Abstract
Objective
Given the unclear relationship between Blastocystis spp. infection and colorectal cancer (CRC), this study aimed to provide insight into Blastocystis infection, assess the effect of chemotherapy on Blastocystosis in CRC patients, and explore potential links between CRC and Blastocystis subtypes (STs).
Subjects
A total of 150 participants were divided into three groups: Group I (50 CRC patients not receiving chemotherapy), Group II (50 CRC patients who were receiving chemotherapy), and Group III (50 healthy, age- and sex-matched controls).
Results
Blastocystis spp. was detected in 42 cases through microscopy and culture, with infection rates higher in Group I (40%) and Group II (32%) compared to the control group (12%). Among all participants, 86 were asymptomatic, while 64 experienced symptoms. PCR analysis confirmed Blastocystis in 26 out of the 42 cases. PCR-restriction fragment length polymorphism (RFLP) analysis identified 60% of isolates as Group A and 16% as Group C, while sequencing later confirmed that 24% belonged to Group B. PCR-sequence-tagged site (STS) analysis revealed five STs (ST1, ST2, ST3, ST5, and ST7), with ST1 (52%) and ST3 (24%) identified as the most prevalent STs.
Conclusion
Blastocystis infection was significantly higher in CRC patients, suggesting a possible association with the disease. It appears to act as an opportunistic pathogen, contributing to symptom development regardless of CRC. The absence of significant differences in ST distribution across groups indicates that Blastocystis pathogenicity is complex and not exclusively linked to specific STs.
Keywords: Blastocystis spp., Colorectal cancer, PCR-RFLP analysis, PCR-STS analysis, ST distribution
Introduction
Blastocystis spp. is a unicellular, anaerobic, eukaryotic protist commonly found in the intestinal tracts of humans and various animals. It is one of the most widespread intestinal microorganisms worldwide [1]. Infection rates range from 10% in developed countries to 60% in developing regions [2]. This organism exhibits diverse morphological forms, which contribute to its resilience and adaptability to varied environments. Its ability to transition between these forms may play a role in its persistence within the host and potentially influence its pathogenicity. Transmission occurs primarily through the fecal-oral route, with contaminated water and food being significant sources of infection [3].
In recent years, Blastocystis spp. has gained recognition as a protozoan potentially linked to gastrointestinal symptoms, though its pathogenicity remains controversial. It is frequently detected in both symptomatic and asymptomatic individuals, making its clinical significance unclear. While the exact mechanisms of pathogenicity are not fully understood, studies have associated infection with various non-specific symptoms, including abdominal pain, nausea, vomiting, anorexia, flatulence, and both acute and chronic diarrhea, as well as weight loss [4]. These symptoms are particularly pronounced in individuals with underlying health conditions, especially immunocompromised patients.
Chemotherapy-induced immunosuppression can increase susceptibility to opportunistic pathogens. Previous studies have reported higher Blastocystis infection rates in patients undergoing chemotherapy compared to healthy individuals [5]. This complex relationship emphasizes the need to examine its clinical impact on immunocompromised individuals and to evaluate how chemotherapy influences Blastocystis infection dynamics. A clearer understanding of this interaction is essential to manage Blastocystis infections in immunosuppressed patients.
Advancements in molecular diagnostics have significantly enhanced the detection and characterization of Blastocystis spp. Polymerase chain reaction (PCR)-based assays have become a widely used tool for identifying and subtyping Blastocystis from stool specimens with higher diagnostic accuracy than traditional methods. Restriction fragment length polymorphism (RFLP) analysis further aids in differentiating Blastocystis subtypes (STs) by digesting DNA at specific nucleotide sequences, generating unique fragment patterns that distinguish strains [6]. In addition, PCR-based sequence-tagged site (STS) analysis enables the identification and classification of distinct STs, improving the understanding of Blastocystis pathogenicity [7]. These molecular approaches provide crucial perception into Blastocystis infection patterns and their potential association with clinical outcomes.
Genetic analyses have identified significant diversity within Blastocystis spp., with at least 44 genetically distinct STs based on small subunit ribosomal RNA (SSU rRNA) gene sequences [8]. Of these, nine STs (ST1 to ST9) are known to colonize humans. This genetic variation has led to hypotheses that differences in pathogenicity and clinical symptoms among infected individuals may be linked to specific STs, potentially clarifying their role in symptomatic infections. ST3 exhibits the highest global distribution, followed closely by ST1 and ST2. However, the relationship between Blastocystis STs and disease remains inconclusive, warranting further molecular and clinical studies [9].
Colorectal cancer (CRC) is the third most diagnosed cancer worldwide and the fourth leading cause of cancer-related mortality [10]. Evidence suggests that various infectious agents including bacteria, viruses, and parasites may contribute to CRC risk by promoting cancer associated mechanisms. Recent studies propose that certain Blastocystis STs may increase CRC susceptibility, supporting tumor initiation and progression in specific populations [11, 12]. Some researchers hypothesize that Blastocystis may promote a pro-inflammatory environment in the gut, which could facilitate carcinogenesis through chronic immune activation and oxidative stress [13].
In view of the global burden of CRC and the emerging link between infections and cancer promoting pathways, this study aimed to provide insight into Blastocystis infection, examine the effect of chemotherapy on Blastocystis spp. infection in CRC patients, and explore whether specific Blastocystis STs are associated with the disease.
Materials and methods
Study Subjects
This study included 100 CRC patients attending the inpatient clinic of the Oncology Department, Alexandria Main University Hospital, Egypt, aged from 25 to 75 years. Females comprised the majority, accounting for 62% of the study population, while males represented 38%. Additionally, 50 healthy visiting relatives, with no history of cancer and matched for age and sex, agreed to participate as controls. Participants were categorized into three groups: Group I: 50 CRC patients not receiving chemotherapy, Group II: 50 CRC patients who were receiving chemotherapy and Group III: 50 healthy controls. Participants with intestinal co-infections were excluded from the study. Basic demographic and clinical data were collected from all participants using a predesigned questionnaire.
