoomed insets show a single IL2D 1° dendrite. Yellow arrowheads denote SAX-2::GFP puncta localized at 1° dendrites; white/black arrowheads point to SAX-2::GFP puncta localized to higher-order dendrites. Scale bar, 10μm. (F) Quantification of SAX-2::GFP puncta at 1° dendrites in control animals at dauer and 16–20 hours post dauer. Mann-Whitney U test, n = 17–20. Dendritic SAX-2 puncta increase 16–20 hours following dauer recovery. (G) Quantifications of total # of SAX-2 puncta at 1° dendrites in control versus sax-1 mutants at dauer. Unpaired t-test with Welch’s correction, n = 5–7. (H) Quantifications of total # of SAX-2 puncta at 1° dendrites in control versus sax-1 mutants at 16–20 hours post dauer. Mann-Whitney U test, n = 17–21. Error bars are ±SEM.

SAX-1 coordinates IL2Q remodeling with RABI-1/Rabin8 and RAB-11.2

Since SAX-1/NDR kinases are emerging as key regulators of membrane dynamics (Roşianu et al. 2023; Fresquez et al. 2025), we tested whether specific Rab GTPases involved in membrane recycling, along with other regulators of membrane dynamics, act as effectors of SAX-1/NDR1/2-mediated dendrite remodeling (Table 1). We found that mutants of RABI-1/Rabin8, a Rab8 guanine-nucleotide exchange factor (GEF), that was previously identified as a direct phosphorylation target of NDR kinases (Ultanir et al. 2012; Chiba et al. 2013; Roşianu et al. 2023), failed to eliminate their 2° dendrites post dauer (Figure 5E; 5J). Tertiary dendrites were affected (Figure 5K), but the phenotype was very subtle when compared to sax-1, sax-2 or mob-2 mutants, while 4° were efficiently eliminated (data not shown). Double-mutants of sax-1 and rabi-1 did not show an additive effect and phenocopied the severity of sax-1 single mutants (Figure 5H; 5L). These results suggest that rabi-1 and sax-1 function in the same genetic pathway that coordinates secondary dendrite elimination, while sax-1 likely directs elimination of tertiary dendrites with additional downstream regulators.

Figure 5. SAX-1 coordinates IL2Q remodeling with RABI-1/Rabin8 and RAB-11.2.

Figure 5.

Open in a new tab

(A-I) Representative confocal images of select IL2Q insets for control (A), rab-11.1 (B), rab-8 (C), rab10 (D), rabi-1 (E), rab-11.2 (F), sax-1 (G), rabi-1;sax-1 (H), and rab-11.2;sax-1 (I) post dauer adult mutants. Scale bar, 10μm. (J-K) Quantification of total number of 2° (J) and 3° (K) dendrites for A-F. Brown-Forsythe and Welch ANOVA with Dunnett’s correction (J) or Kruskal-Wallis with Dunn’s correction (K), n = 8–62. (L) Quantification of total number of 2° dendrites in indicated genotypes. Brown-Forsythe and Welch ANOVA with Dunnett’s correction, n = 8–33. Error bars are ±SEM, with individual data points shown.

Rabin8 functions as a GEF for Rab8 and Rab10, promoting their activation during membrane trafficking (Hattula et al. 2002; Knödler et al. 2010; Feng et al. 2012; Homma and Fukuda 2016). We found that rab-8 and rab-10 mutants showed mild pruning defects of secondary dendrites, reminiscent to rabi-1 mutants (Figure 5C–D;5J–K). These results suggest that RABI1/Rabin8 likely functions with RAB-8 and RAB-10 during dendrite pruning. However, rab-10 and rab-8 mutants also show reduced branching at dauer (data not shown), consistent with their roles in PVD dendrite arborization (Taylor et al. 2015; Zou et al. 2015), which may influence their pruning phenotypes.

Rabin8 recruitment to recycling endosomes depends on its interaction with GTP-bound Rab11 (Chiba et al. 2013; Feng et al. 2015; Homma and Fukuda 2016; Fresquez et al. 2025). To test the involvement of Rab11 in IL2Q dendrite remodeling post dauer, we tested mutant alleles of two closely related Rab11 homologues, rab-11.1 and rab-11.2. rab-11.1 mutants showed grossly normal IL2Q morphology during dauer and had no pruning defect following dauer exit (Figure 5B; 5J–K). In contrast, rab-11.2 mutants showed a pruning defect following dauer exit that was similar to rabi-1 mutants (Figure 5F; 5J–K). In addition, rab-11.2;sax-1 double mutants did not enhance the sax-1 mutant phenotype (Figure 5I;5L), suggesting that they function in the same genetic pathway that eliminates secondary dendrites. Together, these results suggest that RABI-1/Rabin8 and RAB-11.2 function with SAX-1/NDR kinase to eliminate secondary dendrites, likely by coordinating membrane dynamics during IL2Q pruning.

SAX-1 coordinates membrane retrieval

The involvement of rab-11.2 in sax-1-mediated dendrite remodeling suggests that SAX-1 may function to coordinate membrane retrieval during branch elimination. To visualize endocytosis during IL2Q remodeling, we used an established genetically encoded reporter (Richardson, Yee, and Shen 2019). We expressed secreted GFP harboring a signal peptide from muscle, and expressed in IL2 neurons a chimera consisting of RFP and the transmembrane domain of mCD8 fused to an anti-GFP nanobody (GBP) (Figure 6A). GFP binding to GBP leads to GFP accumulating on the surface of IL2Q, and their endocytosis appears as GFP and RFP colocalized puncta (Figure 6C–D) (Richardson, Yee, and Shen 2019). We used a chimera lacking GBP as a control (Figure B) and found that this prevented the recruitment of muscle-secreted GFP to IL2Q surface or endocytic puncta (Figure 6E–F).

Figure 6. SAX-1/NDR promotes endocytic events during pruning.

Figure 6.

Open in a new tab

(A) Schematic of generic endocytosis reporter. mCD8::tagRFP (blue) fused to a GFP-binding nanobody are expressed under an IL2-specific promoter. Secreted GFP (yellow) from muscle binds the nanobody, enabling visualization of endocytosed GFP-mCD8 complexes as blue/yellow colocalized puncta. (B) Schematic of a control endocytosis reporter chimera lacking the GFP-binding nanobody. (C) Zoomed insets of confocal image depicting a single IL2Q 1° dendrite in control dauer with the endocytosis reporter (C-D) and a control construct lacking GFP-binding nanobody (E-F). White arrowheads show blue-yellow colocalization, suggestive of endocytosed complexes. Scale bar, 10μm. (D) Normalized fluorescence linescan of endocytic reporter showing co-localization of blue-yellow puncta (white dashed box) at dauer. (F) Normalized fluorescence linescan of control construct lacking GFP-binding nanobody showing lack of co-localization of blue-yellow puncta at dauer. (G-H) Representative zoomed insets of confocal images of the endocytosis reporter in a single IL2Q neuron at 16–20 hours post dauer in control (G) and sax-1 mutants (H). White arrowheads depict blue-yellow co-localized puncta. Scale bar, 10μm. (I) Quantification of the total number of co-localized blue-yellow puncta at dauer and 16–20 hours post dauer in control animals and sax-1 mutants. Mann-Whitney U test, n = 5–7. Error bars are ±SEM. sax-1 is required for the endocytic puncta post dauer.

We found that endocytosis increases in IL2Q neurons between dauer and 16–20 hours following dauer recovery (Figure 6I), consistent with the idea that pruning involves membrane retrieval. There was no significant difference between the number of endocytic puncta in control and in sax-1 mutants during dauer. Conversely, at 16–20 hours post dauer sax-1 mutants showed a decrease in the number of endocytic events (Figure 6I) These results suggest that sax-1 is specifically required for the formation or stabilization of endocytic sites during IL2Q dendrite pruning following dauer recovery.

