Skip to main content
Journal of Traditional and Complementary Medicine logoLink to Journal of Traditional and Complementary Medicine
. 2024 Mar 30;15(4):343–355. doi: 10.1016/j.jtcme.2024.03.016

Antcin-H, a natural triterpene derived from Antrodia cinnamomea, ameliorates dextran sulfate sodium-induced colitis in mice by inhibiting the NLRP3 inflammasome

Wei-Ting Wong a, Lan-Hui Li b, Hsiao-Wen Chiu a, Mridula P Menon a, Hsien-Ta Hsu c,d, Wen-Yu Lin a,e, Chun-Hsien Wu e, Chen-Lung Ho f, Kuo-Feng Hua a,g,
PMCID: PMC12266280  PMID: 40677541

Abstract

Inflammatory bowel disease (IBD) comprises idiopathic intestinal disorders, including ulcerative colitis and Crohn's disease. Patients with IBD experience a significantly reduced quality of life, and effective management remains challenging. The NOD-, LRR- and pyrin domain-containing protein 3 (NLRP3) inflammasome controls the expression of the pro-inflammatory cytokines interleukin (IL)-1β and IL-18. Abnormal activation of the NLRP3 inflammasome is a crucial factor in the pathogenesis of IBD, making it an attractive therapeutic target. We discovered that Antcin-H, a triterpene isolated from the unique medicinal fungus Antrodia cinnamomea found in Taiwan, effectively inhibits the NLRP3 inflammasome in macrophages and alleviates dextran sulfate sodium (DSS)-induced colitis in a mouse model. We noted that Antcin-H effectively suppresses the NLRP3 inflammasome in macrophages by diminishing reactive oxygen species production, alleviating mitochondrial damage, and reducing apoptosis-associated speck-like protein containing a CARD (ASC) oligomerization. Importantly, these effects are achieved without impacting NF-κB activation. Oral administration of Antcin-H improved symptoms such as diarrhea, bloody stool, weight loss, colon length shortening, and splenomegaly in DSS-treated mice. Antcin-H inhibits colonic expression of NLRP3, ASC, active caspase-1, IL-1β, IL-6, tumor necrosis factor-alpha, monocyte chemoattractant protein-1, myeloperoxidase, C-X-C motif chemokine ligand 1, and cyclooxygenase-2 in DSS-treated mice. Furthermore, Antcin-H modulates the colonic expression of long non-coding RNAs involved in the regulation of NLRP3 inflammasome activation. These results indicate that Antcin-H has the potential to improve IBD by reducing colonic inflammation and suppressing NLRP3 inflammasome activation.

Keywords: Inflammatory bowel disease, NLRP3 inflammasome, Antrodia cinnamomea, Antcin-H

Graphical abstract

Image 1

Abbreviations

5-ASA

5-Amino salicylic acid

ASC

Apoptosis-associated speck-like protein containing a CARD

ATP

Adenosine triphosphate

CD

Crohn's disease

COX-2

Cyclooxygenase-2

CXCL1

C-X-C motif chemokine ligand-1

DAI

Disease activity index

DCFH2-DA

2′,7′-dichlorofluorescein diacetate

DSS

Dextran sodium sulfate

IBD

Inflammatory bowel disease

IC50

Half maximal inhibitory concentration

IL

Interleukin

LPS

Lipopolysaccharide

LncRNAs

Long noncoding RNAs

MCP-1

Monocyte chemoattractant protein-1

MPO

Myeloperoxidase

NLRP3

The NOD-, LRR- and pyrin domain-containing protein 3

NMR

Nuclear magnetic resonance

ROS

Reactive oxygen species

TNF-α

Tumor necrosis factor-α

UC

Ulcerative colitis

VDAC

Voltage-dependent-anion channel

1. Introduction

Inflammatory bowel disease (IBD), including ulcerative colitis (UC) and Crohn's disease (CD), is a chronic intestinal inflammatory disorder that is becoming a global emerging disease with increasing incidence and prevalence.1,2 Common symptoms of IBD, such as blood in the stool, persistent diarrhea, fatigue, and weight loss, significantly impact patients' quality of life. Currently, IBD is not curable, and treatment aims to reduce symptoms and improve quality of life. Existing biological agents and small molecule drugs have limitations in terms of efficacy and side effects, highlighting the need for novel alternative therapies.3

Mounting evidence suggests that dysregulated inflammation and an overreactive immune response in the gut play crucial roles in the pathogenesis of IBD.4 However, the underlying mechanisms of IBD pathogenesis remain poorly understood. The NOD-, LRR- and pyrin domain-containing protein 3 (NLRP3) inflammasome, composed of NLRP3, apoptosis-associated speck-like protein containing a CARD (ASC), and caspase-1, is an important inflammatory machinery that regulates the secretion of interleukin (IL)-1β and IL-18 through caspase-1 activation.5 Activation of the NLRP3 inflammasome occurs in response to specific disease-related stimuli, such as pathogen-associated molecular patterns or endogenous molecules associated with tissue damage or metabolic imbalances.6 Abnormal activation of the NLRP3 inflammasome has been implicated in the pathogenesis of various inflammatory diseases, including metabolic disorders and cancers.6 In the case of IBD, aberrant activation of the NLRP3 inflammasome is considered a crucial pathogenic factor,7,8 making it a potential therapeutic target for IBD.9

Long noncoding RNAs (lncRNAs) are transcripts exceeding 200 nucleotides in length, playing diverse roles in various biological processes. Emerging evidence suggests that long noncoding RNAs (lncRNAs) play a regulatory role in the activation of the NLRP3 inflammasome in diverse disease conditions. These regulatory effects occur at both nuclear and cytoplasmic levels, involving interference in chromatin architecture, gene transcription, and translation processes.10 Additionally, several lncRNAs that modulate the inflammatory response have been documented to be either upregulated or downregulated in individuals with IBD. These observations emphasize the substantial impact of lncRNAs on the pathogenesis of IBD.11 Several natural molecules have been shown to enhance the management of IBD by influencing lncRNAs. This observation suggests that the modulation of lncRNA expression is a crucial molecular mechanism underlying the therapeutic effects mediated by natural molecules.12

Natural molecules and their derivatives offer promising opportunities for drug development.13 Antcin-H, a natural triterpene isolated from Antrodia cinnamomea, an indigenous medicinal fungus in Taiwan,14 has shown intestinal absorption through passive transcellular diffusion in an intestinal Caco-2 cell monolayer model.15 Previous studies have demonstrated that Antcin-H inhibits the phosphorylation levels of Janus Kinase proteins, suggesting its potential as a pan Janus Kinase inhibitor.16 Janus Kinase proteins play a positive role in NLRP3 inflammasome activation both in vitro and in vivo.17,18 These findings motivated us to investigate the inhibitory potential of Antcin-H on NLRP3 inflammasome and its therapeutic potential in NLRP3 inflammasome-associated IBD using a mouse model of dextran sodium sulfate (DSS)-induced colitis. Our study demonstrated that Antcin-H effectively inhibits NLRP3 inflammasome activation in macrophages and ameliorates DSS-induced colitis in the mouse model.

2. Materials and methods

2.1. Reagents

DSS with a molecular weight ranging from 36 to 50 kDa was obtained from MP Biomedicals (Irvine, CA). 5-Amino salicylic acid (5-ASA) and antibodies against ASC, cyclooxygenase-2 (COX-2), and actin were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Antibodies against NLRP3 and mouse caspase-1 were obtained from Adipogen International (San Diego, CA). Antibodies against IL-1β and C-X-C motif chemokine ligand-1 (CXCL1) as well as ELISA kits for IL-1β, IL-6, tumor necrosis factor-α (TNF-α), monocyte chemoattractant protein-1 (MCP-1), and active myeloperoxidase (MPO) were purchased from R&D Systems (Minneapolis, MN). Mitotracker Deep Red, Mitotracker Green, MitoSOX, 2′,7′-dichlorofluorescein diacetate (DCFH2-DA), Trizol reagent and M-MLV reverse transcriptase were acquired from Thermo Fisher Scientific (Waltham, MA). Lipopolysaccharide (LPS) from Escherichia coli O111:B4 was obtained from Sigma-Aldrich (St. Louis, MO). Adenosine triphosphate (ATP), the NF-κB reporter plasmids (pNiFty2-SEAP) and QUANTI-Blue medium were purchased from InvivoGen (San Diego, CA). The AlamarBlue assay kit was obtained from AbD Serotec (Oxford, UK). RPMI-1640 medium was purchased from Invitrogen (Carlsbad, CA), and fetal bovine serum was obtained from Life Technologies (Frederick, MD). SYBR Green was obtained from Bio-Rad (Hercules, CA). Antibodies against IκBα, phospho-IκBα, NF-κB p65 and phospho-NF-κB p65 were purchased from Cell Signaling Technology (Danvers, MA).

