Circ_0007429 promotes hepatocellular carcinoma resistance to sorafenib through the miR-377-3p/THBS1 axis

Abstract

Objective: To elucidate the function of circ_0007429 in hepatocellular carcinoma (HCC) chemoresistance, with a focus on its regulatory mechanisms via the miR-377-3p/THBS1 (Thrombospondin 1) axis. Methods: The expression levels of circ_0007429, miR-377-3p, and THBS1 mRNA were quantified using quantitative Reverse Transcription Polymerase Chain Reaction (qRT-PCR). Cell viability was assessed with the CCK-8 assay, and THBS1 protein expression was evaluated by western blotting. The interactions between miR-377-3p and circ_0007429 or THBS1 were confirmed using luciferase reporter assays. Results: Circ_0007429 expression was substantially upregulated in sorafenib-resistant (SR) HCC cells. Knockdown of circ_0007429 accelerated sorafenib sensitivity by suppressing cell survival. Mechanistically, circ_0007429 acted as a molecular sponge for miR-377-3p, whose activity was increased upon circ_0007429 silencing. THBS1 was recognized as a downstream target of miR-377-3p, and its expression was suppressed by miR-377-3p. Circ_0007429 is a ceRNA for miR-377-3p, thus controlling THBS1 translation and contributing to sorafenib resistance. Conclusion: Circ_0007429 silencing enhances sorafenib sensitivity in HCC through the miR-377-3p/THBS1 axis. circ_0007429 may be a biomarker and therapeutic target for overcoming chemoresistance in HCC.

Introduction

Hepatocellular carcinoma (HCC) is an aggressive malignancy with high mortality rates [1]. While surgical resection remains the primary treatment for early-stage HCC, chemotherapy is widely employed to prolong survival in patients with intermediate to advanced disease [2,3]. Sorafenib, the first FDA-approved targeted agent for systemic treatment of HCC, has become the standard first-line therapy [4,5]. However, the emergence of sorafenib resistance (SR) poses a major challenge to effective clinical management [4]. Therefore, a deeper understanding of the mechanisms underlying SR in HCC is crucial for improving therapeutic outcomes.

Circular RNAs (circRNAs), a class of covalently closed RNA molecules, play essential roles in physiologic processes and disease development, including cancers [6]. Several circRNAs have been associated with chemoresistance in HCC, largely by acting as molecular sponges for microRNAs (miRNAs) [7,8]. For instance, exosomal circ_0032704 promotes SR in HCC and facilitate tumor progression through the miR-514a-3p/PD-L1 axis [9], while circ_0001944 promotes SR in HCC by inhibiting ferroptosis by modulating the miR-1292-5p/FBLN2 (Fibulin-2) axis [10]. Moreover, circ_HMGCS1 has been found to mediate HCC chemoresistance through themiR-338-5p/IL-7 pathway [11]. In addition, circRNA-SORE has been shown to sustain sorafenib resistance by stabilizing YBX1 (Y-box binding protein 1) [11], and exosome-derived circUPF2 enhances resistance by modulating ferroptosis sensitivity in HCC [12]. Notably, circ_0007429 was reported to promote proliferation, invasion, migration, apoptosis resistance, and aerobic glycolysis in HCC cells [13]. However, its role in HCC chemoresistance remains poorly defined.

This study aimed to elucidate the function of circ_0007429 in HCC chemoresistance. Two SR HCC cell lines were established to explore the molecular mechanisms driven by circ_0007429, with a focus on its regulation of the miR-377-3p/THBS1 axis. The findings support that circ_0007429 contributes to sorafenib resistance and may serve as a therapeutic target for chemoresistant HCC.