Stool Sample Collection
Fresh stool samples were collected from every participant and transported to the Parasitology Department laboratory of the Medical Research Institute. Each sample was divided into three portions: one for direct microscopy, a second for culture, and a third for DNA extraction and PCR analysis.
Microscopic Examination
Stool samples were thoroughly mixed and examined for Blastocystis spp. using saline and iodine wet mounts (Garcia, 2007) [14].
In Vitro Culture Technique
Blastocystis spp. was cultured by inoculating ~ 50 mg of fresh stool into modified Jones’ medium, incubated at 37 °C, and the culture interface was examined at 24, 48, and 72 h (Jones, 1946) [15].
Molecular Characterization of Blastocystis spp.
DNA Extraction and PCR Amplification
DNA extraction was performed only on stool samples that tested positive for Blastocystis, using the ZYMO Fecal Isolate DNA Kit, following the manufacturer’s instructions. To enhance performance, β-mercaptoethanol was added to the stool DNA binding buffer at a final concentration of 0.5%. PCR amplification of the SSU rRNA gene was performed using the following primer set (Wong et al., 2008) [16]:
Blas-F: (5’-GGA GGT AGT GAC AAT AAA TC-3’)
Blas-R: (5’-ACT AGG AAT TCC TCG TTC ATG-3’)
The PCR reaction followed the procedure outlined by Mohamed et al. (2017) [17] and used Red Taq master mix (Bioline, UK). Each 25 µl reaction contained 12.5 µl of 2x Red Taq master mix, 1 µl each of 10 µM forward and reverse primers, 2 µl of template DNA, and 8.5 µl of nuclease-free water. PCR cycling conditions were as follows: an initial denaturation step at 95 °C for 4 min, followed by 35 cycles of denaturation at 95 °C for one minute, annealing at 50 °C for 30 s, and extension at 72 °C for one minute. Amplified products were visualized by UV transillumination after electrophoresis on a 1% agarose gel stained with ethidium bromide. Each run included a positive control (a previously sequenced PCR-positive sample) and a negative control (nuclease-free water).
PCR-Restriction Fragment Length Polymorphism (RFLP) Analysis
PCR-RFLP analysis was used to group Blastocystis isolates, targeting a 1100 bp segment of the SSU rRNA gene. Amplified products were digested using the SpeI restriction enzyme (New England BioLabs, MA, USA), following the procedure described by Yoshikawa et al. (2011) [18].
PCR- Sequence-Tagged Site (STS) Analysis
For subtyping, isolates were analyzed using PCR with seven sequence-tagged site (STS) primer pairs as described by Yoshikawa et al., (2004) [19] and Tan et al., (2009) [20]. Primer names, sequences, and expected product sizes are provided in Table 1. Amplifications were performed in 50 µl PCR reactions containing 5 µl of template DNA (10 ng/µl) and were carried out using an Applied Biosystems Veriti Thermal Cycler. PCR-RFLP products were separated by electrophoresis on a 2% agarose gel stained with ethidium bromide, and visualized under UV transillumination. Band sizes were compared to a 100 bp DNA ladder (Promega).
Table 1.
Primer sets for differential identification of Blastocystis STs
| STS primer sets | GenBank accession no. | Sequences | Product size | ST |
|---|---|---|---|---|
| SB83 | AF166086 |
F-GAAGGACTCTCTGACGATGA R-GTCCAAATGAAAGGCAGC |
351 | 1 |
| SB155 | AF166087 |
F-ATCAGCCTACAATCTCCTC R-ATCGCCACTTCTCCAAT |
650 | 2 |
| SB227 | AF166088 |
F-ATCAGCCTACAATCTCCTC R-ATCGCCACTTCTCCAAT |
526 | 3 |
| SB332 | AF166091 |
FGCATCCAGACTACTATCAACATT R-CCATTTTCAGACAACCACTTA |
338 | 4 |
| SB340 | AY048752 |
F-TGTTCTTGTGTCTTCTCAGCTC R-TTCTTTCACACTCCCGTCAT |
704 | 5 |
| SB336 | AY048751 |
F-GTGGGTAGAGGAAGGAAAACA R-AGAACAAGTCGATGAAGTGAGAT |
317 | 6 |
| SB337 | AY048750 |
F-GTCTTTCCCTGTCTATTCTGCA R-AATTCGGTCTGCTTCTTCTG |
487 | 7 |
Sequencing of Blastocystis Isolates
To confirm genotypes identified by PCR-RFLP and to analyze samples that failed RFLP analysis, selected SSU rRNA gene-amplified products were sequenced. Sequencing was performed using the BigDye Terminator Cycle Sequencing Kit (Applied Biosystems) on an ABI Prism 310 Genetic Analyzer. Sequences were aligned using BioEdit version 7.0.1 and analyzed using BLAST program. Genotypes were confirmed by comparison with Blastocystis sequences in the NCBI database.
Statistical Analysis
Data were analyzed using IBM SPSS software, version 20.0 (Armonk, NY: IBM Corp), with significance determined at a 5% level. Quantitative data were described in terms of number and percentage. The Chi-square test, with Monte Carlo correction, was employed to compare categorical variables across groups.
Results
Demographic Characteristics of the Studied Participants
Table 2 presents the age and gender distribution among the 150 study subjects. The majority of participants in all groups aged 25–<65 years, with a smaller proportion aged 65 and above. In terms of gender, females represented the majority in all groups, accounting for 62% of the total study population.