2.2. Preparation of Antcin-H

Antcin-H was purified from the cultivated fruiting bodies of A. cinnamomea. The protocol was modified from the previous study.19 Briefly, the dry powders of fruiting bodies were extracted using ethanol, and then ethanol extracts were applied to silica gel open column to purify the Antcin-H. Pure Antcin-H was analyzed by mass spectrometer and nuclear magnetic resonance (NMR) spectrometer to collect the 1H and 13C NMR spectrum. According to the high performance liquid chromatography analysis, the purity of Antcin-H is determined to be 96% (Supplementary Fig. 1).

2.3. Cell cultures

The J774A.1 mouse macrophage cell line was obtained from the Bioresource Collection and Research Center at the Food Industry Research and Development Institute in Hsinchu, Taiwan. The cells were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum, and maintained at 37°C in a 5% CO2 atmosphere.

2.4. Analysis of NLRP3 inflammasome activation in macrophages

J774A.1 macrophages were primed with 1 μg/ml LPS for 4 h, followed by incubation with Antcin-H or vehicle (0.1% dimethyl sulfoxide, DMSO) for 0.5 h. Subsequently, the cells were activated by 5 mM ATP for 0.5 h. The expressions of IL-1β, IL-18, and active caspase-1 in the supernatants were assessed using ELISA or Western blotting, following the methods described in previous studies.20,21

2.5. Analysis of intracellular reactive oxygen species (ROS) production in macrophages

J774A.1 macrophages were initially primed with 1 μg/ml LPS for 4 h, followed by incubation with 50 μM Antcin-H or vehicle for 0.5 h. Intracellular ROS production was assessed by staining the cells with 2 μM DCFH2-DA for 15 min. Subsequently, the cells were activated by 5 mM ATP, and the fluorescence signals were measured using a fluorometer at 5-min intervals for a duration of 1 h.

2.6. Analysis of mitochondrial damage in macrophages

J774A.1 macrophages were initially primed with 1 μg/ml LPS for 4 h, followed by incubation with 50 μM Antcin-H or vehicle for 0.5 h. Subsequently, the cells were activated by 5 mM ATP for 0.5 h. The integrity of the mitochondrial membrane was assessed by staining the cells with 25 nM MitoTracker Deep Red and 25 nM MitoTracker Green for 15 min. The production of mitochondrial ROS was analyzed by staining the cells with 5 nM MitoSOX for 15 min. The fluorescence signals were then measured using flow cytometry.

2.7. Analysis of macrophages viability

J774A.1 macrophages were treated with 50-200 μM of Antcin-H and incubated for 24 h. The viability of the cells was assessed using the AlamarBlue assay kit, following the protocol provided by the manufacturer.

2.8. NF-κB activity assay

To investigate the impact of Antcin-H on the phosphorylation of IκBα and NF-κB p65, J774A.1 macrophages were incubated with 50 μM Antcin-H or a vehicle for 0.5 h, followed by stimulation with 1 μg/ml LPS for 15–30 min. The phosphorylation of IκBα and NF-κB p65 in the cell lysates was analyzed through Western blotting. To examine the influence of Antcin-H on the transcriptional activity of NF-κB, NF-κB reporter cells (J-Blue cells) were generated by stably transfecting NF-κB reporter plasmids into J774A.1 macrophages. Subsequently, J-Blue cells were treated with 12.5-50 μM Antcin-H or a vehicle for 0.5 h and then stimulated for 24 h with 1 μg/ml LPS. To assess the response, 20 μl of medium from the infected J-Blue cells was mixed with 200 μl QUANTI-Blue medium in 96-well plates and incubated for 15 min at 37°C. The optical density of the mixture was measured at 655 nm using a microplate absorbance reader.

2.9. ASC oligomerization assay

J774A.1 macrophages were initially primed for 4 h with 1 μg/ml LPS, followed by a 0.5-h incubation with Antcin-H or a vehicle. Subsequently, cells were treated with 5 mM ATP for an additional 0.5 h before being lysed using TBS buffer (50 mM Tris-HCl, pH 7.4, and 150 mM NaCl) containing 0.5% Triton X-100, EDTA-free protease inhibitors, and phosphatase inhibitors. The resulting lysates underwent centrifugation at 6000 g for 15 min at 4°C, yielding Triton-insoluble fractions (pellets) and Triton-soluble fractions (supernatants). For ASC oligomerization detection, Triton-insoluble pellets were subjected to two washes with TBS buffer and then resuspended in 300 μl of TBS buffer. The resuspended pellets were crosslinked for 30 min with 2 mM disuccinimidyl suberate at 37°C and subsequently centrifuged for 15 min at 6000 g. Pellets were dissolved in SDS sample buffer and processed for SDS-PAGE. ASC oligomerization was then analyzed by Western blotting.

2.10. Mice model of DSS-induced colitis

Eight-week-old male C57BL/6JNal mice were obtained from the National Laboratory Animal Center (Taipei, Taiwan) and housed at the Animal Center of National Ilan University. The mice were randomly divided into five groups as follows.

  • 1.

    H2O + vehicle group: Mice received normal drinking water ad libitum for six days and were orally administered 200 μl of sterile vehicle (1% DMSO/17% PEG/82% ddH2O) once daily for six days (n = 3).

  • 2.

    DSS + vehicle group: Mice had 3% DSS in their drinking water ad libitum for six days and were orally administered 200 μl of sterile vehicle once daily for six days (n = 6).

  • 3.

    DSS + Antcin-H group: Mice had 3% DSS in their drinking water ad libitum for six days and were orally administered 200 μl of Antcin-H (20 mg/kg) once daily for six days (n = 6).

  • 4.

    DSS + 5-ASA group: Mice had 3% DSS in their drinking water ad libitum for six days and were orally administered 200 μl of 5-ASA (40 mg/kg) once daily for six days (n = 6).

  • 5.

    H2O + Antcin-H group: Mice received normal drinking water ad libitum for six days and were orally administered 200 μl of sterile Antcin-H (20 mg/kg) once daily for six days (n = 3).

All groups were switched to normal drinking water ad libitum for an additional day before sacrifice. The body weight, stool consistency and bleeding severity of the mice was recorded daily until sacrifice. The colon and spleen were collected for further analysis.

2.11. Scoring of disease activity index (DAI)

The DAI score is a research tool employed to quantify the symptoms of mice with IBD. It is calculated by combining the scores for stool consistency and bleeding severity.22 The stool scores included: 0 = well-formed stools; 1 = semi-formed stools that did not adhere to the anus; 2 = semi-formed stools that adhered to the anus. The bleeding scores included: 0 = no bleeding; 1 = slight bleeding; 2 = gross bleeding.

2.12. Analysis of colon tissue damage by H&E staining

A portion of the colonic tissues was fixed in 10% buffered formalin and subsequently embedded in paraffin. Paraffin sections were stained with H&E using standard protocols performed by Energenesis Biomedical Co., Ltd. (Taipei, Taiwan). Histopathological scores were calculated by a pathologist, combining the scores for inflammatory cell infiltration and tissue damage, as previously described.23 The inflammatory cell infiltration score: 0 = lamina propria with rare inflammatory cells; 1 = lamina propria with some inflammatory cells; 2 = confluence of inflammatory cells extending into the submucosa; 3 = transmural extension of the infiltrate. The tissue damage scores: 0 = no damage; 1 = lymphoepithelial lesions; 2 = surface mucosal erosion or focal ulceration; 3 = extensive mucosal damage and extension into deeper structures of the bowel wall.

2.13. Analysis of lncRNAs by real-time RT-PCR

Total RNA was isolated from the colons using Trizol reagent. First-strand cDNA was generated from the isolated RNA using M-MLV reverse transcriptase and random primers. The cDNA samples were then subjected to real-time PCR using the StepOne Real-Time PCR System from Applied Biosystems using SYBR Green and primers designed by Primer3 software. The designed primers were specific to the target genes of interest and were designed to produce amplicons of approximately 100 base pairs in size. The real-time PCR amplification consisted of 40 two-step cycles. Each cycle included denaturation at 95°C for 15 s, followed by annealing and elongation at 60°C for 45 s. The relative expression of lncRNAs was calculated using ΔCt (difference between the Ct values of the target gene and the endogenous control). 18S rRNA was employed as an endogenous control for lncRNAs. The relative expression of the target gene is then expressed as fold change compared to the control sample. The following primers used in this study were purchased form Genomics (Taipei, Taiwan) and shown in Table 1 .

Table 1.

Primer Sequences for qRT-PCR.

Gene Forward Primer (5′-3′) Reverse Primer (5′-3′)
LncRNA-COX-2 AAGGAAGCTTGGCGTTGTGA GAGAGGTGAGGAGTCTTATG
LncRNA-EPS GCGCACTTCTCTCATCTGTG TCAGCTGTAGGATGGGAGGT
LncRNA-SNHG1 TTCGAGCTACCTCCCAGGAT TGTTCTCAGCCAGACACACC
18S rRNA TAGAGGGACAAGTGGCGTTC CGCTGAGCCAGTCAGTGT

2.14. Statistical analysis

Statistical analyses involved the use of two-tailed t-tests for comparisons between two groups and ANOVA with Dunnett's multiple comparisons test for comparisons involving three or more groups. The error bars in the figures depict the standard deviation derived from three independent experiments. Significance levels are denoted as follows: *, **, and *** correspond to p -values of < 0.05, < 0.01, and < 0.001, respectively.