Materials and methods

Establishment of SR HCC cell lines

HCC cell lines, Huh7 and SK-HEP-1, were obtained from the China Center for Type Culture Collection (Wuhan, China). Cells were cultured in DMEM (R&D Systems, USA) supplemented with 10% fetal bovine serum (FBS; R&D Systems) under standard conditions (37°C, 5% CO₂). Both cell lines were exposed to sorafenib (4 μM) for 14 days to establish SR cell lines. The surviving cells were treated with increasing concentrations (5, 6, 7, or 8 μM) of sorafenib for over 30 days. The resistant Huh7/SR and SK-HEP-1/SR cells were maintained in media containing 5 μM sorafenib.

qRT-PCR

Total RNA was extracted using TRIzol regent (Invitrogen, USA), while cytosolic and nuclear RNA fractions were isolated using the Nuclear/Cytosol Fractionation Kit (Biovision, USA). The extracted RNA served as a template for cDNA synthesis via the 1st Strand cDNA Synthesis SuperMix (Yeasen, Shanghai, China). Expression levels of circ_0007429, miR-377-3p, GAPDH, THBS1, and U6 were quantified using SYBR Green Master Mix (Yeasen) on a realtime PCR system. RNA levels were determined by Ct values and quantified by the 2^-ΔΔCt method, with normalization to GAPDH for mRNA and circRNA and to U6 for miRNA. Primer sequences are shown in Table 1.

Table 1.

Primer sequences

Name	Primer (5’-3’) F: forward; R: reverse
circ_0007429 F	GGAACAUGCACAGUGUCAATT
circ_0007429 R	UUGACACUGUGCAUGUUCCTT
miR-377-3p F	GGGCCATCACACAAAGGCAACTT
miR-377-3p R	ATCCAGTGCAGGGTCCGAGG
THBS1 F	GGGGAGATAACGGTGTGTTTG
THBS1 R	CGGGGATCAGGTTGGCATT
U6 F	CGCTTCGGCAGCACATATAC
U6 R	TTCACGAATTTGCGTGTCAT
GAPDH F	GGAGCGAGATCCCTCCAAAAT
GAPDH R	GGCTGTTGTCATACTTCTCATGG

Cell transfection

Cells were transfected with si-NC, si-circ_0007429, pcDNA-NC, or pcDNA-THBS1 using Lipofectamine 3000 (Invitrogen), or with miR-377-3p mimic, inhibitor, or miRNA control (GenePharma, Shanghai, China) using Lipofectamine RNAiMAX (Invitrogen) following the instructions of the manufacturers. After 48 h transfection, the cells were harvested for subsequent functional experiments. The sequence of si-NC were 5’ GGAACATGCACAGTGTCAA 3’. The sequence of si-circ_0007429 were 5’ ATGGGAACATGCACAGTGTCA 3’.

Cell viability assays

SR cells were transfected and seeded into 96-well plates at a density of 5000 cells/well. After overnight incubation, cells were treated with increasing concentrations of sorafenib for an additional 48 h. Ten microliters of CCK-8 reagent (Beyotime, China) were added to each well and incubated for approximately 1 h. Absorbance was measured at 450 nm using a microplate reader.

Dual-luciferase reporter assays

Wild-type (WT) and mutant (MUT) sequences of circ_0007429, along with the 3’ UTR of THBS1 containing predicted miR-377-3p binding sites, were inserted into the pmirGLO luciferase reporter vector (Promega, USA). Cells were seeded in 24-well plates and co-transfected with WT or MUT reporter constructs, along with either miR-377-3p mimics or a negative control miRNA (miR-NC), using Lipofectamine 2000 (Invitrogen). Luciferase activity was measured after 48 h using a dual-luciferase reporter assay system.

Western blotting

Following SR cell lysis in RIPA buffer (Beyotime), protein concentrations were determined using a BCA kit (Takara). Equal amounts of protein (30 μg) were electrophoresed on SDS-PAGE and transferred to PVDF membranes. Membranes were incubated with an anti-THBS1 antibody (Abcam, UK), followed by a horseradish peroxidase (HRP)-conjugated anti-rabbit IgG secondary antibody (Sangon, China) at a 1:1000 dilution. GAPDH (ab8245, Abcam) was used as a loading control at a 1:10000 dilution. Protein bands were visualized using enhanced chemiluminescence (ECL).

Statistical analysis

GraphPad Prism 8 were used for data processing. Results were presented as means ± standard deviation (SD) from at least three independent experiments. Depending on the experimental design, comparisons between or among groups were performed using t-tests, one-way ANOVA, or two-way ANOVA followed by Tukey’s post-hoc test. Associations were assessed using Pearson’s correlation coefficients. A p-value < 0.05 was considered significant.