Discussion

The mechanisms that govern neuronal remodeling during development and under stress remain poorly understood. Here, by adapting C. elegans IL2Q dendrites as a model for developmentally and stress-mediated dendrite pruning, we identified a novel role for the conserved SAX-1/NDR kinase in dendrite branch-specific elimination. Our results indicate that SAX-1/NDR and its conserved interactors SAX-2/Furry and MOB-2 are required for the elimination of IL2Q secondary and tertiary, but not quaternary, branches. SAX-1/NDR is required for dendrite pruning following recovery from developmental diapause induced by manipulating daf-7/TGF-β or daf-2/Insulin-receptor signaling but is dispensable when diapause is induced by starvation. Additionally, we find that SAX-1 functions with the guanine-nucleotide exchange factor RABI-1/Rabin8 and the small GTPase RAB-11.2 to direct the elimination of 2° dendrite branches in post dauer animals. RABI-1/Rabin8 may activate small GTPases RAB-8 and RAB-10 to mediate 2° dendrite elimination and, consequently, regulate membrane retrieval. The known involvement of these proteins in membrane trafficking (Westlake et al. 2011; Ultanir et al. 2012; Chiba et al. 2013; Homma and Fukuda 2016; Fresquez et al. 2025) and our results with a genetically encoded endocytosis reporter suggest that SAX-1 promotes dendrite elimination by regulating membrane dynamics. Together, these results reveal unexpected state- and branch-specific dendrite elimination mechanisms during neuronal remodeling, governed by a conserved regulator of polarized cell growth.

SAX-1/NDR kinases are conserved regulators of polarized cell growth (Verde, Wiley, and Nurse 1998; Tamaskovic, Bichsel, and Hemmings 2003; Das et al. 2009; Gupta and McCollum 2011; Chen et al. 2019). Loss of NDR activity leads to increased cell growth in fission yeast and mammals (Hergovich et al. 2006; Das et al. 2009; Demiray et al. 2018). In C. elegans and Drosophila neurons, mutants in sax-1 or its homolog Trc, respectively, fail to terminate axon growth or display excessive dendrite branching (Gallegos and Bargmann 2004; Emoto et al. 2004; Chung et al. 2016). More recently, it was shown that in hippocampal CA1 neurons, combined loss of NDR1 and NDR2 results in ectopic membrane protrusions (Roşianu et al. 2023), a phenotype that is notably similar to that of sax-2 mutants in C. elegans (Park et al. 2024). Together, these results suggest a general role in restricting cell size. However, the role we identified for sax-1 and sax-2 in IL2Q is not in restricting cellular growth, as sax-1 and sax-2 mutants did not exhibit IL2Q branching defects at dauer arrest. Instead, following the temporal progression of IL2Q pruning, we found that the aberrant dendritic branches observed in mutant adults are not ectopic outgrowths, but rather the result of failed dendrite elimination. Therefore, NDR kinases are able to both inhibit growth and promote the elimination of cellular processes. How these two functions are coordinated remains to be determined. NDR kinases likely engage distinct substrates in a context-dependent manner, enabling it to differentially regulate cellular outcomes. Alternatively, since the elaboration of cellular processes such as dendritic branches involves coordinated growth and retraction (Smith et al. 2010; Shi et al. 2024), it is possible that some of the excessive branching observed in NDR kinase mutants reflects a failure in branch retraction.

How does SAX-1 promote 2° and 3° dendrite pruning? Our findings support that SAX-1 acts as a kinase and functions cell autonomously with its conserved interactors SAX-2/Furry and MOB-2. NDR kinases are activated through binding to MOB family proteins, which enhance NDR phosphorylation and stabilize their active conformation (Bichsel et al. 2004; Hergovich and and Hemmings 2005), while Furry proteins may serve as scaffolds to support kinase function (Chiba et al. 2009; Nagai and Mizuno 2014). NDR kinases can direct growth by regulating the cytoskeleton (Das et al. 2009; Norkett et al. 2020) and membrane dynamics, including regulation of exocytosis, endocytosis, membrane asymmetry, intracellular trafficking, and autophagy (Joffre et al. 2015; Yd et al. 2019; Ogura et al. 2023; Roşianu et al. 2023). We found that sax-1 acts with rab-11.2, rabi-1/Rabin8 and potentially rab-8 and rab-10 to eliminate IL2Q 2° dendrites post dauer, consistent with a role for SAX-1 in regulating membrane dynamics. The preferential elimination of 2° dendrites in these mutants suggests that membrane trafficking is differentially regulated across branch orders during pruning. We also found that sax-1 is required for SAX-2 distribution, with an increased abundance of SAX-2 in sax-1 mutant dendrites. If and how this localization relates to the regulation of membrane trafficking by SAX-1 is unclear. We hypothesize that the increased dendritic localization of SAX-2 is due its retention at an intermediate step in membrane retrieval. Since the compartment to which SAX-2 localizes is unclear (Park et al. 2024), future work will be required to test this hypothesis.

A key and unexpected finding of this study is that different dendritic branches rely on distinct genetic requirements for their elimination, likely reflecting the partial nature of pruning in this system. Unlike in Drosophila da and mushroom body γ neurons, where entire dendritic arbors are eliminated, C. elegans IL2Q neurons selectively eliminate only dauer-induced branches. This points to mechanisms that discriminate between primary and higher-order dendrites during pruning. Moreover, the observation that the mode of dauer induction alters the pruning mechanism underscores the complexity of this process. Leveraging this system in future work could reveal how physiological states or external cues drive branch-specific elimination programs.

Methods

C. elegans strains and maintenance

All C. elegans strains were cultured on Nematode Growth Medium (NGM) seeded with Escherichia coli OP50. Animals were examined at multiple developmental stages, including normal development adults, dauer larva, 16–20hrs post dauer larva, and post dauer adults. Normal development adults were grown at 150°C. Dauer arrest was induced and dauer larva were maintained at 25°C. Post dauer animals were transferred to and maintained at 15°C, unless otherwise indicated. A detailed list of C. elegans strains used in the study is provided in the Key Resources Table.