Table 2.
Distribution of CRC patients and controls by age and gender
| Group I (n = 50) |
Group II (n = 50) |
Group III (n = 50) |
Total (n = 150) |
|||||
|---|---|---|---|---|---|---|---|---|
| No. | % | No. | % | No. | % | No. | % | |
| Age (years) | ||||||||
| 25- < 45 | 26 | 52.0 | 22 | 44.0 | 20 | 40.0 | 68 | 45.3 |
| 45- < 65 | 20 | 40.0 | 18 | 36.0 | 17 | 34.0 | 55 | 36.7 |
| > 65 | 4 | 8.0 | 10 | 20.0 | 13 | 26.0 | 27 | 18.0 |
| Gender | ||||||||
| Male | 17 | 34.0 | 19 | 38.0 | 21 | 42.0 | 57 | 38.0 |
| Female | 33 | 66.0 | 31 | 62.0 | 29 | 58.0 | 93 | 62.0 |
Detection Rates of Blastocystis spp. Using Microscopy and Culture
Microscopically, Blastocystis spp. was detected in 40 cases (26.7%). The culture method identified Blastocystis spp. in 35 participants (23.3%), missing seven cases detected by microscopy but identifying two cases that were negative by microscopy (data not shown in the table). Thus the total number of infected participants was 42 (28%), the highest infection rate was in Group I (40%), followed by Group II (32%), with the lowest in Group III (12%). Statistical analysis showed significant differences between CRC patients and controls (Table 3).
Table 3.
Blastocystis spp. detection among participants in the different groups using microscopy and culture
| Groups |
Blastocystis spp. negative |
Blastocystis spp. positive |
p value x2=10.317 |
||
|---|---|---|---|---|---|
| No. | % | No. | % | ||
| Group I (50) | 30 | 27.7 | 20 | 40 |
p = 0.005* p1 = 0.404 p2 = 0.001* p3 = 0.015* |
| Group II (50) | 34 | 31.5 | 16 | 32 | |
| Group III (50) | 44 | 40.7 | 6 | 12 | |
| Total (150) | 108 | 72 | 42 | 28 | |
χ2: Chi square test
p: p value for comparing between the studied groups
p1: p value for comparing between Group I and Group II
p2: p value for comparing between Group I and Group III
p3: p value for comparing between Group II and Group III
*: Statistically significant at p ≤ 0.05
Group I: CRC patients not receiving chemotherapy
Group II: CRC patients on chemotherapy
Group III: Controls
Age and Gender Characteristics of Blastocystis spp. Infected Cases
Table 4 shows that Blastocystis infection rates were slightly higher in younger and middle-aged adults (29.4% and 29.1%) compared to older participants (22.2%). Males had a significantly higher infection rate (38.6%) than females (21.5%).
Table 4.
Distribution of Blastocystis-positive cases by age and gender
| Demographic data | No. examined | No. positive | % positive | x2 p value |
|---|---|---|---|---|
| Age (years) | ||||
| 25- < 45 | 68 | 20 | 29.4 | |
| 45- < 65 | 55 | 16 | 29.1 |
0.546 0.760 |
| > 65 | 27 | 6 | 22.2 | |
| All ages | 150 | 42 | 28 | |
| Gender | ||||
| Male | 57 | 22 | 38.6 | |
| Female | 93 | 20 | 21.5 |
5.120 0.023* |
| Total | 150 | 42 | 28 |
χ2: Chi square test *: Statistically significant at p ≤ 0.05
p: p value for comparing between the studied groups
Clinical Data and Symptom Analysis among Participants
Among the 150 participants 86 (57.3%) were asymptomatic, while 64 (43.3%) complained of various symptoms. Diarrhea and abdominal pain were the most commonly reported complaints; however, abdominal pain was the only symptom that showed a statistically significant difference. Nausea and vomiting were reported less frequently across all groups (Table 5).
Table 5.
Clinical data among the 150 participants
| Symptoms | Group I (n = 50) |
Group II (n = 50) |
Group III (n = 50) |
Total (n = 150) |
χ2 | P | ||||
|---|---|---|---|---|---|---|---|---|---|---|
| No. | % | No. | % | No. | % | No. | % | |||
| Asymptomatic | 26 | 52.0 | 23 | 46.0 | 37 | 74.0 | 86 | 57.3 | – | – |
| Symptomatic | 24 | 48 | 27 | 54 | 13 | 26 | 64 | 43 | ||
| Nausea | 2 | 4.0 | 3 | 6.0 | 0 | 0.0 | 5 | 3.3 | 2.878 | MCp=0.371 |
| Vomiting | 2 | 4.0 | 1 | 2.0 | 1 | 2.0 | 4 | 2.6 | 0.680 | MCp=1.000 |
| Abdominal pain | 9 | 18.0 | 15 | 30.0 | 1 | 2.0 | 25 | 16.6 | 14.208* | 0.001* |
| Diarrhea | 13 | 26.0 | 14 | 28.0 | 8 | 16.0 | 35 | 32.3 | 2.311 | 0.315 |
x2: Chi square test MCp: Monte Carlo *: Statistically significant at p ≤ 0.05
p: p value for comparing between the studied groups
Group I: CRC patients not receiving chemotherapy
Group II: CRC patients on chemotherapy
Group III: Controls
Table 6 shows the association between Blastocystis infection and/or CRC regarding the absence or presence of symptoms. Participants were categorized into four groups: Group A: Controls/Blastocystis-negative (44/50), Group B: All CRC/Blastocystis-negative (64/100), Group C: All CRC/Blastocystis-positive (36/100) and Group D: All Blastocystis-positive (Controls and CRC) (42/150). No statistically significant difference was observed between Blastocystis-negative groups (A and B) and Blastocystis-positive groups (C and D).