Results

Overexpression of circ_0007429 in SR HCC cell

SR HCC cell lines were successfully established, demonstrating substantially elevated circ_0007429 expression compared to their corresponding parental cells (Figure 1A). Furthermore, the IC₅₀ of sorafenib was markedly elevated in both Huh7/SR and SK-HEP-1/SR cells, versus with Huh7 cells and SK-HEP-1 cells (Figure 1B and 1C). Subcellular fractionation revealed that circ_0007429 was distributed in both the cytoplasm and nucleus, with predominant localization in the cytoplasm (Figure 1D and 1E). After treatment with actinomycin D, circ_0007429 levels remained stable over 24 h, whereas RREB1 mRNA levels significantly decreased (Figure 1F and 1G). RNase R digestion further demonstrated that RNase R markedly degraded the linear transcript, while circ_0007429 revealed resistances to RNase R-mediated degradation (Figure 1H and 1I), confirming the circular nature of circ_0007429. These findings collectively demonstrate that circ_0007429 was upregulated and showed stable expression in SR HCC cells.

Figure 1.

Elevated expression of circ_0007429 in sorafenib-resistant hepatocellular carcinoma (HCC) cell lines. A: qRT-PCR analysis of circ_0007429 expression in Huh7 vs. Huh7/SR and SK-HEP-1 vs. SK-HEP-1/SR cells. B, C: Cell survival and IC₅₀ values following 24 h of sorafenib treatment were assessed using CCK-8 assays. D, E: Subcellular localization of circ_0007429, GAPDH, and U6 in SR cells was determined by qRT-PCR. F, G: RNA stability of circ_0007429 and RREB1 mRNA after actinomycin D treatment (0, 8, 16, and 24 h), assessed by RT-qPCR. H, I: Resistance of circ_0007429 and RREB1 mRNA to RNase R digestion was evaluated by RT-qPCR. *P < 0.05, ^nsP > 0.05.

Knockdown of circ_0007429 sensitized SR cells to sorafenib

SR cells transfected with si-circ_0007429 showed a significant reduction in circ_0007429 expression compared to si-NC transfection (Figure 2A and 2B). This reduction in circ_0007429 level significantly reduced IC₅₀ of sorafenib in both Huh7/SR and SK-HEP-1/SR cells (Figure 2C and 2D). These results indicate that silencing circ_0007429 effectively enhances sorafenib sensitivity and attenuates drug resistance in SR HCC cells in vitro.

Figure 2.

Silencing circ_0007429 enhanced the susceptibility of SR cells to sorafenib. A, B: RT-qPCR analysis of circ_0007429 expressions in SR cells after transfection with si-NC or si-circ_0007429. C, D: CCK-8 assay evaluated cell survival and IC₅₀ values following 24 h of sorafenib treatment in si-NC- and si-circ_0007429-transfected SR cells. *P < 0.05.

Circ_0007429 sponges miR-377-3p

The mechanistic role of circ_0007429 in SR was further investigated. Bioinformatic analysis using the Starbase program predicted potential binding sites between circ_0007429 and miR-377-3p (Figure 3A). This interaction was verified through luciferase reporter assays, which demonstrated a substantial reduction in luciferase activity in both SR cell lines following co-transfection with WT-circ_0007429 and miR-377-3p (Figure 3B and 3C). Moreover, miR-377-3p expression was considerably lower in both resistant cells compared to their parental counterparts (Figure 3D and 3E), indicating a possible regulatory role in SR in HCC. Circ_0007429 knockdown significantly upregulated miR-377-3p expression in SR cells (Figure 3F and 3G), whereas circ_0007429 overexpression suppressed miR-377-3p expression (Figure 3H and 3I). Collectively, these results indicate that circ_0007429 sponges miR-377-3p, negatively regulating its expression in SR HCC cells.

Figure 3.

Circ_0007429 functions as a molecular sponge for miR-377-3p. A: Predicted binding sites between circ_0007429 and miR-377-3p. B, C: Luciferase reporter assay result in sorafenib-resistant cell lines co-transfected with WT or MUT circ_0007429 reporter plasmids and miR-377-3p mimics. D, E: qRT-PCR analysis of miR-377-3p expression in SR and parental cells. F, G: qRT-PCR quantification of miR-377-3p in resistant cell lines transfected with si-NC or si-circ_0007429. H, I: qRT-PCR analysis of miR-377-3p expression following transfection with control or circ_0007429 overexpression vectors. *P < 0.05, ^nsP > 0.05.