Key Resources Table

REAGENTS or RESOURCE SOURCE IDENTIFIER
Bacterial strains
Escherichia coli: OP50 Strain Caenorhabditis Genetics Center (CGC) OP50
Escherichia coli: DH10B, chemical competent cells ThermoFisher Cat# 18297010
Chemicals, peptides, and recombinant proteins
Ethyl methanesulfonate Sigma-Aldrich Cat# M0880–1G
S. pyrogenes Cas9 3NLS, 10μg/uL IDT Cat# 1081058
Levamisole Hydrochloride ChemCruz Cat# 205730
Critical commercial assays
EnGen sgRNA Synthesis Kit, S. pygenes NEB Cat# E3322S
QuikChange Lightning Multi Site-Directed Mutagenesis Kit Agilent Cat# 210513
Monarch RNA Cleanup Kit NEB Cat# T2040
Experimental models: Organisms/strains
myIs13[klp-6p::GFP] (III) myIs13 from Schroeder Lab PT2519
shyIs66[tba-6p::tagRFP;tba-6p::ZIF-1] (III) This study MTS1544
shyIs62[egas-1p::tagRFP] (X) This study MTS1531
daf-7(e1372) (III); shyIs66[tba-6p::tagRFP;tba-6p::ZIF-1] (III) This study MTS3357
daf-7(e1372) (III); shyIs62[egas-1p::tagRFP] (X) This study MTS3392
daf-7(e1372) (III); myIs13[klp-6p::GFP] (III) This study MTS542
sax-1(ky491) (X); shyIs62[egas-1p::tagRFP] (X) This study MTS1463
sax-2(ky216) (III); shyIs62[egas-1p::tagRFP] (X) This study MTS1470
sax-1(ky491) (X); daf-7(e1372) (III); myIs13[klp-6p::GFP] (III) This study MTS3358
sax-1(shy87) (X); daf-7(e1372) (III); shyIs66[tba-6p::tagRFP;tba-6p::ZIF-1] (III) This study MTS1199
sax-1(shy280) (X); daf-7(e1372) (III); shyIs66[tba-6p::tagRFP;tba-6p::ZIF-1] (III) This study MTS3393
sax-1(shy277) (X); daf-7(e1372) (III); shyIs66[tba-6p::tagRFP;tba-6p::ZIF-1] (III) This study MTS3351
shyEx826 [tba-6p::SAX-1;unc-122p::GFP]; sax-1(shy87) (X); daf-7(e1372) (III); shyIs66[tba-6p::tagRFP;tba-6p::ZIF-1] (III) This study MTS3408
shyEx827 [tba-6p::SAX-1(S279A);unc-122p::GFP]; sax-1(shy87) (X); daf-7(e1372) (III); shyIs66[tba-6p::tagRFP;tba-6p::ZIF-1] (III) This study MTS3409
mob-2(ok3273) (X); daf-7(e1372) (III); shyIs66[tba-6p::tagRFP;tba-6p::ZIF-1] (III) This study MTS3384
mob-2(ok3273) (X); sax-1(ky491) (X); daf-7(e1372) (III); shyIs66[tba-6p::tagRFP;tba-6p::ZIF-1] (III) This study MTS3364
sax-1(ky491) (X); daf-7(e1372) (III); shyIs62[egas-1p::tagRFP] (X) This study MTS3390
sax-2(ky216) (III); daf-7(e1372) (III); shyIs62[egas-1p::tagRFP] (X) This study MTS3350
sax-2(ky216) (III); sax-1(shy280) (X); daf-7(e1372) (III); shyIs62[egas-1p::tagRFP] (X) This study MTS3393
sax-2(ky216) (III); sax-1(ky491) (X); daf-7(e1372) (III); shyIs62[egas-1p::tagRFP] (X) This study MTS3347
wdIs52[F49H12.4::GFP + unc-119(+)] (II) wdIs52 from Hammarlund Lab NC1687
sax-1(ky491) (X); wdIs52[F49H12.4::GFP + unc-119(+)](II) This study MTS1981
sax-2(ky216) (III); wdIs52[F49H12.4::GFP + unc-119(+)] (II) This study MTS3332
daf-7(e1372) (III); shyEx349[tba-6p::tagRFP;tba-6p::GFP1-10] This study MTS3410
sax-2(shy279[sax-2::GFP11×3]) (III); daf-7(e1372) (III); shyEx349[tba-6p::tagRFP;tba-6p::GFP1–10] This study MTS3411
sax-2(shy279[sax-2::GFP11×3]) (III); sax-1(ky491) (X); daf-7(e1372) (III); shyEx349[tba-6p::tagRFP;tba-6p::GFP1-10] This study MTS3412
rab-11.1(tm2251) (I); daf-7(e1372) (III); shyIs66[tba-6p::tagRFP;tba-6p::ZIF-1] (III) This study MTS3413
rab-8(tm2991) (I); daf-7(e1372) (III); shyIs66[tba-6p::tagRFP;tba-6p::ZIF-1] (III) This study MTS3414
rab-10(ok1494) (I); daf-7(e1372) (III); shyIs66[tba-6p::tagRFP;tba-6p::ZIF-1] (III) This study MTS3415
rabi-1(tm2518) (II); daf-7(e1372) (III); shyIs66[tba-6p::tagRFP;tba-6p::ZIF-1] (III) This study MTS3416
rabi-1(tm2518) (II); sax-1(ky491) (X); daf-7(e1372) (III); shyIs66[tba-6p::tagRFP;tba-6p::ZIF-1] (III) This study MTS3359
rab-11.2(tm2081) (I); daf-7(e1372) (III); shyIs66[tba-6p::tagRFP;tba-6p::ZIF-1] (III) This study MTS3417
rab-11.2(tm2081) (I); sax-1(ky491) (X); daf-7(e1372) (III); shyIs66[tba-6p::tagRFP;tba-6p::ZIF-1] (III) This study MTS3418
shyEx828 [tba-6p::spGDP::mCD8::tagRFP, myo-3p::sp::scFV::GFP]; daf-7(e1372) (III) This study MTS3419
shyEx828 [tba-6p::spGDP::mCD8::tagRFP, myo-3p::sp::scFV::GFP]; sax-1(ky491) (X); daf-7(e1372) (III) This study MTS3420
shyEx829 [tba-6p::mCD8::tagRFP, myo-3p::sp::scFV::GFP]; daf-7(e1372) (III) This study MTS3422
shyEx829 [tba-6p::mCD8::tagRFP, myo-3p::sp::scFV::GFP]; sax-1(ky491) (X); daf-7(e1372) (III) This study MTS3423
yap-1(tm1416) (X); daf-7(e1372) (III); shyIs66[tba-6p::tagRFP;tba-6p::ZIF-1] (III) This study MTS3421
rict-1(mg360) (II); daf-7(e1372) (III); shyIs66[tba-6p::tagRFP;tba-6p::ZIF-1] (III) This study MTS3424
unc-82(e1323) (II); daf-7(e1372) (III); shyIs66[tba-6p::tagRFP;tba-6p::ZIF-1] (III) This study MTS3425
unc-43(e408) (IV); daf-7(e1372) (III); shyIs66[tba-6p::tagRFP;tba-6p::ZIF-1] (III) This study MTS3426
wsp-1(gm324) (IV); daf-7(e1372) (III); shyIs66[tba-6p::tagRFP;tba-6p::ZIF-1] (III) This study MTS3427
sel-5(ok363) (III); daf-7(e1372) (III); shyIs66[tba-6p::tagRFP;tba-6p::ZIF-1] (III) This study MTS3366
pifk-1(tm2348) (X); daf-7(e1372) (III); shyIs66[tba-6p::tagRFP;tba-6p::ZIF-1] (III) This study MTS3428
mig-10(ok2499) (III); daf-7(e1372) (III); shyIs66[tba-6p::tagRFP;tba-6p::ZIF-1] (III) This study MTS3381
F58G6.1/amph-1(tm1060) (IV); daf-7(e1372) (III); shyIs66[tba-6p::tagRFP;tba-6p::ZIF-1] (III) This study MTS3389
pink-1(ok3538) (II); daf-7(e1372) (III); shyIs66[tba-6p::tagRFP;tba-6p::ZIF-1] (III) This study MTS3429
Oligonucleotides
For sax-1(shy87N316G) gRNA targeting sequence (+PAM): TGTGGAAGCTCAGAGCAGAATGG Sigma-Aldrich olPFD140
For sax-1(shy87N316G) ssODN repair template: tgtaccaacactcttcaaaacttaataattttcagGCTACTCACCATTCTGCTCTGAGCTTCCACAAGAAACGTAT Sigma-Aldrich olPFD142
For sax-1(earlyStop) gRNA targeting sequence (+PAM): GGAAATATCGCAGTACACAAAGG Sigma-Aldrich olPFD196
For sax-1(earlyStop) ssODN repair template: AGAAATTGCACCGGAAATGGAAATATCGCAGTACAGGAAATGGAAATATCGCAGTACAataattaGGATCCctaattaaCAAAGTATAAGgtaatttcattattagaattcgaaacatta Sigma-Aldrich olPFD197
For site-directed mutagenesis of sax-1 cDNA (S279A): tcgcgcatatgcatacgctacggtcggaactc Sigma-Aldrich olPFD333
For sax-2::3xspGFP11 gRNA targeting sequence (+PAM): TTAATCATAATGATCTGATGAGG Sigma-Aldrich olPFD343
For sax-2::3xspGFP11 dsODN repair template: AGCGTCAATGACCGAATCATTCGCACAATTGCCTTACTCATGGTGGCTCTGGAGGTCGTGACCACATGGTCCTTCATGAGTATGTAAATGCTGCTGGGATTACAGGTGGCTCTGGAGGTAGAGATCATATGGTTCTCCACGAATACGTTAACGCCGCAGGCATCACTGGCGGTAGTGGAGGACGCGACCATATGGTACTACATGAATATGTCAATGCAGCCGGAATAACCTAACAGATCATTATGATTAAattagtggaattgcgttg IDT olPFD344
Plasmids
tba-6p::tagRFP This study pGLS8
tba-6p::ZIF-1 This study pGLS9
tba-6p::spGFP1-10 This study pOVG6
egas-1p::tagRFP This study pPFD12
tba-6p::SAX-1 This study pPFD21
tba-6p::SAX-1(S279A) This study pPFD37
tba-6p::spGDP::mCD8::tagRFP This study pPFD57
myo-3p::sp::scFV::GFP Richardson Lab pCER229
tba-6p::mCD8::tagRFP This study pPFD74
Software and Algorithms
MiMOD Galaxy https://toolshed.g2.bx.psu.edu
Prism 10 GraphPad https://www.graphpad.com/
Illustrator 29.0 Adobe https://www.adobe.com/products/illustrator.html
ImageJ2 (2.14.0/1.54f) NIH https://imagej.net/software/imagej2/
AlphaFold Google DeepMind EMBL-EBI https://alphafold.ebi.ac.uk
Zotero7 Zotero https://www.zotero.org/download/
Open in a new tab

Molecular Cloning

Plasmids were constructed using conventional restriction-ligation methods or Gibson Assembly. Genes of interest were ordered as gene fragments from IDT and PCR cloned. Mutagenesis was performed using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent, Cat# 210513). Plasmids were confirmed by Sanger Sequencing. A list of plasmids used in this study are listed in the Key Resources Table. pCER229 was a gift from Claire Richardson. Plasmids were injected at the following concentrations to generate transgenic C. elegans lines: pRF4 (/μL), pGLS8 (15 ng/μL), pGLS9 (10ng/μL), pOVG6 (15ng/μL), pPFD12 (40ng/μL), pPFD21 (10ng/μL), pPFD37 (/μL), pPFD57 (5ng/μL), pCER229 (10ng/μL), and pPFD74 (5ng/μL). Plasmid sequences and constructs are available upon request.