Table 6.
Association between Blastocystis infection, CRC and symptoms
| Groups | No. examined | Asymptomatic | Symptomatic | ||
|---|---|---|---|---|---|
| No. | % | No. | % | ||
| A (Controls/Blastocystis-negative) | 44/50 | 34 | 77 | 10 | 23 |
| B (CRC/Blastocystis-negative) | 64/100 | 49 | 76.5 | 15 | 23.5 |
| C (CRC/Blastocystis-positive) | 36/100 | 13 | 36 | 23 | 64 |
| D (All Blastocystis positives) | 42/150 | 16 | 38 | 26 | 62 |
|
x 2 p value |
29.792 0.001* |
||||
|
p1 p2 |
0.931 0.856 |
||||
*: Statistically significant at p ≤ 0.05
x2: Chi square test
Impact of Chemotherapy on Blastocystis Infection Rates and Clinical Status in Blastocystis-infected CRC Patients
Table 7 shows that Blastocystis infection rates were higher in Group I (40%) than in Group II (32%), with no significant difference between the groups. It also compares the clinical condition of Blastocystis-infected CRC patients. In Group I, 45% were asymptomatic and 55% symptomatic, whereas Group II had fewer asymptomatic cases (25%) and more symptomatic cases (75%).
Table 7.
Effect of chemotherapy on Blastocystis infection and on the presence or absence of symptoms in Blastocystis-infected CRC patients
| Groups | Blastocystosis | |||||||
|---|---|---|---|---|---|---|---|---|
| Infection rate | Asymptomatic | Symptomatic | ||||||
| No. +ve | % +ve | No. -ve | % -ve | No. +ve | % +ve | No. -ve | % -ve | |
| Group I (50) | 20 | 40 | 30 | 60 | 9 | 45 | 11 | 55 |
| Group II (50) | 16 | 32 | 34 | 64 | 4 | 25 | 12 | 75 |
|
x 2 p value |
0.694 0.404 |
1.541 0.214 |
||||||
χ2: Chi square test
p: p value for comparing between the studied groups
Group I: CRC patients not receiving chemotherapy
Group II: CRC patients on chemotherapy
Results of PCR among Positive Cases
As shown in Table 8; Fig. 1, molecular analysis was performed on 42 Blastocystis-positive stool samples. DNA extraction confirmed 26 positive cases, including 12 from Group I, 10 from Group II, and 4 from Group III.
Table 8.
Blastocystis spp. among positive cases using PCR
| PCR | Group I (n = 20) |
Group II (n = 16) | Group III (n = 6) | Total (n = 42) |
||||
|---|---|---|---|---|---|---|---|---|
| No. | % | No. | % | No. | % | No. | % | |
| Positive | 12 | 60 | 10 | 62.5 | 4 | 66.6 | 26 | 61.9 |
| Negative | 8 | 40 | 6 | 37.5 | 2 | 33.4 | 16 | 38.1 |
Group I: CRC patients not receiving chemotherapy
Group II: CRC patients on chemotherapy
Group III: Controls
Fig. 1.
Demonstrative 1% agarose gel with amplification of the Blastocystis-specific 1100 bp target of the SSU rRNA gene. Lane L contains the 100 bp DNA ladder; Lane 1 is the negative control; Lanes 2, 3, 6, 7, 9 and 10 show positive results for Blastocystis spp.; and Lanes 4, 5, and 8 show negative results for the Blastocystis spp. gene
Grouping and Subtyping of Blastocystis by PCR-RFLP and STS-PCR Analysis
Blastocystis isolates were grouped based on RFLP analysis of the amplified 1100 bp SSU rRNA gene target. Two groups were identified: Group A (≈ 200 bp and 450 bp) with 15 isolates and Group C (≈ 470 bp and 650 bp) with 4 isolates (Fig. 2). PCR-RFLP analysis did not identify Group B, which was later detected through sequencing. PCR-STS analysis further subtyped Group A into ST1 (52%) and ST2 (8%) and Group C into ST5 (12%) and ST7 (4%).
Fig. 2.
RFLP and STS-PCR analysis of Blastocystis spp. A) RFLP-PCR of the 1100 bp SSU rRNA gene showing digestion patterns for Blastocystis Group A (≈ 450 bp and 200 bp, Lane 3) and Group C (≈ 470 bp and 640 bp, Lanes 2 and 4); Lane L: 100 bp DNA ladder. B) RFLP-PCR profile for Group C (Lanes 3–5); Lane L: 1000 bp DNA ladder. C) STS-PCR showing STs: ST1 (400 bp, Lane 1) and ST5 (700 bp, Lanes 2 and 6); Lane L: 100 bp DNA ladder
DNA Sequencing
To confirm the genetic classification, 13 samples (seven RFLP-failed cases, three weak band cases, and three randomly selected positive samples) were further analyzed by SSU rRNA gene sequencing. BLAST analysis identified six isolates as Group B, representing 24% of the total detected isolates. Results of the sequencing data are summarized in Table 9.
Table 9.
Genotyping results of 13 sequenced samples with GenBank accession numbers
| Subtypes | Patients group | GenBank accession number |
|---|---|---|
| ST1 | I | KY823345.1 |
| ST1 | I | MK375239.1 |
| ST1 | II | KY823345.1 |
| ST2 | I | MK801368.1 |
| ST3 | I | MT330277.1 |
| ST3 | II | MC330277.1 |
| ST3 | II | MN914081.1 |
| ST3 | II | MK375226.1 |
| ST3 | III | MK375277.1 |
| ST3 | III | MK375225.1 |
| ST5 | I | KC148209.1 |
| ST5 | II | EF209016.1 |
| ST7 | I | MT898459.1 |
Group I: CRC patients not receiving chemotherapy
Group II: CRC patients on chemotherapy
Group III: Controls
Frequency of Blastocystis spp. STs
ST1 was the most prevalent Blastocystis ST, detected in 50% of Group I and 66.7% of Group II. ST3 was the second most common, while ST5 and ST7 were less frequent, with ST7 found only in Group I. In Group III, ST3 was the most common (50%), followed by ST1 and ST2 (25% each). No statistically significant differences were observed in ST distribution among the groups (Table 10).