3. Results

3.1. Antcin-H inhibits NLRP3 inflammasome in macrophages

We investigate the potential inhibitory effects of Antcin-H, a triterpene found inA. cinnamomea(Fig. 1A), on the NLRP3 inflammasome in macrophages. The LPS-primed macrophages were treated with Antcin-H for 30 min and then activated with the NLRP3 activator ATP for an additional 30 min. We measured the levels of two key pro-inflammatory cytokines of the NLRP3 inflammasome, IL-1β and IL-18, in the supernatants of the treated macrophages.5ATP significantly induced the expression of IL-1β (Fig. 1B) and IL-18 (Fig. 1C) in LPS-primed macrophages. The presence of Antcin-H led to a reduction in the levels of IL-1β with a tested half maximal inhibitory concentration (IC50) at 22.2 μM (Fig. 1B) and IL-18 (Fig. 1C). Caspase-1 activation is a key step in the NLRP3 inflammasome activation process.5ATP also increased the levels of active caspase-1 (p10) in the supernatants. Antcin-H significantly reduced the levels of p10 in the supernatants, indicating that the activation of caspase-1 was inhibited by Antcin-H (Fig. 1D). These results support the conclusion that Antcin-H can inhibit NLRP3 inflammasome activation in macrophages.

Fig. 1.

Fig. 1

Antcin-H inhibits NLRP3 inflammasome in macrophages. (A) A. cinnamomea and the chemical structure of Antcin-H. (B) Antcin-H inhibits ATP-induced IL-1β secretion in LPS-primed macrophages analyzed by ELISA. (C) Antcin-H inhibits ATP-induced IL-18 secretion in LPS-primed macrophages analyzed by Western blotting. (D) Antcin-H inhibits ATP-induced caspase-1 activation in LPS-primed macrophages. The ELISA data are expressed as the means ± SD of three separate experiments. The Western blotting images are representative of separate experiments. ***p < 0.001 compared to the ATP-treated macrophages.

3.2. Antcin-H inhibits pyroptosis in macrophages

NLRP3 inflammasome activation in macrophages led to the induction of pyroptosis, which is characterized by the loss of cell membrane integrity.24This was evidenced by the significant extracellular release of LDH in LPS-primed macrophages when treated with ATP, indicating that pyroptosis occurred (Fig. 2A). Treatment with Antcin-H reduced the extracellular release of LDH in ATP-activated macrophages with a tested IC50at 28.2 μM (Fig. 2A). This suggests that Antcin-H inhibited pyroptosis and helped preserve cell membrane integrity. NLRP3 inflammasome activation can lead to the extracellular release of its component proteins, NLRP3 and ASC, which can amplify the inflammatory response.25We found that ATP induced the extracellular release of NLRP3 (Fig. 2B) and ASC (Fig. 2C) in LPS-primed macrophages. However, treatment with Antcin-H reduced the release of these inflammasome components, indicating that Antcin-H inhibited the extracellular release and potential inflammatory amplification. It was important to assess whether the observed inhibitory effects of Antcin-H were due to a general cytotoxic effect. We tested the viability of macrophages treated with Antcin-H at concentrations of up to 200 μM and found that Antcin-H did not significantly reduce macrophage viability at concentration100 μM (Fig. 2D). This suggests that the inhibitory effects of Antcin-H on NLRP3 inflammasome activation and pyroptosis were not a result of cytotoxicity.

Fig. 2.

Fig. 2

Antcin-H inhibits pyroptosis in macrophages. (A) Antcin-H inhibits ATP-induced LDH release in LPS-primed macrophages. (B) Antcin-H inhibits ATP-induced NLRP3 release in LPS-primed macrophages analyzed by Western blotting. (C) Antcin-H inhibits ATP-induced ASC release in LPS-primed macrophages analyzed by Western blotting. (D) Effect of Antcin-H on viability of macrophages. The LDH release and cell viability data are expressed as the means ± SD of three separate experiments. The Western blotting images are representative of separate experiments. **p < 0.01 and ***p < 0.001 compared to the ATP-treated macrophages.

3.3. Antcin-H inhibits ROS production and mitochondrial damage in macrophages

ROS have been shown to play crucial roles in the activation of the NLRP3 inflammasome.26In this study, we investigated the effect of Antcin-H on ATP-mediated ROS production in LPS-primed macrophages, as ROS can serve as an upstream activation signal for caspase-1, a key component of the NLRP3 inflammasome.26We found that ATP significantly increased intracellular ROS production in LPS-primed macrophages, as indicated by staining with the ROS indicator DCFH2-DA. However, treatment with Antcin-H led to a significant reduction in ATP-mediated ROS production in macrophages (Fig. 3A). Mitochondrial dysfunction has been recognized as another important activation signal for the NLRP3 inflammasome.27To assess the effect of Antcin-H on mitochondrial function, we examined mitochondrial membrane integrity using MitoTracker Deep Red and MitoTracker Green, fluorescent probes that stain mitochondria with intact membranes or total mitochondria regardless of their membrane integrity, respectively. Upon ATP treatment, LPS-primed macrophages showed increased mitochondrial membrane integrity loss, as evidenced by an elevated cell population with low MitoTracker Deep Red staining (Fig. 3B). However, treatment with Antcin-H reduced ATP-mediated mitochondrial membrane integrity loss (Fig. 3B). Mitochondrial ROS production can lead to the oxidation of mitochondrial DNA, which can then be released into the cytosol from damaged mitochondria. Oxidized mitochondrial DNA can bind to NLRP3 protein and activate the NLRP3 inflammasome.27We found that ATP increased mitochondrial ROS production in LPS-primed macrophages, and this effect was reduced by Antcin-H (Fig. 3C). Additionally, ASC oligomerization represents a crucial step in the activation of the NLRP3 inflammasome.28To determine whether Antcin-H hinders ASC oligomerization, we investigated its impact on the formation of ASC oligomers. Through Western blot analysis, we observed that Antcin-H decreased ATP-induced ASC oligomer formation in LPS-primed macrophages (Fig. 3D). These results support the hypothesis that Antcin-H protects against mitochondrial damage, and the reduction in ASC oligomerization may contribute to its inhibitory effects on NLRP3 inflammasome activation. Furthermore, we conducted experiments to assess the impact of Antcin-H on the activation of NF-κB, a crucial regulator of the priming signal for the NLRP3 inflammasome.29 Our Western blot analysis revealed that Antcin-H had no observable effect on the phosphorylation levels of I-κBα (Fg. 3E) and NF-κB p65 (Fg. 3F) in LPS-activated macrophages. To further corroborate the influence of Antcin-H on NF-κB activation, we investigated its impact on NF-κB transcriptional activity using an NF-κB reporter cell line. The results conclusively demonstrated that Antcin-H did not modify NF-κB transcriptional activity in LPS-activated macrophages (Fg. 3G). In summary, these findings suggest that the inhibition of the NLRP3 inflammasome by Antcin-H may not occur through the inhibition of NF-κB.

Fig. 3.

Fig. 3

Antcin-H inhibits ROS production and mitochondrial damage in macrophages. (A) Antcin-H inhibits ATP-induced ROS production in LPS-primed macrophages. (B) Antcin-H inhibits ATP-induced mitochondrial membrane integrity loss in LPS-primed macrophages. (C) Antcin-H inhibits ATP-induced mitochondrial ROS production in LPS-primed macrophages. (D) Antcin-H inhibits ATP-induced ASC oligomerization in LPS-primed macrophages. (E) Effect of Antcin-H on LPS-induced I-κBα phosphorylation in macrophages. (F) Effect of Antcin-H on LPS-induced NF-κB p65 phosphorylation in macrophages. (G) Effect of Antcin-H on LPS-induced NF-κB transcriptional activity in macrophages. The ROS and NF-κB transcriptional activity data are expressed as the means ± SD of three separate experiments. The flow cytometry data presented represent individual experiments, and the histogram provides quantification expressed as the mean ± SD for these three experiments. The Western blotting images displayed represent individual experiments. *p < 0.05 and **p < 0.01 compared to the ATP-treated macrophages.