C. elegans transgenic strain generation

Transgenic strains were generated by microinjecting plasmid DNA into the gonads of young adult animals following established protocols (Mello and Fire 1995). Plasmids containing unc122p::eGFP, unc-122p::tagRFP, elt-7p::eGFP::NLS, and elt-7p::TagRFP-T::NLS were used as co-injection markers. Following microinjection, F1 progeny transmitting the fluorescent reporter or co-injection marker were individually isolated, and their F2 progeny were screened under a compound microscope to identify appropriate expression levels. Integrated strains were generated using the TMP/UV method, outcrossed a minimum of six times, and subsequently mapped to specific chromosomes using standard mapping strains prior to experimental use.

Dauer Induction and Exit

Dauer induction and exit were controlled using the temperature-sensitive, constitutive daf-7/TGFβ mutant allele e1372. Larva 4 (L4) stage animals were maintained at 25°C to allow dauer induction. Then, dauer larva were manually transferred to NGM plates with freshly seeded E. coli OP50 and shifted to 15°C to prompt dauer exit towards reproductive development.

Genetic screen to isolate IL2Q pruning regulators

To identify novel IL2Q neuron pruning regulators, we conducted an unbiased forward genetic screen (Supplemental Figure 1C). Animals (L4 larva) carrying the temperature-sensitive daf7(e1372) mutant allele were exposed to ethyl methanesulfonate (EMS) following previous protocols (Brenner 1974) to induce random genomic point mutations. After mutagenesis, animals were maintained at 15°C to allow for normal development. F1 animals (~3 per plate) were then transferred to 25°C to induce dauer arrest in F2 progeny. Dauer larvae were then manually transferred to NGM plates with freshly seeded E. coli OP50 and incubated at 15°C to prompt dauer exit. Nematodes at the post dauer day 1 adult stage were subsequently mounted on a 2% agarose pad, immobilized with 10mM levamisole dissolved in M9, and screened under a fluorescent compound microscope for IL2Q remodeling defects. Mutant candidates were isolated and outcrossed at least once to our control strain to confirm the heritability of the observed phenotypes. The causal variant for shy87, described in this study, were mapped by whole-genome sequencing and SNV linkage mapping with the MiModD software package run in a Galaxy server. To further confirm the identity of the isolated shy87 allele, we employed a transgenic rescue strategy utilizing a sax-1 containing fosmid and were able to successfully rescue the mutant phenotype.

IL2Q Remodeling Timeseries

Synchronized populations of dauer larva induced at 25°C, carrying a temperature-sensitive daf7(e1372) mutation, were manually transferred to NGM plates with freshly seeded E. coli OP50 and incubated at 15°C to prompt dauer exit towards reproductive development. At 8hrs posttransfer, we screened under a dissecting microscope and selected for larva that exhibited pharyngeal pumping and foraging behavior. The larvae were then kept at 15°C for further examination. Animals were then mounted on 2% agarose pads and 10mM levamisole dissolved in M9 for imaging at defined timepoints (12, 14, 16, 18, 20, 22, 24, 26, 28, 30 hours). Image acquisition settings were maintained throughout all timepoints. Quantification of remodeling events was performed as described in the IL2Q Neurite Scoring section.

Fluorescence microscopy and sample preparation

Nematodes were mounted on a 2% agarose pad and paralyzed in a droplet of 10mM Levamisole dissolved in M9 buffer. Animals were imaged at the following developmental stages: adults (normal development), dauer larva, 16–20hrs post dauer larva, and post dauer old adults, as indicated in the Figures. Images were acquired with a Laser Sage DMi8 inverted microscope (Leica) equipped with a VT-iSIM system (BioVision) and an ORCA-Flash 4.0 camera (Hamamatsu) controlled by MetaMorph Advanced Confocal Acquisition Software Package. The microscope was equipped with an HC PL APO 100x/1.47NA Oil, HC PL APO 63x/1.40NA Oil CS2, a HC PL APO 40x/1.30NA Oil CS2, and a HC PL APO 20x/0.8NA Air objective. Maximum intensity projections were generated in FIJI (ImageJ2).

CRISPR/Cas9 Genome Editing

All CRISPR-Cas9-engineered strains were generated following the Mello Lab published protocol (Dokshin et al. 2018). We synthesized sgRNA from single-stranded DNA utilizing the EnGen sgRNA Synthesis Kit, S. pygenes (NEB Cat#E3322S), followed by sgRNA purification utilizing the Monarch RNA cleanup kit (NEB #T2040). A detailed list of sgRNA target sites is provided in the Key Resources Table, along with corresponding repair templates listed.

IL2Q Neurite Scoring

Raw imaging files were imported to ImageJ2 for manual IL2Q neurite scoring. Scoring was based on the stereotypical arborization pattern of IL2Q neurons (Supplemental Figure 1A). In control animals, primary (1°) dendrites extend anteriorly from the cell body toward the nose along the pharyngeal axis. Secondary (2°) dendrites emerge perpendicularly from the 1° dendrite, extending toward the ventral and dorsal midlines. Tertiary (3°) dendrites arise from the 2° dendrites and bifurcate along the anterior-posterior axis. Quaternary (4°) dendrites extend perpendicularly from the 3° dendrites toward the body-wall muscle quadrants. In addition to anterior arborization, neurons also project posteriorly directed neurites, but these were excluded. For each animal, IL2D and IL2V pairs (four) neurons and all dendrite orders (1°–4°) were scored, and data were compiled to determine the total number of 2°, 3°, and 4° dendrites per genotype. For adults and 16–20hrs animals, the previously described scoring strategy was employed.

Fluorescence Quantification

Following acquisition, raw imaging files were processed in ImageJ2. For quantification of endogenous and cell-specific SAX-2 puncta in control and sax-1 mutants, we manually counted GFP(+) puncta across the length of the IL2D/V primary (1°) dendrite. For quantification of the generic endocytosis reporter, normalized fluorescence linescans were generated by tracing the length of an IL2D/V primary (1°) dendrite and measuring fluorescence intensity along the neurite using the Plot Profile function. Colocalized puncta between secreted GFP and IL2-expressed mCD8::tagRFP were manually counted from images of live animals.

Statistical Analysis

Statistical analyses were performed on GraphPad Prism 10. Data were tested for normality, and parametric or nonparametric tests used as appropriate. Statistical significance was determined using unpaired t-test, unpaired t-test with Welch’s correction, or Mann-Whitney U test. For multiple comparisons, we used Brown-Forsythe and Welch ANOVA test or Kruskal-Wallis test followed by a post test. Sample sizes are described in figure legends. Error bars are represented as ± SEM, with individual data points shown.

Resource Availability

Lead Contact

Further information and requests for reagents should be directed to the lead contact: Shaul Yogev (shaul.yogev@yale.edu).

Materials Availability

Plasmids and transgenic C. elegans strains generated for this study are available form the lead contact upon request.

Data and Code Availability

Raw data used for this study are available from the lead contact upon request.

Supplementary Material

1

Acknowledgements

We thank members of the Yogev lab for valuable input and technical advice. We thank OVG and GLS for plasmids. We acknowledge the Yale Center for Genome Analysis, which is supported by the NIH National Institute of General Medical Science (1S10OD030363-01A1). We thank Claire Richardson (University of Wisconsin, Madison) for generously sharing the following plasmids: pCER206 and pCER229. Some strains provided by Caenorhabditis Genome Center (CGC), which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440). We acknowledge the Mitani Lab, the National Bioresource Project for the Nematode (Japan) for alleles provided. This work was supported by R35GM133573 to SY and NIH F31-NS122294 and GE016776 to PVFD.

Footnotes

Declaration of Interests

The authors declare no competing interests.