Table 10.
Distribution of Blastocystis STs among the study groups
| Subtypes | Group I no. Infected (12) |
Group II no. Infected (9) |
Group III no. Infected (4) |
Total STs (25) |
χ2 | MC p |
|---|---|---|---|---|---|---|
| ST1 | 6 (50.0%) | 6 (66.7%) | 1 (25.0%) | 13 (52%) | 1.887 | 0.435 |
| ST2 | 1 (8.3%) | 0 (0.0%) | 1 (25.0%) | 2 (8%) | 2.358 | 0.423 |
| ST3 | 2 (16.7%) | 2 (22.2%) | 2 (50.0%) | 6 (24%) | 1.917 | 0.391 |
| ST5 | 2 (16.7%) | 1 (11.1%) | 0 (0.0%) | 3 (12%) | 0.678 | 1.000 |
| ST7 | 1 (8.3%) | 0 (0.0%) | 0 (0.0%) | 1 (4%) | 1.462 | 1.000 |
| χ2 (π) | 6.493 (0.718) | |||||
χ2: Chi square test MCp: Monte Carlo
Group I: CRC patients not receiving chemotherapy
Group II: CRC patients on chemotherapy
Group III: Controls
Discussion
A growing body of research suggests that Blastocystis spp. may play a role in CRC development. In the present study, among the 150 participants, Blastocystis spp. was detected in 42 cases (28%) using both microscopy and culture. Microscopy identified Blastocystis in 26.7% of cases with 100% specificity, attributed to the expertise of highly skilled technicians. However, culture, often considered the gold standard, showed a lower detection rate (23.3%). This discrepancy may be due to challenges in the culture process, resulting from microbial interference or parasite degradation during incubation. The interplay between patient health status and detection methodologies appears to be a key factor influencing Blastocystis spp. prevalence in CRC patients. A higher infection rate was observed in CRC patients compared to healthy controls. Consistently, Sulżyc-Bielicka et al. (2021) [21] reported a higher Blastocystis prevalence in CRC patients (12.15%) compared to controls (2.42%) using light microscopy. In contrast, Ali et al. (2021) [22] found higher prevalence rates in both CRC patients (52%) and controls (42%) using in vitro culture. These inconsistencies suggest the necessity for employing multiple diagnostic methods to achieve more accurate estimates of Blastocystis prevalence.
Blastocystis infection rates did not significantly differ across age groups. However, a significantly higher infection rate was observed in males compared to females (38.6% vs. 21.5%).
The pathogenicity of Blastocystis spp. remains a subject of debate, as evidenced by its detection in both symptomatic and asymptomatic individuals. In this study, 86 out of 150 participants (57%) were asymptomatic, while 64 (43%) reported symptoms. Abdominal pain and diarrhea were the most prevalent, while other symptoms were less frequent and showed no significant variation across groups. Other studies, including one by Abu Sheishaa et al. (2023) [23], reported a higher prevalence of Blastocystis in asymptomatic individuals, suggesting weak association with clinical symptoms. Similarly, a study conducted in Senegal found that symptomatic Blastocystis-infected patients frequently experienced diarrhea, abdominal pain, and dyspeptic disorders, although many asymptomatic carriers were also identified [24].
Regarding Blastocystis infection and CRC, in the present study, Blastocystis infection rates were higher in CRC patients (irrespective of treatment) compared to controls. Previous studies have reported higher Blastocystis infection rates in patients undergoing chemotherapy compared to healthy individuals. A 2023 case-control study in the UAE found Blastocystis in 40.4% of cancer patients versus 17.3% of healthy controls [11]. Likewise, a 2021 study in Poland found Blastocystis infection to be five times more likely in CRC patients (12.6%) than in controls (2.6%) [21]. These findings suggest that the immunocompromised status associated with cancer may contribute to increased Blastocystis spp. prevalence.
The inclusion of both chemotherapy and non-chemotherapy CRC patients aimed to assess whether chemotherapy influences Blastocystis infection rate. Chemotherapy is known to alter the gut microenvironment, potentially affecting parasite survival and reducing Blastocystis spp. viability. While it may exert a toxic effect on the parasite, ultimately limiting its survival, Blastocystis spp. has the ability to modulate the host immune response which may contribute to its persistence despite chemotherapy. The parasite employs several mechanisms to evade immune responses, including the degradation of secretory immunoglobulin A (sIgA), evasion of host defenses, and alteration of cytokine production, such as interleukin-8, which disrupts local immune responses [25]. These adaptations enable Blastocystis spp. to persist in immunocompromised hosts, where a weakened immune system may struggle to control colonization. This dual effect, where chemotherapy-induced immunosuppression may decrease parasite viability, yet Blastocystis’ immune-modulating properties allow it to persist, creates a complex interaction that calls for further study [26].
Regarding the impact of chemotherapy on the clinical condition of Blastocystis-infected CRC patients, a lower proportion of symptomatic cases was observed in Group I (55%) compared to Group II (75%), despite the lower infection rate in chemotherapy-treated patients. Although this difference did not reach statistical significance (p = 0.214), this suggests that while chemotherapy may lower infection rates it does not necessarily alleviate symptoms in Blastocystis-infected CRC patients and could even contribute to increased symptom manifestation, possibly due to chemotherapy-induced immunosuppression.