3.4. Antcin-H ameliorates DSS-induced colitis in a mice model

The study investigated the potential of Antcin-H as an inhibitor of IBD using a mice model of DSS-induced colitis. The mice exposed to DSS experienced significant body weight loss, indicating the severity of colitis. However, oral administration of either 20 mg/kg Antcin-H or 40 mg/kg 5-ASA (a clinically used drug for IBD) resulted in a significant attenuation of body weight loss (Fig. 4A). This suggests that both Antcin-H and 5-ASA effectively prevented further weight loss due to colitis. DSS-induced colitis is often associated with diarrhea and bloody stools, characteristic of IBD. The DAI scores of mice can be calculated based on the severity of the diarrhea and bloody stool.22The administration of Antcin-H and 5-ASA improved these symptoms and reduced DAI scores in the mice, indicating their potential in reducing the severity of colitis (Fig. 4B). In addition, DSS caused significant colonic shortening in the mice, which is a common characteristic of colitis. However, oral administration of Antcin-H or 5-ASA effectively attenuated the colonic shortening, suggesting that both compounds could protect the colon tissue from inflammation-induced damage (Fig. 4C). DSS-induced colitis also led to significant splenomegaly in the mice, which indicates an elevated inflammatory response. However, oral administration of Antcin-H or 5-ASA ameliorated this splenomegaly, suggesting that both compounds helped in reducing the inflammatory response in the mice (Fig. 4D). Furthermore, the standard pathological test using H&E staining showed that both Antcin-H and 5-ASA exhibited notable protective effects against intestine damage and inflammation. This suggests that both compounds can protect the intestine from the harmful effects of colitis (Fig. 4E). Importantly, oral administration of 20 mg/kg Antcin-H alone did not cause significant body weight loss, colonic shortening, or splenomegaly in mice, indicating that Antcin-H at this dosage did not cause any noticeable side effects. This is crucial as it suggests that the tested dose of Antcin-H is well-tolerated in mice (Fig. 4A–E).

Fig. 4.

Fig. 4

Antcin-H ameliorates DSS-induced colitis in a mice model. (A) Antcin-H attenuates body weight loss. (B) Antcin-H improves DAI scores. (C) Antcin-H attenuates the colonic shortening. (D) Antcin-H attenuates the splenomegaly. (E) Antcin-H attenuates intestine damage analyzed by H&E staining. *p < 0.05, **p < 0.01 and ***p < 0.001 compared to DSS + vehicle group.

3.5. Antcin-H ameliorates the activation of the NLRP3 inflammasome in colon of DSS-treated mice

The study further investigated the underlying mechanisms by which Antcin-H exerts its inhibitory effects on DSS-induced colitis in the mice model. It was previously established that the NLRP3 inflammasome plays a crucial role in DSS-induced colitis.7,8DSS administration significantly increased the levels of IL-1β in both colon tissue and serum. IL-1β is a pro-inflammatory cytokine produced and released upon NLRP3 inflammasome activation.5Oral administration of Antcin-H or 5-ASA resulted in a significant reduction of IL-1β levels in both colon tissue and serum (Fig. 5A). This indicates that both Antcin-H and 5-ASA can effectively inhibit the production of IL-1β, thus reducing inflammation associated with colitis. DSS-induced colitis also led to a significant increase in the levels of active caspase-1 in colon tissue. Caspase-1 is a critical component of the NLRP3 inflammasome and is responsible for the maturation and release of IL-1β.5However, oral administration of Antcin-H or 5-ASA significantly reduced the levels of active caspase-1 in colon tissue (Fig. 5B). This suggests that both Antcin-H and 5-ASA can inhibit the activation of caspase-1, thereby blocking the release of IL-1β. Additionally, NLRP3 and ASC are essential components of the NLRP3 inflammasome complex.5DSS administration caused a significant increase in the expression levels of NLRP3 and ASC in colon tissue. However, oral administration of Antcin-H or 5-ASA significantly reduced the expression levels of NLRP3 (Fig. 5C) and ASC (Fig. 5D) in colon tissue. This indicates that both Antcin-H and 5-ASA can downregulate the expression of key components of the NLRP3 inflammasome, thus preventing its activation. Importantly, oral administration of Antcin-H alone did not induce the levels of IL-1β, NLRP3, and ASC in colon tissue. This is consistent with the previous finding that Antcin-H at the tested dosage did not cause any side effects in mice.

Fig. 5.

Fig. 5

Antcin-H ameliorates the activation of the NLRP3 inflammasome in colon of DSS-treated mice. (A) IL-1β levels in colon and in serum. (B) Active caspase-1 levels in colon. (C) NLRP3 levels in colon. (D) ASC levels in colon. The Western blotting images are representative of separate experiments, and the column diagram represents the fold change compared with the H2O + vehicle group normalized to actin analyzed by Image J. **p < 0.01 and ***p < 0.001 compared to DSS + vehicle group.

3.6. Antcin-H ameliorates colonic inflammation in DSS-treated mice

The study further investigated the anti-inflammatory effects of Antcin-H in the DSS-induced colitis mice model, in addition to its inhibition of the NLRP3 inflammasome activation. Inflammatory responses, characterized by increased levels of various pro-inflammatory markers, play crucial roles in the development and progression of IBD, including colitis.30DSS administration significantly increased the expression levels of pro-inflammatory cytokines, including IL-6 (Fig. 6A), TNF-α (Fig. 6B), MCP-1 (Fig. 6C), and CXCL1 (Fig. 6D), in the colon tissue. However, oral administration of Antcin-H or 5-ASA resulted in a significant reduction in the expression levels of these pro-inflammatory cytokines. This indicates that Antcin-H can effectively suppress the production of these inflammatory mediators, thereby reducing inflammation in the colon tissue. MPO is an enzyme released by activated neutrophils and is considered a marker of inflammation.31DSS-induced colitis also led to increased levels of active MPO in colon tissue. Oral administration of Antcin-H or 5-ASA significantly reduced the levels of active MPO, suggesting that Antcin-H can attenuate neutrophil-mediated inflammation in the colon (Fig. 6E). COX-2 is an enzyme involved in the production of prostaglandins, which are pro-inflammatory lipid mediators.32DSS treatment also increased the expression of COX-2 in the colon tissue. However, treatment with Antcin-H or 5-ASA reduced the expression of COX-2 (Fig. 6F), indicating that Antcin-H can inhibit the production of pro-inflammatory prostaglandins. Collectively, these results demonstrate that Antcin-H exhibits anti-inflammatory activity in the DSS-induced colitis mice model by reducing the expression of various pro-inflammatory cytokines (IL-6, TNF-α, MCP-1, and CXCL1), inhibiting neutrophil activation (measured by active MPO levels), and suppressing COX-2 expression.

Fig. 6.

Fig. 6

Antcin-H ameliorates colonic inflammation in DSS-treated mice. Protein expression levels of IL-6 (A), TNF-α (B), MCP-1 (C), CXCL1 (D) and active MPO (E) in colon were analyzed by ELISA. (F) Protein expression levels of COX-2 in colon were analyzed by Western blotting. The Western blotting images are representative of separate experiments, and the column diagram represents the fold change compared with the H2O + vehicle group normalized to actin analyzed by Image J. **p < 0.01 and ***p < 0.001 compared to DSS + vehicle group.

3.7. Antcin-H modulates colonic lncRNAs expression in DSS-treated mice

The lncRNAs are important regulators of gene expression and have diverse roles in modulating inflammatory responses.33One specific lncRNA, called lncRNA-COX-2, is involved in increasing the expression of two proteins, NLRP3 and ASC, by promoting the nuclear translocation and transcription of NF-κB p65. This, in turn, enhances the activation of the NLRP3 inflammasome.34In the context of colon inflammation in mice induced by DSS treatment, we found a significant upregulation in the expression of lncRNA-COX-2 compared to control mice (Fig. 7A). We tested the effects of Antcin-H and 5-ASA, on lncRNA-COX-2 expression in DSS-treated mice. Both Antcin-H and 5-ASA are found to be capable of decreasing the expression of lncRNA-COX-2 in these mice (Fig. 7A). In addition to lncRNA-COX-2, we also investigated two other lncRNAs, lncRNA-EPS,35and lncRNA-SNHG1,36which were found to inhibit inflammation. Interestingly, the expression of lncRNA-EPS (Fig. 7B) and lncRNA-SNHG1 (Fig. 7C) was significantly increased in DSS-treated mice, suggesting a potential anti-inflammatory role for these lncRNAs in this model. We found that the increased expression of lncRNA-EPS (Fig. 7B) and lncRNA-SNHG1 (Fig. 7C) in DSS-treated mice was inhibited by treatment with Antcin-H and 5-ASA. This indicates that Antcin-H and 5-ASA might counteract the upregulation of these lncRNAs, which could be relevant to the reduced inflammatory status in Antcin-H- and 5-ASA-trated mice. Oral administration of Antcin-H alone did not alter the expression levels of these lncRNAs in mice.

Fig. 7.

Fig. 7

Antcin-H modulates lncRNAs expression in DSS-treated mice. Expression levels of lncRNA-COX-2 (A), lncRNA-EPS (B) and lncRNA-SNHG1 (C) in colon were analyzed by real-time RT-PCR. **p < 0.01 and ***p < 0.001 compared to DSS + vehicle group.