Circ_0007429 silencing enhanced sorafenib sensitivity through miR-377-3p

To evaluate whether miR-377-3p mediated the effects of circ_0007429 on SR, both SR cell lines were transfected with si-circ_0007429, si-NC, si-circ_0007429 + miR-NC inhibitor, or si-circ_0007429 + miR-377-3p inhibitor. qRT-PCR revealed that transfection with si-circ_0007429 substantially increased miR-377-3p levels. However, this upregulation was suppressed by the miR-377-3p inhibition (Figure 4A and 4B). Next, CCK-8 assays further demonstrated that circ_0007429 knockdown markedly reduced SR, as evidenced by decreased cell viability. However, this sensitizing effect was reversed by miR-377-3p inhibition (Figure 4C and 4D). These data suggest that miR-377-3p mediates the regulatory role of circ_0007429 in SR in HCC cells.

Figure 4.

Circ_0007429 silencing enhanced sorafenib sensitivity in HCC cells by miR-377-3p sponging. A, B: qRT-PCR analysis of miR-377-3p expression following circ_0007429 knockdowns. C, D: CCK-8 assay assessing cell viability of resistant HCC cells after combined treatment with sorafenib and circ_0007429 silencing, with or without miR-377-3p inhibitor. *P < 0.05.

THBS1 is a direct target of miR-377-3p

Bioinformatic analysis using the StarBase platform predicted putative binding sites for miR-377-3p in the 3’ untranslated region (UTR) of THBS1 mRNA (Figure 5A). This interaction was further verified using dual-luciferase reporter (DLR) assays, which showed that miR-377-3p overexpression substantially reduced THBS1 3’ UTR WT reporter activity, whereas no marked change was observed in the MUT construct (Figure 5B and 5C). Furthermore, both THBS1 mRNA and protein levels were upregulated in both resistant cell lines (Figure 5D-G). However, overexpression of miR-377-3p markedly downregulated THBS1 (Figure 5H-K). These findings confirm that miR-377-3p directly targets and downregulates THBS1.

Figure 5.

THBS1 is a direct target of miR-377-3p. A: Predicted binding sites of miR-377-3p within the THBS1 3’ UTR region. B, C: Dual-luciferase reporter (DLR) assays in both resistant cell lines co-transfected with MUT and WT THBS1 reporter constructs and miR-377-3p mimics. D-G: THBS1 mRNA and protein levels in resistant and parental HCC cells examined using qRT-PCR and western blot. H-K: THBS1 mRNA and protein levels in resistant cells following miR-377-3p overexpression examined using qRT-PCR and western blot. *P < 0.05, ^nsP > 0.05.

miR-377-3p alleviated sorafenib resistance in HCC cells by regulating THBS1 expression

To assess the functional relevance of the miR-377-3p/THBS1 axis in modulating SR in HCC cells, both SR cell lines were transfected with miR-377-3p mimics, miR-NC, miR-377-3p + pcDNA-NC, or miR-377-3p + pcDNA-THBS1. THBS1 overexpression reversed the miR-377-3p-induced suppression of THBS1 expression, indicating successful transfection (Figure 6A-D). CCK-8 assays depicted that miR-377-3p overexpression substantially reduced cell viability in the presence of sorafenib, whereas this effect was partially reversed by THBS1 overexpression (Figure 6E and 6F). These results suggest that miR-377-3p mitigates sorafenib resistance in HCC cells by downregulating THBS1.

Figure 6.

miR-377-3p reduced HCC cell resistance by downregulating THBS1. A-D: qRT-PCR and western blot analyses of THBS1 expression in resistance HCC cells after miR-377-3p transfection. E, F: CCK-8 assays measuring cell viability of resistant HCC cells treated with varying doses of sorafenib and miR-377-3p modulation. *P < 0.05.