A comparative analysis was conducted to determine whether Blastocystis infection or CRC plays a more significant role in symptom development. The comparison between Blastocystis-negative controls (Group A) and Blastocystis-negative CRC patients (Group B) revealed no significant difference, indicating that CRC alone does not substantially contribute to gastrointestinal symptoms in the absence of Blastocystis infection. Similarly, the comparison between Blastocystis-positive CRC patients (Group C) and all Blastocystis-positive individuals (Group D) showed no statistically significant difference (p2 = 0.856). These findings reinforce the idea that Blastocystis infection, rather than CRC itself, plays a primary role in symptom development, supporting its classification as a potential opportunistic pathogen. In line with these findings, Stensvold et al. (2009) [27] suggested a possible association between Blastocystis infection and CRC development, potentially exacerbating gastrointestinal symptoms. Likewise, Mohamed et al. (2017) [17] reported a significant presence of Blastocystis in CRC patients but found no direct correlation with specific gastrointestinal manifestations.
In the present study, PCR analysis detected Blastocystis spp. in 26 out of 42 (61.9%) of positive samples. This detection rate is low compared to traditional methods like microscopy and culture. Factors such as DNA degradation, ineffective extraction, or the presence of inhibitors in stool samples may contribute to this reduced detection rate, influencing detection outcomes. These challenges align with findings from other studies, where PCR detection rates varied based on sample quality, the choice of PCR primers and protocols can significantly impact detection sensitivity, as variations in target gene regions and amplification conditions may lead to inconsistent results across different studies [28, 29].
Conversely, other studies have reported higher detection rates of Blastocystis in CRC patients using PCR. A study conducted in Poland found that PCR detected Blastocystis in 12.63% of CRC patients, which was significantly higher than in the control group (2.63%) [20]. Similarly, research from the UAE reported a 60% prevalence of Blastocystis in CRC patients using molecular methods [11].
PCR-RFLP analysis revealed that most Blastocystis isolates belonged to Group A (60%), and Group C (16%). Further subtyping with PCR-STS primers identified five distinct STs (ST1, ST2, ST3, ST5, and ST7), with ST1 (52%) and ST3 (24%) being the most predominant. ST1 was most frequent among non-chemotherapy CRC patients, a pattern potentially linked to its association with gastrointestinal symptoms and potential pathogenicity. However, no significant differences in ST distribution were observed between CRC patients and healthy controls, suggesting that Blastocystis infection itself, rather than a specific ST, may be associated with CRC development. The relationship between Blastocystis STs and CRC remains complex, as studies present conflicting evidence [21, 30, 31].
While some studies suggest a potential pathogenic role for specific STs [12, 17], others [30, 31], including the present study, found no significant differences in ST distribution between CRC patients and healthy controls. This inconsistency highlights the intricate nature of Blastocystis involvement in CRC. Several studies have investigated this association further, Khaled et al. [32] and Kumarasamy et al. [12] reported frequent detection of Blastocystis in CRC patients, with ST1 and ST3 being the most common STs. They proposed that Blastocystis may contribute to CRC progression by altering the host immune response and increasing oxidative stress. Conversely, Mohamed et al. (2017) [17] identified a significant association between ST1 and CRC, suggesting a ST-specific role in carcinogenesis. They hypothesized that ST1 might influence CRC development by inhibiting apoptosis in colon cancer cells and promoting their proliferation through the downregulation of host immune responses [33].
This study identified only single-subtype infections. The absence of mixed ST infections could be attributed to several factors. One possible explanation is the selective outgrowth of a dominant ST, where certain STs may have a competitive advantage within the host environment, leading to their predominance. Additionally, competitive interactions between STs within the host may influence which ST prevails, potentially limiting the coexistence of multiple STs. This suggests that the pathogenic potential of Blastocystis may be more closely linked to factors such as the host’s immune response, specific ST characteristics, and interactions with the intestinal microbiota. In contrast, mixed infections have been reported in other populations [34]. A study conducted in Colombia identified mixed infections in 8.7% of samples, with ST1 and ST3 being the most prevalent combinations [34].
In conclusion, this study suggests a potential link between Blastocystis spp. infection and CRC, though no significant differences in ST distribution were observed. Blastocystis may act as an opportunistic pathogen contributing to gastrointestinal symptoms, while chemotherapy appears to reduce infection rates without easing symptoms, possibly due to immune suppression. Further research is needed to determine whether Blastocystis is a true risk factor for CRC or merely an opportunistic colonizer in immunocompromised patients.
Limitations of the molecular study include the relatively small sample size, which may affect the precision and reliability of the results.
Acknowledgements
The authors would like to express their deep gratitude to Professor Hoda Fahmy Farag, Parasitology Department, Medical Research Institute, Alexandria University, for her insightful comments, and valuable contributions to the revision and improvement of this manuscript.
Author Contributions
A.S. contributed to the design layout, conception and implementation of the study, interpretation of the results, and manuscript writing. M.E. and A.A. contributed to the implementation of the study, result interpretation and manuscript writing. N.A. contributed to the design layout, conception and implementation of the study, interpretation of the results, and manuscript writing. B.M. collected the stool samples, assisted in the implementation of the study and manuscript writing. R.E. and M.I. contributed to the interpretation of the results and reviewed the manuscript.
Funding
Open access funding provided by The Science, Technology & Innovation Funding Authority (STDF) in cooperation with The Egyptian Knowledge Bank (EKB). Open access funding provided by The Science, Technology & Innovation Funding Authority (STDF) in cooperation with The Egyptian Knowledge Bank (EKB). Open access funding provided by The Science, Technology & Innovation Funding Authority (STDF) in cooperation with The Egyptian Knowledge Bank (EKB). Open access funding provided by The Science, Technology & Innovation Funding Authority (STDF) in cooperation with The Egyptian Knowledge Bank (EKB). Open access funding provided by The Science, Technology & Innovation Funding Authority (STDF) in cooperation with The Egyptian Knowledge Bank (EKB). No additional funding was received to support the research work itself.