4. Discussion

IBD is indeed a global health issue that affects a significant number of people worldwide. 37 The two main types of IBD are Crohn's disease and ulcerative colitis, both of which involve chronic inflammation of the gastrointestinal tract. The exact cause of IBD is not entirely understood, but it is believed to result from a combination of genetic, environmental, and microbial factors that trigger an abnormal immune response in the intestines. This chronic inflammation can lead to various symptoms such as abdominal pain, diarrhea, weight loss, and fatigue, among others. The unpredictable nature of IBD flares can significantly impact a person's quality of life. 38 The primary approach to managing IBD involves the use of medications, which are typically the first line of treatment. Some of the commonly used medications for IBD include: anti-diarrheal drugs to control diarrhea or pain relievers for abdominal discomfort; corticosteroids, the potent anti-inflammatory drugs that can help to quickly reduce inflammation during acute flare-ups; aminosalicylates to reduce inflammation of intestines; immunosuppressive drugs to suppress the immune system and can be effective in managing IBD, which are often used for individuals who do not respond to other treatments or who need to taper off corticosteroids; antibiotics to target bacterial overgrowth or infections in the gut, which can exacerbate IBD symptoms. 39 While these medications can be effective in controlling IBD symptoms and inducing remission, they are not without potential side effects. Some of the common side effects of these drugs may include increased susceptibility to infections, bone density loss, liver problems, and other complications. Long-term use of some medications, such as corticosteroids or certain immunosuppressive drugs, can be particularly concerning due to the risk of serious adverse effects. 40, 41, 42 Given the limitations and potential risks associated with medications, researchers continue to explore other treatment options for IBD. These may include biologic therapies that target specific immune pathway, 43 novel anti-inflammatory agents, 44 and research into the gut microbiome to better understand its role in IBD development. 45 , 46

The NLRP3 inflammasome is a multiprotein complex involved in the immune response. Activation of the NLRP3 inflammasome is associated with the release of pro-inflammatory cytokines, including IL-1β, 5 which can contribute to the development and progression of colitis. 7, 8, 9 IL-1β receptor antagonist and caspase-1 inhibitor are agents that can block the effects of IL-1β and inhibit its production, respectively. By doing so, they can help reduce the development of colitis. 47 By using specific inhibitors like MCC950 or glyburide, the NLRP3 inflammasome's activity can be suppressed, leading to a reduction in IL-1β production and colonic inflammation in mice. 48 The NLRP3 inflammasome appears to be a crucial target for drugs aimed at improving IBD. 9 , 49 , 50 Traditional medicine has a long history of using plants and medicinal fungi to treat various diseases, and it continues to be an essential source of bioactive compounds for modern medicine. Over the years, research has focused on screening natural products, including those derived from traditional medicine, for their NLRP3 inflammasome inhibitory activity and in the management of various health conditions, including IBD. 51 , 52

A. cinnamomea is a medicinal fungus that is native to Taiwan and has been used in traditional medicine for various health benefits for a long time. Researchers have identified several bioactive compounds and ingredients in A. cinnamomea, including triterpenoids, steroids benzenoids, and polysaccharides, which are believed to be responsible for its pharmacological activities, such as hepatoprotective, anti-cancer, anti-oxidative and anti-inflammatory activities. 53 Antcin-H, a major triterpene isolated from this fungus, has shown potential in enhancing chemotherapy against lymphoma cells, 16 and inhibiting the growth and invasion of human renal carcinoma cells. 19 Antcin-H has been shown to protect the liver from inflammation and injury. This could be beneficial in the management of liver-related disorders. 54 , 55 Mitochondrial dysfunction plays a crucial role in NLRP3 inflammasome activation. ROS generated from mitochondria trigger the relocation of NLRP3 to mitochondria-associated ER membranes, where ASC is recruited, promoting NLRP3 inflammasome activation. 27 , 56 Mitochondrial ROS induce the oxidation of mitochondrial DNA. The oxidized mitochondrial DNA is then released from mitochondria via mitochondrial permeability transition pores- and voltage-dependent-anion channel (VDAC)-dependent channels. Once in the cytosol, it binds to cytosolic NLRP3, leading to inflammasome activation. 57 In this study, Antcin-H has been found to reduce mitochondrial ROS production in macrophages. As a result, it may decrease the generation of oxidized mitochondrial DNA and limit the translocation of NLRP3 to mitochondria-associated ER membranes. Antcin-H is also shown to improve mitochondrial integrity, which may further reduce the translocation of oxidized mitochondrial DNA into the cytosol, contributing to the regulation of inflammasome activation. In addition, it has been demonstrated that NLRP3 inflammasome activation requires new mitochondrial DNA synthesis induced by LPS stimulation. 58 However, the effect of Antcin-H on LPS-mediated new mitochondrial DNA synthesis needs further investigation. Patients with UC and CD, as well as mice with colitis induced by DSS, show increased levels of plasma mitochondrial DNA compared to individuals without IBD. This indicates that mitochondrial dysfunction and mitochondrial DNA release may play a role in IBD pathogenesis. 59 Besides its involvement in NLRP3 inflammasome activation, recent studies have implicated mitochondrial dysfunction as a trigger for IBD. This suggests that mitochondrial abnormalities may contribute to the development and progression of IBD. 60 Mitochondrial VDAC1 is overexpressed in the colon of patients with CD and UC, as well as in DSS-treated mice. VDAC1 plays a critical role in mitochondrial function, and its dysregulation may contribute to IBD pathogenesis. Inhibiting VDAC1 through its interacting molecules has shown promise in improving the IBD syndrome in DSS-treated mice, suggesting that mitochondria could be a potential therapeutic target for IBD. 61 In conclusion, the study suggests that Antcin-H may have potential anti-inflammatory effects by targeting mitochondrial ROS production, mitochondrial integrity, and oxidized mitochondrial DNA generation, which are critical steps in NLRP3 inflammasome activation and IBD pathogenesis. However, more research is needed to fully understand the compound's impact on LPS-induced new mitochondrial DNA synthesis and its overall role in regulating the NLRP3 inflammasome activation pathway.

The lncRNAs are a class of RNA transcripts that lack the ability to encode proteins. Instead, they have been increasingly recognized for their crucial roles in various cellular processes, including the regulation of gene expression and inflammatory responses. 62 Recent studies have shed light on the critical role of lncRNAs in the precise regulation of the NLRP3 inflammasome both at the nuclear and cytoplasmic levels. These lncRNAs exert their functions by interfering with chromatin architecture, gene transcription, and translation processes. 63 Some lncRNAs, such as lncRNA-SNHG5 and lncRNA-NEAT1, are implicated in promoting IBD. 64 , 65 Their increased expression might contribute to the inflammatory processes in the colon and exacerbate IBD. Conversely, other lncRNAs, such as lncRNA-Gm31629 and lncRNA-MEG3, have been shown to alleviate IBD. 66 , 67 In this study we identified three lncRNAs, namely lncRNA-COX-2, lncRNA-EPS, and lncRNA-SNHG1, which were up-regulated in the colon of DSS-treated mice. Notably, lncRNA-COX-2 is a positive regulator of the NLRP3 inflammasome, 34 which is implicated in IBD pathogenesis. The oral administration of Antcin-H was found to reduce the expression of lncRNA-COX-2. Interestingly, Antcin-H also reduced the levels of two anti-inflammatory lncRNAs, lncRNA-EPS and lncRNA-SNHG1, which were increased in the colon of DSS-treated mice. The study suggests that this reduction might be due to a feedback regulation in response to the reduced colonic inflammation caused by Antcin-H. The findings imply that Antcin-H has complex effects on lncRNAs, influencing both pro-inflammatory and anti-inflammatory lncRNAs in the context of IBD. The compound's ability to reduce pro-inflammatory lncRNA-COX-2 expression might be one mechanism by which it exerts its anti-inflammatory effects. However, the reasons for the reduction of anti-inflammatory lncRNA-EPS and lncRNA-SNHG1 are not entirely clear and warrant further investigation.

IBD is characterized by an elevation in tight junction proteins and increased intestinal permeability.68Autophagy, a cellular protective mechanism, plays a crucial role in breaking down damaged organelles, unnecessary proteins, and pathogenic agents. Studies have illustrated that autophagy facilitates the lysosomal degradation of the tight junction protein claudin-2, thereby reducing epithelial tight junction permeability.69These findings collectively suggest a potential role for autophagy in preserving epithelial barrier function and potentially improving IBD outcomes.70Autophagy not only sustains intestinal homeostasis and supports barrier function but also regulates the NLRP3 inflammasome, a critical pathogenic factor in IBD.7,8 Autophagy has been demonstrated to hinder NLRP3 inflammasome activation by breaking down NLRP3 and proIL-1β,71,72 preserving mitochondrial integrity,73 and reducing mitochondrial ROS concentration.74 Upon NLRP3 inflammasome activation, caspase-1 cleaves GSDMD into N- and C-termini. The N-termini form a transmembrane pore in the cell membrane, leading to increased cell membrane permeability. This results in the release of cytokines such as IL-1β and IL-18, along with cytosolic components like LDH, NLRP3, and ASC, causing inflammatory cell death known as pyroptosis.75 Pyroptosis significantly influences mucosal inflammation and the defense of the intestinal epithelium against enteropathogenic bacterial infection, emphasizing its impact on IBD pathogenesis.76 Moreover, autophagy negatively regulates pyroptosis by reducing cleaved GSDMD levels and eliminating damaged mitochondria.77,78 In this study, we demonstrated that Antcin-H inhibits the NLRP3 inflammasome, reducing the release of LDH, NLRP3, and ASC, indicating a decrease in pyroptosis. However, a limitation of this study is the absence of an investigation into the effects of Antcin-H on autophagy induction. Previous research has shown that the ethanol extract and polysaccharides of A. cinnamomea induce autophagy in human colorectal cancer cells and mouse Kupffer cells, respectively.79,80 Eburicoic Acid and coenzyme Q0, isolated from A. cinnamomea, induce autophagy in human hepatoma cells and human glioblastoma cells, respectively.81,82 It would be worthwhile to investigate whether Antcin-H inhibits the NLRP3 inflammasome and pyroptosis through autophagy induction in future studies. While this study incorporated 5-ASA as a positive control in the mice model of DSS-induced colitis, it is important to note another limitation: the absence of a positive control drug targeting the NLRP3 inflammasome, such as MCC950. Including MCC950 in this study would provide a valuable comparison and enhance our understanding of the mode of action of Antcin-H. The addition of MCC950 could offer further insights into the specific mechanisms underlying the observed effects and strengthen the overall interpretation of the results.