Circ_0007429 functions as a ceRNA for miR-377-3p in regulating THBS1 expression

To explore whether circ_0007429 modulates THBS1 expression via miR-377-3p, SR cells were transfected with si-circ_0007429 alone or in combination with miR-377-3p inhibitors. WB analysis revealed that circ_0007429 knockdowns significantly reduced THBS1 expression in both resistant cell lines. However, this reduction in THBS1 levels was partially reversed upon inhibition of miR-377-3p (Figure 7A-D). The data indicate that circ_0007429 positively regulates THBS1 level by sponging miR-377-3p, thereby contributing to SR in HCC cells.

Figure 7.

Circ_0007429 acts as a ceRNA for miR-377-3p to regulate THBS1 expression. A-D: qRT-PCR and western blot analysis of THBS1 expression in both resistant cell lines following transfection with si-circ_0007429 alone or in combination with miR-377-3p inhibitor. *P < 0.05.

Discussion

Hepatocellular carcinoma (HCC) is an aggressive malignancy with a high recurrence rate. The limited effectiveness of conventional therapy is largely attributed to the development of chemoresistance [14,15]. Recent studies have implicated dysregulated circRNAs in both HCC tumorigenesis and the acquisition of chemoresistance [16-19]. For instance, circ_0044539 promotes lymph node metastasis in HCC through exosomal miR-29a-3p signaling [20], while hsa_circ_0000098 has been recognized as a possible therapeutic target that drives both HCC progression and doxorubicin resistance [21]. This study demonstrated that circ_0007429 expression was related to sorafenib resistance (SR) in HCC. Silencing circ_0007429 considerably sensitized resistant cells to sorafenib in vitro. Furthermore, the underlying molecular mechanisms of circ_0007429-mediated SR were partially elucidated.

The ceRNA hypothesis posits that circRNAs modulate gene expression by sponging miRNAs, thereby preventing miRNAs-mediated repression of target mRNAs [22,23]. miRNAs play critical roles in HCC progression and chemoresistance. For example, miRNA-223 suppresses hepatocarcinogenesis by inhibiting hypoxia-induced angiogenesis and immune suppression [24]. miR-21-5p enhances SR and promotes HCC progression by modulating Sirtuin 7 (SIRT7) ubiquitination through Ubiquitin-Specific Protease 24 (USP24) [25]. In this study, circ_0007429 directly modulated miR-377-3p. Earlier research has demonstrated that miR-377-3p suppresses epithelial-mesenchymal transition (EMT) and metastasis in cervical carcinoma by targeting Serum/Glucocorticoid Regulated Kinase 3 (SGK3) [26], and inhibits HCC progression by downregulating carnitine palmitoyl transferase 1C (CPT1C)-mediated fatty acid oxidation [27]. Our findings indicate that circ_0007429 contributes to SR in HCC by modulating miR-377-3p activity.

THBS1 has been associated with calcium signaling, a pathway implicated in the acquisition of resistance to various pharmacologic agents and genotoxic stress [28]. Furthermore, recent studies have demonstrated that the THBS1 upregulation facilitates cellular proliferation and suppresses apoptosis in HCC [29]. In this study, miR-377-3p was identified for the first time as a direct regulator of THBS1 in HCC. Elevated miR-377-3p levels were shown to reduce THBS1 expression, thereby attenuating sorafenib resistance in HCC cells. Importantly, these findings elucidate that circ_0007429 acts as a molecular sponge for miR-377-3p, regulating THBS1 expression and contributing to SR in HCC.

This study presents certain limitations. First, the interactions among circ_0007429, miR-377-3p, and THBS1 were not validated in clinical HCC tissue samples. Second, the functional role of the circ_0007429/miR-377-3p/THBS1 axis in modulating SR was not explored by animal models. Despite these limitations, the molecular mechanism by which circ_0007429 affects SR in HCC was successfully elucidated using comprehensive in vitro experiments.

Conclusion

This study showed a specific role of circ_0007429 in contributing to chemoresistance in HCC. Mechanistically, circ_0007429 promotes sorafenib resistance in HCC cells by sponging miR-377-3p and upregulating THBS1. These findings identify circ_0007429 as a promising therapeutic option for overcoming chemoresistance in HCC.

Disclosure of conflict of interest

None.