References

  1. Altun Z.F. and Hall D.H. 2009. “Introduction.” WormAtlas. 10.3908/wormatlas.1.1 [DOI] [Google Scholar]
  2. Androwski Rebecca J., Flatt Kristen M., and Schroeder Nathan E.. 2017. “Phenotypic Plasticity and Remodeling in the Stress-Induced Caenorhabditis Elegans Dauer.” Wiley Interdisciplinary Reviews. Developmental Biology 6 (5). 10.1002/wdev.278. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bichsel Samuel J., Tamaskovic Rastislav, Stegert Mario R., and Hemmings Brian A.. 2004. “Mechanism of Activation of NDR (Nuclear Dbf2-Related) Protein Kinase by the hMOB1 Protein*.” Journal of Biological Chemistry 279 (34): 35228–35. 10.1074/jbc.M404542200. [DOI] [PubMed] [Google Scholar]
  4. Brenner S. 1974. “THE GENETICS OF CAENORHABDITIS ELEGANS.” Genetics 77 (1): 71–94. 10.1093/genetics/77.1.71. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Brunson Kristen L., Enikö Kramár, Lin Bin, Chen Yuncai, Colgin Laura Lee, Yanagihara Theodore K., Lynch Gary, and Baram Tallie Z.. 2005. “Mechanisms of Late-Onset Cognitive Decline after Early-Life Stress.” Journal of Neuroscience 25 (41): 9328–38. 10.1523/JNEUROSCI.228-105.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Burguete Alondra S., Song Yanjun, and Ghabrial Amin S.. 2024. “The Ccm3-GckIII Signaling Axis Regulates Rab11-Dependent Recycling to the Apical Compartment.” bioRxiv. 10.1101/2024.05.03.592387. [DOI] [Google Scholar]
  7. Burnell Ann M., Houthoofd Koen, O’Hanlon Karen, and Vanfleteren Jacques R.. 2005. “Alternate Metabolism during the Dauer Stage of the Nematode Caenorhabditis Elegans.” Experimental Gerontology, Metabolism, Aging and Longevity, 40 (11): 850–56. 10.1016/j.exger.2005.09.006. [DOI] [PubMed] [Google Scholar]
  8. Cassada Randall C., and Russell Richard L.. 1975. “The Dauerlarva, a Post-Embryonic Developmental Variant of the Nematode Caenorhabditis Elegans.” Developmental Biology 46 (2): 326–42. 10.1016/0012-1606(75)90109-8. [DOI] [PubMed] [Google Scholar]
  9. Cervino Ailen S., Moretti Bruno, Stuckenholz Carsten, Grecco Hernán E., Davidson Lance A., and Cirio M. Cecilia. 2021. “Furry Is Required for Cell Movements during Gastrulation and Functionally Interacts with NDR1.” Scientific Reports 11 (1): 6607. 10.1038/s41598-021-86153-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Chen Chuan, Rodriguez Pino Marbelys, Haller Patrick Roman, and Verde Fulvia. 2019. “Conserved NDR/LATS Kinase Controls RAS GTPase Activity to Regulate Cell Growth and Chronological Lifespan.” Molecular Biology of the Cell 30 (20): 2598–2616. 10.1091/mbc.E19-03-0172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Chiba Shuhei, Amagai Yuta, Homma Yuta, Fukuda Mitsunori, and Mizuno Kensaku. 2013. “NDR2mediated Rabin8 Phosphorylation Is Crucial for Ciliogenesis by Switching Binding Specificity from Phosphatidylserine to Sec15.” The EMBO Journal 32 (6): 874–85. 10.1038/emboj.2013.32. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Chiba Shuhei, Ikeda Masanori, Katsunuma Kokichi, Ohashi Kazumasa, and Mizuno Kensaku. 2009. “MST2- and Furry-Mediated Activation of NDR1 Kinase Is Critical for Precise Alignment of Mitotic Chromosomes.” Current Biology 19 (8): 675–81. 10.1016/j.cub.2009.02.054. [DOI] [PubMed] [Google Scholar]
  13. Christian K. M., Miracle A. D., Wellman C. L., and Nakazawa K.. 2011. “Chronic Stress-Induced Hippocampal Dendritic Retraction Requires CA3 NMDA Receptors.” Neuroscience 174 (February):26–36. 10.1016/j.neuroscience.2010.11.033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Chung Samuel H., Awal Mehraj R., Shay James, McLoed Melissa M., Mazur Eric, and Gabel Christopher V.. 2016. “Novel DLK-Independent Neuronal Regeneration in Caenorhabditis Elegans Shares Links with Activity-Dependent Ectopic Outgrowth.” Proceedings of the National Academy of Sciences of the United States of America 113 (20): E2852–2860. 10.1073/pnas.1600564113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Cong Jingli, Geng Wei, He Biao, Liu Jingchun, Charlton Jeannette, and Adler Paul N.. 2001. “The Furry Gene of Drosophila Is Important for Maintaining the Integrity of Cellular Extensions during Morphogenesis.” Development 128 (14): 2793–2802. 10.1242/dev.128.14.2793. [DOI] [PubMed] [Google Scholar]
  16. Das Maitreyi, Wiley David J., Chen Xi, Shah Kavita, and Verde Fulvia. 2009. “The Conserved NDR Kinase Orb6 Controls Polarized Cell Growth by Spatial Regulation of the Small GTPase Cdc42.” Current Biology: CB 19 (15): 1314–19. 10.1016/j.cub.2009.06.057. [DOI] [PubMed] [Google Scholar]
  17. Demiray Yunus E., Rehberg Kati, Kliche Stefanie, and Stork Oliver. 2018. “Ndr2 Kinase Controls Neurite Outgrowth and Dendritic Branching Through A1 Integrin Expression.” Frontiers in Molecular Neuroscience 11 (March). 10.3389/fnmol.2018.00066. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Deretic Dusanka, Tam Beatrice M, Moritz Orson L, Robichaux Michael, and Fresquez Theresa. 2023. “Rabin8 Phosphorylation by NDR2 Directs Membrane Progression in the Ciliary Trafficking of Rhodopsin.” Investigative Ophthalmology & Visual Science 64 (8): 4443. [Google Scholar]
  19. Devroe Eric, Erdjument-Bromage Hediye, Tempst Paul, and Silver Pamela A.. 2004. “Human Mob Proteins Regulate the NDR1 and NDR2 Serine-Threonine Kinases *.” Journal of Biological Chemistry 279 (23): 24444–51. 10.1074/jbc.M401999200. [DOI] [PubMed] [Google Scholar]
  20. Dokshin Gregoriy A., Ghanta Krishna S., Piscopo Katherine M., and Mello Craig C.. 2018. “Robust Genome Editing with Short Single-Stranded and Long, Partially Single-Stranded DNA Donors in Caenorhabditis Elegans.” Genetics 210 (3): 781–87. 10.1534/genetics.118.301532. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Emoto Kazuo, He Ying, Ye Bing, Grueber Wesley B., Adler Paul N., Jan Lily Yeh, and Jan Yuh-Nung. 2004. “Control of Dendritic Branching and Tiling by the Tricornered-Kinase/Furry Signaling Pathway in Drosophila Sensory Neurons.” Cell 119 (2): 245–56. 10.1016/j.cell.2004.09.036. [DOI] [PubMed] [Google Scholar]
  22. Fang Xiaolan, Lu Qiuheng, Emoto Kazou, and Adler Paul N.. 2010. “The Drosophila Fry Protein Interacts with Trc and Is Highly Mobile in Vivo.” BMC Developmental Biology 10 (1): 40. 10.1186/1471-213X-10-40. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Feng Shanshan, Knödler Andreas, Ren Jinqi, Zhang Jian, Zhang Xiaoyu, Hong Yujuan, Huang Shaohui, Peränen Johan, and Guo Wei. 2012. “A Rab8 Guanine Nucleotide Exchange Factor-Effector Interaction Network Regulates Primary Ciliogenesis.” The Journal of Biological Chemistry 287 (19): 15602–9. 10.1074/jbc.M111.333245. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Feng Shanshan, Wu Bin, Peränen Johan, and Guo Wei. 2015. “Kinetic Activation of Rab8 Guanine Nucleotide Exchange Factor Rabin8 by Rab11.” In Rab GTPases: Methods and Protocols, edited by Guangpu Li, 99–106. New York, NY: Springer. 10.1007/978-1-4939-2569-8_8. [DOI] [PubMed] [Google Scholar]