5. Conclusions

This study provides evidence that Antcin-H can inhibit NLRP3 inflammasome activation in the DSS-induced colitis mice model. The mechanism of action involves reducing the levels of pro-inflammatory cytokines and inhibiting the activation of the NLRP3 inflammasome in mice and in macrophages. These findings support the potential of Antcin-H as a therapeutic agent for IBD, as it targets the inflammatory pathway involved in the disease. However, further research is necessary to fully understand the molecular mechanisms underlying the inhibitory effects and safety profile of Antcin-H before considering its use in human trials for IBD.

Ethics approval

The animal study was conducted with the approval of the Institutional Animal Care and Use Committee of the National Ilan University (approval number: No. 106–13).

Funding

This research work is supported by the funding from the National Science and Technology Council, Taiwan (MOST 111-2628-B-197-001-MY3; NSTC 112-2313-B-197-002; MOST 111-2811-B-197-001; NSTC 112-2811-B-197-002).

CRediT authorship contribution statement

Wei-Ting Wong: Methodology, Investigation, Formal analysis, Writing – original draft. Lan-Hui Li: Methodology, Investigation, Formal analysis, Writing – original draft. Hsiao-Wen Chiu: Methodology, Investigation, Formal analysis. Mridula P. Menon: Methodology, Formal analysis. Hsien-Ta Hsu: Investigation, Resources. Wen-Yu Lin: Methodology. Chun-Hsien Wu: Methodology. Chen-Lung Ho: Methodology. Kuo-Feng Hua: Conceptualization, Data curation, Funding acquisition, Supervision, Writing – review & editing.

Data availability

Data will be made available on request.

Declaration of generative AI and AI-assisted technologies in the writing process

During the preparation of this work the author(s) used ChatGPT in order to improve language. After using this tool/service, the author(s) reviewed and edited the content as needed and take(s) full responsibility for the content of the publication.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgment

The authors express their gratitude to Dr. Shui-Tein Chen of ALPS Biotech Co. Ltd, Taipei, Taiwan, for his assistance in preparing Antcin-H. Additionally, the authors extend their appreciation to Prof. Lee-Chiang Lo of the Department of Chemistry at National Taiwan University, Taipei, Taiwan, for conducting HPLC analysis to assess the purity of Antcin-H.

Footnotes

Peer review under responsibility of The Center for Food and Biomolecules, National Taiwan University.

Appendix A

Supplementary data to this article can be found online at https://doi.org/10.1016/j.jtcme.2024.03.016.

Appendix A. Supplementary data

The following is/are the supplementary data to this article:

mmc1.docx (95KB, docx)