Data Availability
All data generated or analyzed during this study are included in this published article.
Declarations
Ethical Approval
The study protocol was approved from the Research Ethics Committee of the Medical Research Institute (MRI), Alexandria University.
Informed Consent
All participants provided informed consent after receiving an explanation of the study’s purpose. Cases with Blastocystis received standard treatment.
Competing Interests
The authors declare no competing interests.
Footnotes
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Hublin JSY, Maloney JG, Santin M (2021) Blastocystis in domesticated and wild mammals and birds. Res Vet Sci 135:260–282 [DOI] [PubMed] [Google Scholar]
- 2.Havelaar AH, Kirk MD, Torgerson PR, Gibb HJ, Hald T, Lake RJ et al (2015) World health organization global estimates and regional comparisons of the burden of foodborne disease in 2010. PLoS Med 12(12):e1001923 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Duda A, Kosik-Bogacka D, Lanocha N, Szymański S (2014) Blastocystis hominis—Komensal Czy patogen? [Blastocystis homini—parasites or commensals?]. Ann Acad Me Stetin60:23–28 [PubMed] [Google Scholar]
- 4.Pawelec-Pęciak O, Łanocha-Arendarczyk N, Grzeszczak K, Kosik-Bogacka D (2025) The role of Blastocystis spp. Etiology Gastrointest Autoimmune Dis Pathogens 14:313. 10.3390/pathogens14040313 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Chandramathi S, Suresh K, Anita ZB, Kuppusamy UR (2012) Infections of blastocystis hominis and microsporidia in cancer patients: are they opportunistic? Trans R Soc trop med hyg. 106(4):267–269. 10.1016/j.trstmh.2011.12.008. Epub 2012 Feb 14. PMID: 22340948 [DOI] [PubMed]
- 6.El-Taweel H, Isaa YA, Shehata GA, Gaballah A, Lotfy WM, Tolba MM (2020) Restriction fragment length polymorphism (RFLP) analysis of blastocystis spp. In symptomatic and asymptomatic Individuals from alexandria, Egypt. Parasitol United J 13:164–171 [Google Scholar]
- 7.Salehi Sangani G, Hosseini-Safa A, Hosseini Farash BR, Salehi Sangani P, Zarean M, Moghaddas E, Zoghdar Moghadam S, Jarahi L, Gholizadeh A, Berenji F (2025) Detection and subtyping of blastocystis sp. in human and animal stool samples using high-resolution melting analysis. BMC Infect Dis 5(1):171. 10.1186/s12879-024-10423-yPMID: 39910463; PMCID: PMC11800531 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Matovelle C, Quílez J, Tejedor MT, Beltrán A, Chueca P, Monteagudo LV (2024) subtype distribution of Blastocystis spp. in patients with gastrointestinal symptoms in northern Spain. Microorganisms. 27;12(6):1084. 10.3390/microorganisms12061084. PMID: 38930466; PMCID: PMC11205523 [DOI] [PMC free article] [PubMed]
- 9.Kosik-Bogacka D, Lepczyńska M, Kot K, Szkup M, Łanocha-Arendarczyk N, Dzika E, Grochans E (2021) Prevalence, subtypes and risk factors of Blastocystis spp. Infection among Pre- and perimenopausal women. BMC Infect Dis 21:1125. 10.1186/s12879-021-06815-z [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Ferlay J, Soerjomataram I, Dikshit R, Eser S, Mathers C, Rebelo M et al (2015) Cancer incidence and mortality worldwide: sources, methods and major patterns in GLOBOCAN 2012. Int J Cancer 136(5):E359–E386 [DOI] [PubMed] [Google Scholar]
- 11.Labania L, Zoughbor S, Ajab S, Olanda M, Shantour SNM, Al Rasbi Z (2023) The associated risk of Blastocystis infection in cancer: A case control study. Front Oncol 20:13:1115835. 10.3389/fonc.2023.1115835PMID: 36890816; PMCID: PMC9986623 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Kumarasamy V, Atroosh WM, Anbazhagan D, Abdalla MMI, Azzani M (2022) Association of Blastocystis hominis with colorectal cancer: A systematic review of in vitro and in vivo evidences. World J Gastrointest Oncol 15(3):734–745. 10.4251/wjgo. PMID: 35321272; PMCID: PMC8919012.13. Diagnostic Medical Parasitology2016 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Aykur M, Malatyalı E, Demirel F, Cömert-Koçak B, Gentekaki E, Tsaousis AD, Dogruman-Al F (2024) Blastocystis: a mysterious member of the gut microbiome. Microorganisms;24;12(3):461. 10.3390/microorganisms12030461. PMID: 38543512; PMCID: PMC10972062 [DOI] [PMC free article] [PubMed]
- 14.Garcia LS (2016) Diagnostic medical parasitology, 6th edn. ASM, Washington DC., pp 27–37 [Google Scholar]
- 15.Jones WR (1946) The experimental infection of rats with Entamoeba histolytica; with a method for evaluating the anti-amoebic properties of new compounds. Ann Trop Med Parasitol 40:130–140 [DOI] [PubMed] [Google Scholar]
- 16.Wong KH, Ng GC, Lin RT, Yoshikawa H, Taylor MB, Tan KS (2008) Predominance of subtype 3 among Blastocystis isolates from a major hospital in Singapore. Parasitol Res 102(4):663–670 [DOI] [PubMed] [Google Scholar]