  25. Fresquez Theresa, Tam Beatrice M., Eshelman Shannon C., Moritz Orson L., Robichaux Michael A., and Deretic Dusanka. 2025. “Rabin8 Phosphorylated by NDR2, the Canine Early Retinal Degeneration Gene Product, Directs Rhodopsin Golgi-to-Cilia Trafficking.” Journal of Cell Science 138 (2): JCS263401. 10.1242/jcs.263401. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Furusawa Kotaro, and Emoto Kazuo. 2021. “Spatiotemporal Regulation of Developmental Neurite Pruning: Molecular and Cellular Insights from Drosophila Models.” Neuroscience Research, Toward understanding of integral processes of circuit formation, maintenance and elimination, 167 (June):54–63. 10.1016/j.neures.2020.11.010. [DOI] [PubMed] [Google Scholar]
  27. Gallegos Maria E., and Bargmann Cornelia I.. 2004. “Mechanosensory Neurite Termination and Tiling Depend on SAX-2 and the SAX-1 Kinase.” Neuron 44 (2): 239–49. 10.1016/j.neuron.2004.09.021. [DOI] [PubMed] [Google Scholar]
  28. Geng Wei, He Biao, Wang Mina, and Adler Paul N. 2000. “The Tricornered Gene, Which Is Required for the Integrity of Epidermal Cell Extensions, Encodes the Drosophila Nuclear DBF2-Related Kinase.” Genetics 156 (4): 1817–28. 10.1093/genetics/156.4.1817. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Gerisch Birgit, Weitzel Cindy, Kober-Eisermann Corinna, Rottiers Veerle, and Antebi Adam. 2001. “A Hormonal Signaling Pathway Influencing C. Elegans Metabolism, Reproductive Development, and Life Span.” Developmental Cell 1 (6): 841–51. 10.1016/S1534-5807(01)00085-5. [DOI] [PubMed] [Google Scholar]
  30. Gógl Gergő, Schneider Kyle D., Yeh Brian J., Alam Nashida, Nguyen Ba Alex N., Moses Alan M., Hetényi Csaba, Reményi Attila, and Weiss Eric L.. 2015. “The Structure of an NDR/LATS Kinase–Mob Complex Reveals a Novel Kinase–Coactivator System and Substrate Docking Mechanism.” PLOS Biology 13 (5): e1002146. 10.1371/journal.pbio.1002146. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Golden James W., and Riddle Donald L.. 1982. “A Pheromone Influences Larval Development in the Nematode Caenorhabditis Elegans.” Science 218 (4572): 578–80. 10.1126/science.6896933. [DOI] [PubMed] [Google Scholar]
  32. Golden James W., and Riddle Donald L..1984. “The Caenorhabditis Elegans Dauer Larva: Developmental Effects of Pheromone, Food, and Temperature.” Developmental Biology 102 (2): 368–78. 10.1016/0012-1606(84)90201-X. [DOI] [PubMed] [Google Scholar]
  33. Gottlieb S, and Ruvkun G. 1994. “Daf-2, Daf-16 and Daf-23: Genetically Interacting Genes Controlling Dauer Formation in Caenorhabditis Elegans.” Genetics 137 (1): 107–20. 10.1093/genetics/137.1.107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Gupta Sneha, and McCollum Dannel. 2011. “Crosstalk between NDR Kinase Pathways Coordinates Cell Cycle Dependent Actin Rearrangements.” Cell Division 6 (November):19. 10.1186/1747-1028-6-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Hattula Katarina, Furuhjelm Johanna, Arffman Airi, and Peränen Johan. 2002. “A Rab8-Specific GDP/GTP Exchange Factor Is Involved in Actin Remodeling and Polarized Membrane Transport.” Molecular Biology of the Cell 13 (9): 3268–80. 10.1091/mbc.e02-03-0143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. He Ying, Fang Xiaolan, Emoto Kazuo, Jan Yuh-Nung, and Adler Paul N.. 2005. “The Tricornered Ser/Thr Protein Kinase Is Regulated by Phosphorylation and Interacts with Furry during Drosophila Wing Hair Development.” Molecular Biology of the Cell 16 (2): 689–700. 10.1091/mbc.E04-09-0828. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Hergovich Alexander. 2011. “MOB Control: Reviewing a Conserved Family of Kinase Regulators.” Cellular Signalling 23 (9): 1433–40. 10.1016/j.cellsig.2011.04.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Hergovich Alexander, Bichsel Samuel J., and Brian A. and Hemmings. 2005. “Human NDR Kinases Are Rapidly Activated by MOB Proteins through Recruitment to the Plasma Membrane and Phosphorylation.” Molecular and Cellular Biology 25 (18): 8259–72. 10.1128/MCB.25.18.8259-8272.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Hergovich Alexander, Stegert Mario R., Schmitz Debora, and Hemmings Brian A.. 2006. “NDR Kinases Regulate Essential Cell Processes from Yeast to Humans.” Nature Reviews Molecular Cell Biology 7 (4): 253–64. 10.1038/nrm1891. [DOI] [PubMed] [Google Scholar]
  40. Homma Yuta, and Fukuda Mitsunori. 2016. “Rabin8 Regulates Neurite Outgrowth in Both GEF Activity-Dependent and -Independent Manners.” Molecular Biology of the Cell 27 (13): 2107–18. 10.1091/mbc.E16-02-0091. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Hu Patrick J. 2018. “Dauer.” In WormBook: The Online Review of C. Elegans Biology [Internet]. WormBook. https://www.ncbi.nlm.nih.gov/books/NBK116082/. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Hurd Daryl D, Miller Renee M, Núñez Lizbeth, and Portman Douglas S. 2010. “Specific α- and β-Tubulin Isotypes Optimize the Functions of Sensory Cilia in Caenorhabditis Elegans.” Genetics 185 (3): 883–96. 10.1534/genetics.110.116996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Irie K., Nagai T., and Mizuno K.. 2020. “Furry Protein Suppresses Nuclear Localization of Yes-Associated Protein (YAP) by Activating NDR Kinase and Binding to YAP.” J Biol Chem 295 (10): 3017–28. 10.1074/jbc.RA119.010783. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Joffre Carine, Dupont Nicolas, Hoa Lily, Gomez Valenti, Pardo Raul, Gonçalves-Pimentel Catarina, Achard Pauline, et al. 2015. “The Pro-Apoptotic STK38 Kinase Is a New Beclin1 Partner Positively Regulating Autophagy.” Current Biology: CB 25 (19): 2479–92. 10.1016/j.cub.2015.08.031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Kanamori Takahiro, Kanai Makoto I., Dairyo Yusuke, Yasunaga Kei-ichiro, Morikawa Rei K., and Emoto Kazuo. 2013. “Compartmentalized Calcium Transients Trigger Dendrite Pruning in Drosophila Sensory Neurons.” Science 340 (6139): 1475–78. 10.1126/science.1234879. [DOI] [PubMed] [Google Scholar]
  46. Kanamori Takahiro, Yoshino Jiro, Yasunaga Kei-ichiro, Dairyo Yusuke, and Emoto Kazuo. 2015. “Local Endocytosis Triggers Dendritic Thinning and Pruning in Drosophila Sensory Neurons.” Nature Communications 6 (1): 6515. 10.1038/ncomms7515. [DOI] [PubMed] [Google Scholar]
  47. Karp Xantha. 2018. “Working with Dauer Larvae.” In WormBook: The Online Review of C. Elegans Biology [Internet]. WormBook. https://www.ncbi.nlm.nih.gov/books/NBK535516/. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Knödler Andreas, Feng Shanshan, Zhang Jian, Zhang Xiaoyu, Das Amlan, Peränen Johan, and Guo Wei. 2010. “Coordination of Rab8 and Rab11 in Primary Ciliogenesis.” Proceedings of the National Academy of Sciences 107 (14): 6346–51. 10.1073/pnas.1002401107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Koike-Kumagai Makiko, Yasunaga Kei-ichiro, Morikawa Rei, Kanamori Takahiro, and Emoto Kazuo. 2009. “The Target of Rapamycin Complex 2 Controls Dendritic Tiling of Drosophila Sensory Neurons through the Tricornered Kinase Signalling Pathway.” The EMBO Journal 28 (24): 3879–92. 10.1038/emboj.2009.312. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Krämer Rafael, Rode Sandra, and Rumpf Sebastian. 2019. “Rab11 Is Required for Neurite Pruning and Developmental Membrane Protein Degradation in Drosophila Sensory Neurons.” Developmental Biology, Single-cell branching morphogenesis, 451 (1): 68–78. 10.1016/j.ydbio.2019.03.003. [DOI] [PubMed] [Google Scholar]