References

  • 1.Saez A., Herrero-Fernandez B., Gomez-Bris R., Sánchez-Martinez H., Gonzalez-Granado J.M. Pathophysiology of inflammatory bowel disease: innate immune system. Int J Mol Sci. 2023;24:1526. doi: 10.3390/ijms24021526. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Kaplan G.G., Windsor J.W. The four epidemiological stages in the global evolution of inflammatory bowel disease. Nat Rev Gastroenterol Hepatol. 2021;18:56–66. doi: 10.1038/s41575-020-00360-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Higashiyama M., Hokaria R. New and emerging treatments for inflammatory bowel disease. Digestion. 2023;104:74–81. doi: 10.1159/000527422. [DOI] [PubMed] [Google Scholar]
  • 4.Alimohammadi N., Koosha F., Rafeian-Kopaei M. Current, new, and future therapeutic targets in inflammatory bowel disease: a systematic review. Curr Pharmaceut Des. 2020;26:2668–2675. doi: 10.2174/1381612826666200406081920. [DOI] [PubMed] [Google Scholar]
  • 5.Xu J., Núñez G. The NLRP3 inflammasome: activation and regulation. Trends Biochem Sci. 2023;48:331–344. doi: 10.1016/j.tibs.2022.10.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Sharma B.R., Kanneganti T.D. NLRP3 inflammasome in cancer and metabolic diseases. Nat Immunol. 2021;22:550–559. doi: 10.1038/s41590-021-00886-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Kanneganti T.D. Inflammatory bowel disease and the NLRP3 inflammasome. N Engl J Med. 2017;377:694–696. doi: 10.1056/NEJMcibr1706536. [DOI] [PubMed] [Google Scholar]
  • 8.Zhen Y., Zhang H. NLRP3 inflammasome and inflammatory bowel disease. Front Immunol. 2019;10:276. doi: 10.3389/fimmu.2019.00276. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Chen Q.L., Yin H.R., He Q.Y., Wang Y. Targeting the NLRP3 inflammasome as new therapeutic avenue for inflammatory bowel disease. Biomed Pharmacother. 2021;138 doi: 10.1016/j.biopha.2021.111442. [DOI] [PubMed] [Google Scholar]
  • 10.Menon M.P., Hua K.F. The long non-coding RNAs: paramount regulators of the NLRP3 inflammasome. Front Immunol. 2020;11 doi: 10.3389/fimmu.2020.569524. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Ghafouri-Fard S., Eghtedarian R., Taheri M. The crucial role of non-coding RNAs in the pathophysiology of inflammatory bowel disease. Biomed Pharmacother. 2020;129 doi: 10.1016/j.biopha.2020.110507. [DOI] [PubMed] [Google Scholar]
  • 12.Zhang G., Zhang C., Sun J., Xiong Y., Wang L., Chen D. Phytochemical regulation of RNA in treating inflammatory bowel disease and colon cancer: inspirations from cell and animal studies. J Pharmacol Exp Therapeut. 2021;376:464–472. doi: 10.1124/jpet.120.000354. [DOI] [PubMed] [Google Scholar]
  • 13.Chopra B., Dhingra A.K. Natural products: a lead for drug discovery and development. Phytother Res. 2021;35:4660–4702. doi: 10.1002/ptr.7099. [DOI] [PubMed] [Google Scholar]
  • 14.Senthil Kumar K.J., Gokila Vani M., Hsieh H.W., Lin C.C., Wang S.Y. Antcins from Antrodia cinnamomea and Antrodia salmonea inhibit angiotensin-converting enzyme 2 (ACE2) in epithelial cells: can Be potential candidates for the development of SARS-CoV-2 prophylactic agents. Plants. 2021;10:1736. doi: 10.3390/plants10081736. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Wang Q., Qiao X., Qian Y., et al. Intestinal absorption of ergostane and lanostane triterpenoids from Antrodia cinnamomea using caco-2 cell monolayer model. Nat Prod Bioprospect. 2015;5:237–246. doi: 10.1007/s13659-015-0072-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Chen Y.F., Chang C.H., Huang Z.N., Su Y.C., Chang S.J., Jan J.S. The JAK inhibitor antcin H exhibits direct anticancer activity while enhancing chemotherapy against LMP1-expressed lymphoma. Leuk Lymphoma. 2019;60:1193–1203. doi: 10.1080/10428194.2018.1512709. [DOI] [PubMed] [Google Scholar]
  • 17.Zhu H., Jian Z., Zhong Y., et al. Janus kinase inhibition ameliorates ischemic stroke injury and neuroinflammation through reducing NLRP3 inflammasome activation via JAK2/STAT3 pathway inhibition. Front Immunol. 2021;12 doi: 10.3389/fimmu.2021.714943. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Zhang M., Wu D., Xu J., et al. Suppression of NLRP3 inflammasome by dihydroarteannuin via the HIF-1α and JAK3/STAT3 signaling pathway contributes to attenuation of collagen-induced arthritis in mice. Front Pharmacol. 2022;13 doi: 10.3389/fphar.2022.884881. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Chiu K.Y., Chen T.H., Wen C.L., et al. Antcin-H isolated from Antrodia cinnamomea inhibits renal cancer cell invasion partly through inactivation of FAK-ERK-C/EBP-β/c-Fos-MMP-7 pathways. Evid Based Complement Alternat Med. 2017;2017 doi: 10.1155/2017/5052870. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Li L.H., Lin J.S., Chiu H.W., et al. Mechanistic insight into the activation of the NLRP3 inflammasome by Neisseria gonorrhoeae in macrophages. Front Immunol. 2019;10:1815. doi: 10.3389/fimmu.2019.01815. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Liao P.C., Chao L.K., Chou J.C., et al. Lipopolysaccharide/adenosine triphosphate-mediated signal transduction in the regulation of NLRP3 protein expression and caspase-1-mediated interleukin-1β secretion. Inflamm Res. 2013;62:89–96. doi: 10.1007/s00011-012-0555-2. [DOI] [PubMed] [Google Scholar]
  • 22.Tsai W.C., Wong W.T., Hsu H.T., et al. Surfactin containing Bacillus licheniformis-fermented products alleviate dextran sulfate sodium-induced colitis by inhibiting colonic inflammation and the NLRP3 inflammasome in mice. Animals (Basel) 2022;12:3456. doi: 10.3390/ani12243456. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Yang N., Xia Z., Shao N., et al. Carnosic acid prevents dextran sulfate sodium-induced acute colitis associated with the regulation of the Keap1/Nrf2 pathway. Sci Rep. 2017;7 doi: 10.1038/s41598-017-11408-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Bergsbaken T., Fink S.L., Cookson B.T. Pyroptosis: host cell death and inflammation. Nat Rev Microbiol. 2009;7:99–109. doi: 10.1038/nrmicro2070. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Baroja-Mazo A., Martín-Sánchez F., Gomez A.I., et al. The NLRP3 inflammasome is released as a particulate danger signal that amplifies the inflammatory response. Nat Immunol. 2014;15:738–748. doi: 10.1038/ni.2919. [DOI] [PubMed] [Google Scholar]
  • 26.Tschopp J., Schroder K. NLRP3 inflammasome activation: the convergence of multiple signalling pathways on ROS production? Nat Rev Immunol. 2010;10:210–215. doi: 10.1038/nri2725. [DOI] [PubMed] [Google Scholar]
  • 27.Zhou R., Yazdi A.S., Menu P., Tschopp J. A role for mitochondria in NLRP3 inflammasome activation. Nature. 2011;469:221–225. doi: 10.1038/nature09663. [DOI] [PubMed] [Google Scholar]
  • 28.Dick M.S., Sborgi L., Rühl S., Hiller S., Broz P. ASC filament formation serves as a signal amplification mechanism for inflammasomes. Nat Commun. 2016;7 doi: 10.1038/ncomms11929. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Bauernfeind F.G., Horvath G., Stutz A., et al. Cutting edge: NF-kappaB activating pattern recognition and cytokine receptors license NLRP3 inflammasome activation by regulating NLRP3 expression. J Immunol. 2009;183:787–791. doi: 10.4049/jimmunol.0901363. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Friedrich M., Pohin M., Powrie F. Cytokine networks in the pathophysiology of inflammatory bowel disease. Immunity. 2019;50:992–1006. doi: 10.1016/j.immuni.2019.03.017. [DOI] [PubMed] [Google Scholar]
  • 31.Aratani Y. Myeloperoxidase: its role for host defense, inflammation, and neutrophil function. Arch Biochem Biophys. 2018;640:47–52. doi: 10.1016/j.abb.2018.01.004. [DOI] [PubMed] [Google Scholar]
  • 32.Simon L.S. Role and regulation of cyclooxygenase-2 during inflammation. Am J Med. 1999;106:37S–42S. doi: 10.1016/s0002-9343(99)00115-1. [DOI] [PubMed] [Google Scholar]
  • 33.Robinson E.K., Covarrubias S., Carpenter S. The how and why of lncRNA function: an innate immune perspective. Biochim Biophys Acta Gene Regul Mech. 2020;1863 doi: 10.1016/j.bbagrm.2019.194419. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Xue Z., Zhang Z., Liu H., et al. lincRNA-Cox2 regulates NLRP3 inflammasome and autophagy mediated neuroinflammation. Cell Death Differ. 2019;26:130–145. doi: 10.1038/s41418-018-0105-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Atianand M.K., Hu W., Satpathy A.T., et al. A long noncoding RNA lincRNA-EPS acts as a transcriptional brake to restrain inflammation. Cell. 2016;165:1672–1685. doi: 10.1016/j.cell.2016.05.075. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Lv L., Xi H.P., Huang J.C., Zhou X.Y. LncRNA SNHG1 alleviated apoptosis and inflammation during ischemic stroke by targeting miR-376a and modulating CBS/H2S pathway. Int J Neurosci. 2021;131:1162–1172. doi: 10.1080/00207454.2020.1782904. [DOI] [PubMed] [Google Scholar]
  • 37.Alatab S., Sepanlou S.G., Ikuta K. GBD 2017 Inflammatory Bowel Disease Collaborators. The global, regional, and national burden of inflammatory bowel disease in 195 countries and territories, 1990-2017: a systematic analysis for the Global Burden of Disease Study 2017. Lancet Gastroenterol Hepatol. 2020;5:17–30. doi: 10.1016/S2468-1253(19)30333-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Zhang Y.Z., Li Y.Y. Inflammatory bowel disease: pathogenesis. World J Gastroenterol. 2014;20:91–99. doi: 10.3748/wjg.v20.i1.91. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Baumgart D.C., Le Berre C. Newer biologic and small-molecule therapies for inflammatory bowel disease. N Engl J Med. 2021;385:1302–1315. doi: 10.1056/NEJMra1907607. [DOI] [PubMed] [Google Scholar]
  • 40.Cunliffe R.N., Scott B.B. Review article: monitoring for drug side-effects in inflammatory bowel disease. Aliment Pharmacol Ther. 2002;16:647–662. doi: 10.1046/j.1365-2036.2002.01216.x. [DOI] [PubMed] [Google Scholar]
  • 41.Curkovic I., Egbring M., Kullak-Ublick G.A. Risks of inflammatory bowel disease treatment with glucocorticosteroids and aminosalicylates. Dig Dis. 2013;31:368–373. doi: 10.1159/000354699. [DOI] [PubMed] [Google Scholar]
  • 42.Singh S., Facciorusso A., Dulai P.S., Jairath V., Sandborn W.J. Comparative risk of serious infections with biologic and/or immunosuppressive therapy in patients with inflammatory bowel diseases: a systematic review and meta-analysis. Clin Gastroenterol Hepatol. 2020;18 doi: 10.1016/j.cgh.2019.02.044. 69-81.e3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Bauer C., Duewell P., Mayer C., et al. Colitis induced in mice with dextran sulfate sodium (DSS) is mediated by the NLRP3 inflammasome. Gut. 2010;59:1192–1199. doi: 10.1136/gut.2009.197822. [DOI] [PubMed] [Google Scholar]