- 17.Mohamed AM, Ahmed MA, Ahmed SA, Al-Semany SA, Alghamdi SS, Zaglool D (2017) Predominance and association risk of blastocystis hominis subtype I in colorectal cancer: a case control study. Infect Agent Cancer 12:21 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Yoshikawa H, Dogruman-Al F, Turk S, Kustimur S, Balaban N, Sultan N (2011) Evaluation of DNA extraction kits for molecular diagnosis of human blastocystis subtypes from fecal samples. Parasitol Res 109(4):1045–1050 [DOI] [PubMed] [Google Scholar]
- 19.Yoshikawa H, Abe N, Wu Z (2004) PCR-based identification of zoonotic isolates of blastocystis from mammals and birds. Microbiology 150(Pt 5):1147–1151 [DOI] [PubMed] [Google Scholar]
- 20.Tan TC, Ong SC, Suresh KG (2009) Genetic variability of Blastocystis spp. isolates obtained from cancer and HIV/AIDS patients. Parasitol Res 105(5):1283–1286 [DOI] [PubMed] [Google Scholar]
- 21.Sulżyc-Bielicka V, Kołodziejczyk L, Adamska M, Skotarczak B, Jaczewska S, Safranow K, Bielicki P, Kładny J, Bielicki D (2021) Colorectal cancer and Blastocystis sp. infection. Parasit Vectors 14;14(1):200. 10.1186/s13071-021-04681-x. PMID: 33853659; PMCID: PMC8048192 [DOI] [PMC free article] [PubMed]
- 22.Ali SH, Ismail MAM, El-Badry AA et al (2022) An association between Blastocystis subtypes and colorectal Cancer patients: A significant different profile from Non-Cancer individuals. Acta Parasit 67:752–763. 10.1007/s11686-021-00508-y [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Abu-Sheishaa G, Ahmad H, Abdelhameed K, Ali N (2023) Blastocystis species prevalence and associated patient characteristics as predictors among a cohort of symptomatic and asymptomatic Egyptians. Al-Azhar Intern Med J 4(3):19. 10.58675/2682-339X.1712 [Google Scholar]
- 24.Sylla K, Sow D, Lelo S, Dieng T, Tine RC, Faye B (2022) Blastocystis sp. Infection: prevalence and clinical aspects among patients attending to the laboratory of Parasitology–Mycology of Fann university hospital. Dakar Senegal Parasitol 2(4):292–301. 10.3390/parasitologia2040024 [Google Scholar]
- 25.Puthia MK, Vaithilingam A, Lu J, Tan KSW (2005) Degradation of human secretory Immunoglobulin a by blastocystis. Parasitol Res 97:386–389. 10.1007/s00436-005-1461-0 [DOI] [PubMed] [Google Scholar]
- 26.Asghari A, Zare M, Hatam G, Shahabi S, Gholizadeh F, Motazedian M (2020) Molecular identification and subtypes distribution of blastocystis sp. isolated from children and adolescent with cancer in iran: evaluation of possible risk factors and clinical features. Acta Parasitol 65(2):462–473. 10.2478/s11686-020-00186-2 [DOI] [PubMed] [Google Scholar]
- 27.Stensvold CR, Lewis HC, Hammerum AM, Porsbo LJ, Nielsen SS, Olsen KE, Arendrup MC, Nielsen HV, Mølbak K (2009) Blastocystis: unravelling potential risk factors and clinical significance of a common but neglected parasite. Epidemiol Infect 137(11):1655-63. 10.1017/S0950268809002672. Epub 2009 Apr 27. PMID: 19393117 [DOI] [PubMed]
- 28.Eida AM, Eida MM (2008) Identication of Blastocystis hominis in patients with irritable bowel syndrome using microscopy and culture compared to PCR. Parasitol United J 1(2):87–92 [Google Scholar]
- 29.Parkar U, Traub RJ, Kumar S, Mungthin M, Vitali S, Leelayoova S, Morris K, Thompson RC (2007) Direct characterization of Blastocystis from faeces by PCR and evidence of zoonotic potential. Parasitol 134(3):359– 67. 10.1017/S0031182006001582 [DOI] [PubMed]
- 30.Tocci S, Das S, Sayed IM (2024) an update on Blastocystis: possible mechanisms of Blastocystis-mediated colorectal cancer. Microorganisms 22;12(9):1924. PMID: 39338600; PMCID: PMC11433781 10.3390/microorganisms12091924 [DOI] [PMC free article] [PubMed]
- 31.Tunali V, Nagavci B, Carmena D et al (20225) relationship between Blastocystis infection and clinical outcomes: A scoping review protocol [version 1; peer review: 4 approved]. Open Res Europe 5:15 (10.12688/openreseurope.19281.1) [DOI] [PMC free article] [PubMed]
- 32.Khaled S, Gantois N, Ayoubi A, Even G, Sawant M, El Houmayraa J et al (2021) Blastocystis sp. Prevalence and Subtypes Distribution amongst Syrian Refugee Communities Living in North Lebanon. Microorganisms;9(1) [DOI] [PMC free article] [PubMed]
- 33.Mohamed RT, El-Bali MA, Mohamed AA, Abdel-Fatah MA, El-Malky MA, Mowafy NM et al (2017) Subtyping of Blastocystis sp. isolated from symptomatic and asymptomatic individuals in makkah, Saudi Arabia. Parasit Vectors 10(1):174 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Garcia-Montoya GM, Galvan-Diaz AL, Alzate JF (2023) Metataxomics reveals Blastocystis subtypes mixed infections in Colombian children. Infect Genet Evol; 113:105478. 10.1016/j.meegid.2023.105478. Epub 2023 Jul 4. PMID: 37406785 [DOI] [PubMed]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All data generated or analyzed during this study are included in this published article.