  51. Kuo Chay T., Jan Lily Yeh, and Jan Yuh Nung. 2005. “Dendrite-Specific Remodeling of Drosophila Sensory Neurons Requires Matrix Metalloproteases, Ubiquitin-Proteasome, and Ecdysone Signaling.” October 18, 2005. 10.1073/pnas.0507393102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Kuo Chay T., Zhu Sijun, Younger Susan, Jan Lily Y., and Jan Yuh Nung. 2006. “Identification of E2/E3 Ubiquitinating Enzymes and Caspase Activity Regulating Drosophila Sensory Neuron Dendrite Pruning.” Neuron 51 (3): 283–90. 10.1016/j.neuron.2006.07.014. [DOI] [PubMed] [Google Scholar]
  53. Lee Tzumin, Marticke Simone, Sung Carl, Robinow Steven, and Luo Liqun. 2000. “Cell-Autonomous Requirement of the USP/EcR-B Ecdysone Receptor for Mushroom Body Neuronal Remodeling in Drosophila.” Neuron 28 (3): 807–18. 10.1016/S0896-6273(00)00155-0. [DOI] [PubMed] [Google Scholar]
  54. Lin Tzu, Kao Hao-Hsiang, Chou Che-Hsuan, Chou Chih-Yu, Liao Yu-Ching, and Lee Hsiu-Hsiang. 2020. “Rab11 Activation by Ik2 Kinase Is Required for Dendrite Pruning in Drosophila Sensory Neurons.” PLOS Genetics 16 (2): e1008626. 10.1371/journal.pgen.1008626. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Lin Tzu, Pan Po-Yuan, Lai Yu-Ting, Chiang Kai-Wen, Hsieh Hsin-Lun, Wu Yi-Ping, Ke Jian-Ming, et al. 2015. “Spindle-F Is the Central Mediator of Ik2 Kinase-Dependent Dendrite Pruning in Drosophila Sensory Neurons.” PLOS Genetics 11 (11): e1005642. 10.1371/journal.pgen.1005642. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Magariños Ana Marıa, McEwen Bruce S., Flügge Gabriele, and Fuchs Eberhard. 1996. “Chronic Psychosocial Stress Causes Apical Dendritic Atrophy of Hippocampal CA3 Pyramidal Neurons in Subordinate Tree Shrews.” Journal of Neuroscience 16 (10): 3534–40. 10.1523/JNEUROSCI.16-10-03534.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. McEwen Bruce S., Nasca Carla, and Gray Jason D.. 2016. “Stress Effects on Neuronal Structure: Hippocampus, Amygdala, and Prefrontal Cortex.” Neuropsychopharmacology 41 (1): 3–23. 10.1038/npp.2015.171. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Mello Craig, and Fire Andrew. 1995. “Chapter 19 DNA Transformation.” In Methods in Cell Biology, edited by Epstein Henry F. and Shakes Diane C., 48:451–82. Cuenorhubditis Elegans: Modern Biologcal Analysis of an Organism. Academic Press. 10.1016/S0091-679X(08)61399-0. [DOI] [PubMed] [Google Scholar]
  59. Millward Thomas A., Hess Daniel, and Hemmings Brian A.. 1999. “Ndr Protein Kinase Is Regulated by Phosphorylation on Two Conserved Sequence Motifs*.” Journal of Biological Chemistry 274 (48): 33847–50. 10.1074/jbc.274.48.33847. [DOI] [PubMed] [Google Scholar]
  60. Nagai Tomoaki, and Mizuno Kensaku. 2014. “Multifaceted Roles of Furry Proteins in Invertebrates and Vertebrates.” The Journal of Biochemistry 155 (3): 137–46. 10.1093/jb/mvu001. [DOI] [PubMed] [Google Scholar]
  61. Natarajan Rajalaxmi, Barber Kara, Buckley Amanda, Cho Phillip, Egbejimi Anuoluwapo, and Wairkar Yogesh P.. 2015. “Tricornered Kinase Regulates Synapse Development by Regulating the Levels of Wiskott-Aldrich Syndrome Protein.” PLOS ONE 10 (9): e0138188. 10.1371/journal.pone.0138188. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Nishida Kei, Tsuchiya Kenta, Obinata Hiroyuki, Onodera Shizuka, Honda Yu, Lai Yen-Cheng, Haruta Nami, and Sugimoto Asako. 2021. “Expression Patterns and Levels of All Tubulin Isotypes Analyzed in GFP Knock-In C. Elegans Strains.” Cell Structure and Function 46 (1): 51–64. 10.1247/csf.21022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Norkett Rosalind, del Castillo Urko, Lu Wen, and Gelfand Vladimir I. 2020. “Ser/Thr Kinase Trc Controls Neurite Outgrowth in Drosophila by Modulating Microtubule-Microtubule Sliding.” Edited by Pfeffer Suzanne R and DeLuca Jennifer G. eLife 9 (February):e52009. 10.7554/eLife.52009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Ogura Monami, Kaminishi Tatsuya, Shima Takayuki, Torigata Miku, Bekku Nao, Tabata Keisuke, Minami Satoshi, et al. 2023. “Microautophagy Regulated by STK38 and GABARAPs Is Essential to Repair Lysosomes and Prevent Aging.” EMBO Reports 24 (12): e57300. 10.15252/embr.202357300. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Park Seungmee, Noblett Nathaniel, Pitts Lauren, Colavita Antonio, Wehman Ann M., Jin Yishi, and Chisholm Andrew D.. 2024. “Dopey-Dependent Regulation of Extracellular Vesicles Maintains Neuronal Morphology.” Current Biology: CB 34 (21): 4920–4933.e11. 10.1016/j.cub.2024.09.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Rehberg Kati, Kliche Stefanie, Madencioglu Deniz A., Thiere Marlen, Müller Bettina, Meineke Bernhard Manuel, Freund Christian, Budinger Eike, and Stork Oliver. 2014. “The Serine/Threonine Kinase Ndr2 Controls Integrin Trafficking and Integrin-Dependent Neurite Growth.” Journal of Neuroscience 34 (15): 5342–54. 10.1523/JNEUROSCI.2728-13.2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Ren Peifeng, Lim Chang-Su, Johnsen Robert, Albert Patrice S., Pilgrim David, and Riddle Donald L.. 1996. “Control of C. Elegans Larval Development by Neuronal Expression of a TGF-β Homolog.” Science 274 (5291): 1389–91. 10.1126/science.274.5291.1389. [DOI] [PubMed] [Google Scholar]
  68. Riccomagno Martin M., and Kolodkin Alex L.. 2015. “Sculpting Neural Circuits by Axon and Dendrite Pruning.” Annual Review of Cell and Developmental Biology 31 (Volume 31, 2015): 779–805. 10.1146/annurev-cellbio-100913-013038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Richardson Claire E., Yee Callista, and Shen Kang. 2019. “A Hormone Receptor Pathway CellAutonomously Delays Neuron Morphological Aging by Suppressing Endocytosis.” PLoS Biology 17 (10): e3000452. 10.1371/journal.pbio.3000452. [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Riddle Donald L. 1977. “A Genetic Pathway for Dauer Larva Formation in Caenorhabditis Elegans : (Nematode, Development, Neuron).” https://mospace.umsystem.edu/xmlui/handle/10355/67163.
  71. Riddle Donald L., Swanson Margaret M., and Albert Patrice S.. 1981. “Interacting Genes in Nematode Dauer Larva Formation.” Nature 290 (5808): 668–71. 10.1038/290668a0. [DOI] [PubMed] [Google Scholar]
  72. Roşianu Flavia, Mihaylov Simeon R., Eder Noreen, Martiniuc Antonie, Claxton Suzanne, Flynn Helen R., Jalal Shamsinar, et al. 2023. “Loss of NDR1/2 Kinases Impairs Endomembrane Trafficking and Autophagy Leading to Neurodegeneration.” Life Science Alliance 6 (2): e202201712. 10.26508/lsa.202201712. [DOI] [PMC free article] [PubMed] [Google Scholar]
  73. Rui Menglong. 2024. “Recent Progress in Dendritic Pruning of Drosophila C4da Sensory Neurons.” Open Biology 14 (7): 240059. 10.1098/rsob.240059. [DOI] [PMC free article] [PubMed] [Google Scholar]
  74. Rumpf Sebastian, Wolterhoff Neele, and Herzmann Svende. 2019. “Functions of Microtubule Disassembly during Neurite Pruning.” Trends in Cell Biology 29 (4): 291–97. 10.1016/j.tcb.2019.01.002. [DOI] [PubMed] [Google Scholar]