  • 44.Li Y., Chen J., Bolinger A.A., et al. Target-based small molecule drug discovery towards novel therapeutics for inflammatory bowel diseases. Inflamm Bowel Dis. 2021;27:S38–S62. doi: 10.1093/ibd/izab190. [DOI] [PubMed] [Google Scholar]
  • 45.Franzosa E.A., Sirota-Madi A., Avila-Pacheco J., et al. Gut microbiome structure and metabolic activity in inflammatory bowel disease. Nat Microbiol. 2019;4:293–305. doi: 10.1038/s41564-018-0306-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Federici S., Kredo-Russo S., Valdés-Mas R., et al. Targeted suppression of human IBD-associated gut microbiota commensals by phage consortia for treatment of intestinal inflammation. Cell. 2022;185 doi: 10.1016/j.cell.2022.07.003. 2879-2898.e24. [DOI] [PubMed] [Google Scholar]
  • 47.Zhang J., Fu S., Sun S., Li Z., Guo B. Inflammasome activation has an important role in the development of spontaneous colitis. Mucosal Immunol. 2014;7:1139–1150. doi: 10.1038/mi.2014.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Perera A.P., Fernando R., Shinde T., et al. MCC950, a specific small molecule inhibitor of NLRP3 inflammasome attenuates colonic inflammation in spontaneous colitis mice. Sci Rep. 2018;8:8618. doi: 10.1038/s41598-018-26775-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Perera A.P., Kund D., Eri R. NLRP3 inhibitors as potential therapeutic agents for treatment of inflammatory bowel disease. Curr Pharmaceut Des. 2017;23:2321–2327. doi: 10.2174/1381612823666170201162414. [DOI] [PubMed] [Google Scholar]
  • 50.Oizumi T., Mayanagi T., Toya Y., Sugai T., Matsumoto T., Sobue K. NLRP3 inflammasome inhibitor OLT1177 suppresses onset of inflammation in mice with dextran sulfate sodium-induced colitis. Dig Dis Sci. 2022;67:2912–2921. doi: 10.1007/s10620-021-07184-y. [DOI] [PubMed] [Google Scholar]
  • 51.Bagherniya M., Khedmatgozar H., Fakheran O., Xu S., Johnston T.P., Sahebkar A. Medicinal plants and bioactive natural products as inhibitors of NLRP3 inflammasome. Phytother Res. 2021;35:4804–4833. doi: 10.1002/ptr.7118. [DOI] [PubMed] [Google Scholar]
  • 52.Direito R., Barbalho S.M., Figueira M.E., et al. Medicinal plants, phytochemicals and regulation of the NLRP3 inflammasome in inflammatory bowel diseases: a comprehensive review. Metabolites. 2023;13:728. doi: 10.3390/metabo13060728. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Li H.X., Wang J.J., Lu C.L., Gao Y.J., Gao L., Yang Z.Q. Review of bioactivity, isolation, and identification of active compounds from Antrodia cinnamomea. Bioengineering (Basel) 2022;9:494. doi: 10.3390/bioengineering9100494. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Huo Y., Win S., Than T.A., et al. Antcin H protects against acute liver injury through disruption of the interaction of c-jun-N-terminal kinase with mitochondria. Antioxidants Redox Signal. 2017;26:207–220. doi: 10.1089/ars.2016.6833. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Tien A.J., Chien C.Y., Chen Y.H., Lin L.C., Chien C.T. Fruiting bodies of Antrodia cinnamomea and its active triterpenoid, antcin K, ameliorates N-Nitrosodiethylamine-Induced hepatic inflammation, fibrosis and carcinogenesis in rats. Am J Chin Med. 2017;45:173–198. doi: 10.1142/S0192415X17500124. [DOI] [PubMed] [Google Scholar]
  • 56.Nakahira K., Haspel J.A., Rathinam V.A., et al. Autophagy proteins regulate innate immune responses by inhibiting the release of mitochondrial DNA mediated by the NALP3 inflammasome. Nat Immunol. 2011;12:222–230. doi: 10.1038/ni.1980. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Xian H., Watari K., Sanchez-Lopez E., et al. Oxidized DNA fragments exit mitochondria via mPTP- and VDAC-dependent channels to activate NLRP3 inflammasome and interferon signaling. Immunity. 2022;55 doi: 10.1016/j.immuni.2022.06.007. 1370-1385.e8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Zhong Z., Liang S., Sanchez-Lopez E., et al. New mitochondrial DNA synthesis enables NLRP3 inflammasome activation. Nature. 2018;560:198–203. doi: 10.1038/s41586-018-0372-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Boyapati R.K., Dorward D.A., Tamborska A., et al. Mitochondrial DNA is a pro-inflammatory damage-associated molecular pattern released during active IBD. Inflamm Bowel Dis. 2018;24:2113–2122. doi: 10.1093/ibd/izy095. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Ho G.T., Theiss A.L. Mitochondria and inflammatory bowel diseases: toward a stratified therapeutic intervention. Annu Rev Physiol. 2022;84:435–459. doi: 10.1146/annurev-physiol-060821-083306. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Verma A., Pittala S., Alhozeel B., et al. The role of the mitochondrial protein VDAC1 in inflammatory bowel disease: a potential therapeutic target. Mol Ther. 2022;30:726–744. doi: 10.1016/j.ymthe.2021.06.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Mattick J.S., Amaral P.P., Carninci P., et al. Long non-coding RNAs: definitions, functions, challenges and recommendations. Nat Rev Mol Cell Biol. 2023;24:430–447. doi: 10.1038/s41580-022-00566-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Menon M.P., Hua K.F. The long non-coding RNAs: paramount regulators of the NLRP3 inflammasome. Front Immunol. 2020;11 doi: 10.3389/fimmu.2020.569524. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Li H., Xuan J., Zhang W., et al. Long non-coding RNA SNHG5 regulates ulcerative colitis via microRNA-375/Janus kinase-2 axis. Bioengineered. 2021;12:4150–4158. doi: 10.1080/21655979.2021.1953219. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Li F., Liu H., Fu J., et al. Knockdown of long non-coding RNA NEAT1 relieves inflammation of ulcerative colitis by regulating the miR-603/FGF9 pathway. Exp Ther Med. 2022;23:131. doi: 10.3892/etm.2021.11054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Feng X., Xiao Y., He J., et al. Long noncoding RNA Gm31629 protects against mucosal damage in experimental colitis via YB-1/E2F pathway. JCI Insight. 2022;7 doi: 10.1172/jci.insight.150091. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Wang Y., Wang N., Cui L., et al. Long non-coding RNA MEG3 alleviated ulcerative colitis through upregulating miR-98-5p-sponged IL-10. Inflammation. 2021;44:1049–1059. doi: 10.1007/s10753-020-01400-z. [DOI] [PubMed] [Google Scholar]
  • 68.Michielan A., D'Incà R. Host-microbiome interaction in Crohn's disease: a familiar or familial issue? World J Gastrointest Pathophysiol. 2015;6:159–168. doi: 10.4291/wjgp.v6.i4.159. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Nighot P.K., Hu C.A., Ma T.Y. Autophagy enhances intestinal epithelial tight junction barrier function by targeting claudin-2 protein degradation. J Biol Chem. 2015;290:7234–7246. doi: 10.1074/jbc.M114.597492. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Foerster E.G., Mukherjee T., Cabral-Fernandes L., Rocha J.D.B., Girardin S.E., Philpott D.J. How autophagy controls the intestinal epithelial barrier. Autophagy. 2022;18:86–103. doi: 10.1080/15548627.2021.1909406. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Chuang S.Y., Yang C.H., Chou C.C., Chiang Y.P., Chuang T.H., Hsu L.C. LR-induced PAI-2 expression suppresses IL-1β processing via increasing autophagy and NLRP3 degradation. Proc Natl Acad Sci U S A. 2013;110:16079–16084. doi: 10.1073/pnas.1306556110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Harris J., Hartman M., Roche C., et al. Autophagy controls IL-1beta secretion by targeting pro-IL-1beta for degradation. J Biol Chem. 2011;286:9587–9597. doi: 10.1074/jbc.M110.202911. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Nakahira K., Haspel J.A., Rathinam V.A., et al. Autophagy proteins regulate innate immune responses by inhibiting the release of mitochondrial DNA mediated by the NALP3 inflammasome. Nat Immunol. 2011;12:222–230. doi: 10.1038/ni.1980. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.Zhou R., Yazdi A.S., Menu P., Tschopp J. A role for mitochondria in NLRP3 inflammasome activation. Nature. 2011;469:221–225. doi: 10.1038/nature09663. [DOI] [PubMed] [Google Scholar]
  • 75.Burdette B.E., Esparza A.N., Zhu H., Wang S. Gasdermin D in pyroptosis. Acta Pharm Sin B. 2021;11:2768–2782. doi: 10.1016/j.apsb.2021.02.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Zhang S., Liang Y., Yao J., Li D.F., Wang L.S. Role of pyroptosis in inflammatory bowel disease (IBD): from gasdermins to DAMPs. Front Pharmacol. 2022;13 doi: 10.3389/fphar.2022.833588. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Wang X., Li H., Li W., et al. The role of Caspase-1/GSDMD-mediated pyroptosis in Taxol-induced cell death and a Taxol-resistant phenotype in nasopharyngeal carcinoma regulated by autophagy. Cell Biol Toxicol. 2020;36:437–457. doi: 10.1007/s10565-020-09514-8. [DOI] [PubMed] [Google Scholar]
  • 78.Li M.Y., Zhu X.L., Zhao B.X., et al. Adrenomedullin alleviates the pyroptosis of Leydig cells by promoting autophagy via the ROS-AMPK-mTOR axis. Cell Death Dis. 2019;10:489. doi: 10.1038/s41419-019-1728-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Tsai D.H., Chung C.H., Lee K.T. Antrodia cinnamomea induces autophagic cell death via the CHOP/TRB3/Akt/mTOR pathway in colorectal cancer cells. Sci Rep. 2018;8 doi: 10.1038/s41598-018-35780-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80.Ruan S., Yang Y., Li W. Antrodia Camphorata Polysaccharide activates autophagy and regulates NLRP3 degradation to improve liver injury-related inflammatory response. Aging (Albany NY) 2022;14:8970–8981. doi: 10.18632/aging.204330. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81.Su Y.C., Liu C.T., Chu Y.L., Raghu R., Kuo Y.H., Sheen L.Y. Eburicoic acid, an active triterpenoid from the fruiting bodies of basswood cultivated Antrodia cinnamomea, induces ER stress-mediated autophagy in human hepatoma cells. J Tradit Complement Med. 2012;2:312–322. doi: 10.1016/s2225-4110(16)30117-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82.Yang H.L., Tsai C.H., Shrestha S., Lee C.C., Liao J.W., Hseu Y.C. Coenzyme Q0, a novel quinone derivative of Antrodia camphorata, induces ROS-mediated cytotoxic autophagy and apoptosis against human glioblastoma cells in vitro and in vivo. Food Chem Toxicol. 2021;155 doi: 10.1016/j.fct.2021.112384. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

mmc1.docx (95KB, docx)

Data Availability Statement

Data will be made available on request.


Articles from Journal of Traditional and Complementary Medicine are provided here courtesy of Elsevier

RESOURCES