  75. Santos Paulo F., Fazendeiro Beatriz, Luca Francis C., Ambrósio António Francisco, and Léger Hélène. 2023. “The NDR/LATS Protein Kinases in Neurobiology: Key Regulators of Cell Proliferation, Differentiation and Migration in the Ocular and Central Nervous System.” European Journal of Cell Biology 102 (2): 151333. 10.1016/j.ejcb.2023.151333. [DOI] [PubMed] [Google Scholar]
  76. Schroeder Nathan E., Androwski Rebecca J., Rashid Alina, Lee Harksun, Lee Junho, and Barr Maureen M.. 2013. “Dauer-Specific Dendrite Arborization in C. Elegans Is Regulated by KPC-1/Furin.” Current Biology: CB 23 (16): 1527–35. 10.1016/j.cub.2013.06.058. [DOI] [PMC free article] [PubMed] [Google Scholar]
  77. Schuldiner Oren, and Yaron Avraham. 2015. “Mechanisms of Developmental Neurite Pruning.” Cellular and Molecular Life Sciences 72 (1): 101–19. 10.1007/s00018-014-1729-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  78. Shi Rebecca, Ho Xue Yan, Tao Li, Taylor Caitlin A., Zhao Ting, Zou Wei, Lizzappi Malcolm, Eichel Kelsie, and Shen Kang. 2024. “Stochastic Growth and Selective Stabilization Generate Stereotyped Dendritic Arbors.” bioRxiv. 10.1101/2024.05.08.591205. [DOI] [PubMed] [Google Scholar]
  79. Smith Cody J., Watson Joseph D., Spencer W. Clay, O’Brien Tim, Cha Byeong, Albeg Adi, Treinin Millet, and Miller David M.. 2010. “Time-Lapse Imaging and Cell-Specific Expression Profiling Reveal Dynamic Branching and Molecular Determinants of a Multi-Dendritic Nociceptor in C. Elegans.” Developmental Biology 345 (1): 18–33. 10.1016/j.ydbio.2010.05.502. [DOI] [PMC free article] [PubMed] [Google Scholar]
  80. Suzuki Atsushi, Ogura Tsutomu, and Esumi Hiroyasu. 2006. “NDR2 Acts as the Upstream Kinase of ARK5 during Insulin-like Growth Factor-1 Signaling.” Journal of Biological Chemistry 281 (20): 13915–21. 10.1074/jbc.M511354200. [DOI] [PubMed] [Google Scholar]
  81. Tamaskovic Rastislav, Bichsel Samuel J., and Hemmings Brian A.. 2003. “NDR Family of AGC Kinases – Essential Regulators of the Cell Cycle and Morphogenesis.” FEBS Letters 546 (1): 73–80. 10.1016/S0014-5793(03)00474-5. [DOI] [PubMed] [Google Scholar]
  82. Tamaskovic Rastislav, Bichsel Samuel J., Rogniaux Hélène, Stegert Mario R., and Hemmings Brian A.. 2003. “Mechanism of Ca2+-Mediated Regulation of NDR Protein Kinase through Autophosphorylation and Phosphorylation by an Upstream Kinase*.” Journal of Biological Chemistry 278 (9): 6710–18. 10.1074/jbc.M210590200. [DOI] [PubMed] [Google Scholar]
  83. Taylor Caitlin A., Yan Jing, Howell Audrey S., Dong Xintong, and Shen Kang. 2015. “RAB-10 Regulates Dendritic Branching by Balancing Dendritic Transport.” PLOS Genetics 11 (12): e1005695. 10.1371/journal.pgen.1005695. [DOI] [PMC free article] [PubMed] [Google Scholar]
  84. Ultanir Sila K., Hertz Nicholas T., Li Guangnan, Ge Woo-Ping, Burlingame Alma L., Pleasure Samuel J., Shokat Kevan M., Jan Lily Yeh, and Jan Yuh-Nung. 2012. “Chemical Genetic Identification of NDR1/2 Kinase Substrates AAK1 and Rabin8 Uncovers Their Roles in Dendrite Arborization and Spine Development.” Neuron 73 (6): 1127–42. 10.1016/j.neuron.2012.01.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  85. Verde Fulvia, Wiley David J., and Nurse Paul. 1998. “Fission Yeast Orb6, a Ser/Thr Protein Kinase Related to Mammalian Rho Kinase and Myotonic Dystrophy Kinase, Is Required for Maintenance of Cell Polarity and Coordinates Cell Morphogenesis with the Cell Cycle.” June 1998. 10.1073/pnas.95.13.7526. [DOI] [PMC free article] [PubMed] [Google Scholar]
  86. Vyas Ajai, Mitra Rupshi, Shankaranarayana Rao B. S., and Sumantra Chattarji. 2002. “Chronic Stress Induces Contrasting Patterns of Dendritic Remodeling in Hippocampal and Amygdaloid Neurons.” Journal of Neuroscience 22 (15): 6810–18. 10.1523/JNEUROSCI.22-15-06810.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  87. Westlake Christopher J., Baye Lisa M., Nachury Maxence V., Wright Kevin J., Ervin Karen E., Phu Lilian, Chalouni Cecile, et al. 2011. “Primary Cilia Membrane Assembly Is Initiated by Rab11 and Transport Protein Particle II (TRAPPII) Complex-Dependent Trafficking of Rabin8 to the Centrosome.” Proceedings of the National Academy of Sciences of the United States of America 108 (7): 2759–64. 10.1073/pnas.1018823108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  88. White J. G., Southgate E., Thomson J. N., and Brenner S.. 1986. “The Structure of the Nervous System of the Nematode Caenorhabditis Elegans.” Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences 314 (1165): 1–340. [DOI] [PubMed] [Google Scholar]
  89. Williams Darren W., and Truman James W.. 2005. “Cellular Mechanisms of Dendrite Pruning in Drosophila: Insights from in Vivo Time-Lapse of Remodeling Dendritic Arborizing Sensory Neurons.” Development 132 (16): 3631–42. 10.1242/dev.01928. [DOI] [PubMed] [Google Scholar]
  90. Wu Zhihao, Sawada Tomoyo, Shiba Kahori, Liu Song, Kanao Tomoko, Takahashi Ryosuke, Hattori Nobutaka, Imai Yuzuru, and Lu Bingwei. 2013. “Tricornered/NDR Kinase Signaling Mediates PINK1-Directed Mitochondrial Quality Control and Tissue Maintenance.” Genes & Development 27 (2): 157–62. 10.1101/gad.203406.112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  91. Yd Tay, Leda M, Spanos C, Rappsilber J, Goryachev Ab, and Sawin Ke. 2019. “Fission Yeast NDR/LATS Kinase Orb6 Regulates Exocytosis via Phosphorylation of the Exocyst Complex.” Cell Reports 26 (6). 10.1016/j.celrep.2019.01.027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  92. Zallen Jennifer A., Peckol Erin L., Tobin David M., and Bargmann Cornelia I.. 2000. “Neuronal Cell Shape and Neurite Initiation Are Regulated by the Ndr Kinase SAX-1, a Member of the Orb6/COT-1/Warts Serine/Threonine Kinase Family.” Molecular Biology of the Cell 11 (9): 3177–90. 10.1091/mbc.11.9.3177. [DOI] [PMC free article] [PubMed] [Google Scholar]
  93. Zhang Heng, Wang Yan, Lin Wong Jack Jing, Lim Kah-Leong, Liou Yih-Cherng, Wang Hongyan, and Yu Fengwei. 2014. “Endocytic Pathways Downregulate the L1-Type Cell Adhesion Molecule Neuroglian to Promote Dendrite Pruning in Drosophila.” Developmental Cell 30 (4): 463–78. 10.1016/j.devcel.2014.06.014. [DOI] [PubMed] [Google Scholar]
  94. Zhang Lei, Tang Fengyuan, Terracciano Luigi, Hynx Debby, Kohler Reto, Bichet Sandrine, Hess Daniel, et al. 2015. “NDR Functions as a Physiological YAP1 Kinase in the Intestinal Epithelium.” Current Biology: CB 25 (3): 296–305. 10.1016/j.cub.2014.11.054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  95. Zou Wei, Yadav Smita, DeVault Laura, Nung Jan Yuh, and Sherwood David R.. 2015. “RAB-10-Dependent Membrane Transport Is Required for Dendrite Arborization.” PLOS Genetics 11 (9): e1005484. 10.1371/journal.pgen.1005484. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
NIHPP2025.06.09.658633V1-supplement-1.pdf (419.1KB, pdf)

Data Availability Statement

Raw data used for this study are available from the lead contact upon request.

Articles from bioRxiv are provided here courtesy of Cold Spring Harbor Laboratory Preprints

RESOURCES