Skip to main content
NCBI home page
ACS Omega logoLink to ACS Omega
. 2025 Jun 29;10(27):29428–29441. doi: 10.1021/acsomega.5c02585

Alleviation of Depression-Like Symptoms Through Orientin-Mediated Regulation of Neuroinflammation and PI3K/AKT Signaling

Yaya Du †, Jingcheng Yang †, Fei Li ‡, Linxi Wang †,§, Yiyuan Tian ∥, Le Yang †, Lanxin Luo †,*
PMCID: PMC12268429  PMID: 40687051

Abstract

Neuroinflammation is vital in depression’s onset and development, making its relief a key treatment goal. Orientin (ORI), a natural flavonoid, is known to modulate inflammation, but whether it can ease depression by regulating neuro-inflammation remains uncertain. This study aimed to uncover ORI’s antineuroinflammation mechanisms for treating depression. It utilized LPS-induced cell and mouse models and Chronic Unpredictable Mild Stress (CUMS) model. Enzyme-linked immunoassay, Western blotting, and immunofluorescence staining gauged ORI’s anti-inflammatory effects. Behavioral tests assessed the impact on depressive symptoms. Network pharmacology and molecular biology methods probed its action mechanism and anti-inflammation targets. ORI effectively curbed inflammation, blocked M1 polarization, and reduced the inflammatory mediator release in LPS-induced BV2 cells and mice. In LPS-induced and CUMS depression mouse models, ORI notably alleviated depression-like behavior and neuroinflammation in the prefrontal cortex (PFC). Also, ORI treatment reduced the LPS-induced spike in the frequency of spontaneous excitatory postsynaptic currents (sEPSC) in PFC neurons. The PI3K/AKT signaling pathway was found to underpin ORI’s effects. Overall, ORI shows potential as a natural remedy for depression, influencing neuroinflammation and regulating microglial polarization and neuronal excitability to improve symptoms.

graphic file with name ao5c02585_0011.jpg

graphic file with name ao5c02585_0009.jpg

1. Introduction

The robust association between neuroinflammation and various mood disorders is extensively recognized as a critical determinant in the etiology of mental health issues and resultant disabilities on a global scale. Empirical research has elucidated heightened microglial activity in brain regions implicated in depression, including the prefrontal cortex, anterior cingulate cortex, and insula, during episodes of major depression. , The increased activity of inflammatory cytokines or microglia has been implicated in the manifestation of depressive symptoms. , Evidence suggests that attenuating microglial activation can ameliorate behaviors analogous to depression. Therefore, targeting neuroinflammation is a crucial tool for alleviating depression-like symptoms.

Microglia play a key role in regulating neuroinflammation and maintaining central nervous system (CNS) homeostasis. Microglia display a spectrum of activation states contingent upon the specific signals they encounter, which can span the range from protective to deleterious. In the context of neuroinflammation, activated microglia secrete inflammatory mediators such as tumor necrosis factor-α (TNF-α), interleukin-1 beta (IL-1β), and inducible nitric oxide synthase (iNOS), which can precipitate neuronal dysfunction and degeneration. This inflammatory cascade is implicated in the pathogenesis of various psychological disorders, including depression. Thus, mitigating neuroinflammation is essential in the treatment of depression-like symptoms.

Orientin (ORI) belongs to the family of natural flavonoids and is mainly extracted from Polygonum orientale. As an active compound, it has a variety of excellent properties, including neuroprotective, anti-inflammatory, analgesic, antiviral, antioxidant, and antibacterial effects. In the field of clinical application, orientin shows extremely broad prospects. For example, it has positive application value in the treatment of cardiovascular diseases, neuropathic pain, and inflammatory diseases. In vivo models of inflammation have substantiated ORI’s anti-inflammatory effects, thereby endorsing its application in traditional medicine for the management of inflammatory conditions. ORI has been demonstrated to downregulate the secretion of pro-inflammatory cytokines in mast cells. ORI has also been reported to alleviate LPS-induced acute lung injury by inhibiting inflammation and oxidative stress. Additionally, research has shown that ORI exerts a significant neuroprotective effect in rotenone-induced Parkinson’s disease by modulating pathways such as Nrf2-ARE, PI3K-AKT, JNK-ERK1/2, and TLR4/NF-κB. While previous studies have highlighted the therapeutic potential of ORI in the treatment of inflammation-related diseases, its specific therapeutic role in depression remains unclear.

This research aims to bridge the existing gap by employing both acute and chronic animal models of depression, in conjunction with an LPS-induced BV2 microglial cell model, to elucidate the mechanism of action of ORI. The results of this study enhance our understanding of ORI’s antidepressant properties, providing valuable insights into its potential application as a natural intervention for ameliorating depression.

2. Materials and Methods

2.1. Cell Culture

BV2 cells were grown in high glucose DMEM with 10% FBS, 40 units/mL penicillin, and 40 μg/mL streptomycin, and maintained at 37 °C in T25 flasks with 5% CO2.

2.2. Cytotoxicity by CCK-8 Assay

The CCK-8 cell counting kit (code HY-K0301–100T, MCE, USA) was utilized to assess the cytotoxic effects of ORI in vitro. BV2 microglia were exposed to either a drug-containing solution (0.1%) or varying concentrations of ORI (2, 4, 8, 16, 32, 64, 128, or 256 μM) for 24 h, followed by incubation with the CCK-8 solution for 30 min. Tecan Infinite M200 PRO multimode microplate reader (Tecan, Switzerland) was used to determine cell viability at 450 nm.

2.3. Real-Time PCR

Inflammatory cytokine production was assessed following ORI treatment. BV2 microglial cells were pretreated with 0, 2, 8, and 32 μM ORI for 18 h and then stimulated with 1 μg/mL LPS for 6 h. RNA was extracted using TRIzol, and cDNA was synthesized with the Superscript cDNA Premix Kit II. The cDNA was analyzed via 40 cycles of real-time PCR on the QuantStudio 5 system using primers listed in Table , using GAPDH for normalization.

1. Primer Sequences.

Gene Forward Reverse
IL-10 GCCTCTTCTCATTCCTGCTTGTGG GTGGTTTGTGAGTGTGAGGGTCTG
IL-6 TCGCAGCAGCACATCAACAAGAG AGGTCCACGGGAAAGACACAGG
IL-1β CTTCTTGGGACTGATGCTGGTGAC AGGTCTGTTGGGAGTGGTATCCTC
TNF-α TCCCTGGGTGAGAAGCTGAAGAC CACCTGCTCCACTGCCTTGC
GAPDH AGAAGGTGGTGAAGCAGGCATC CGAAGGTGGAAGAGTGGGAGTTG
Open in a new tab

2.4. Immunofluorescence Staining

The immunofluorescence staining process of BV2 cells is as follows: After fixation with 4% paraformaldehyde, the cells are treated with a permeabilization buffer for 10 min and blocked with serum for 30 min. Subsequently, they are incubated overnight at 4 °C with primary antibodies against Arg-1 (16001-1-AP, 1:500, Thermo) and iNOS (AB178945, 1:500, Abcam). After being washed three times with PBS, the cells are incubated with antirabbit fluorescent secondary antibodies at room temperature for 1 h and then washed again with PBS. The cell nuclei are stained with DAPI for 5 min, washed three times with PBS, and then the coverslips are mounted. Before the immunofluorescence staining of mouse brain tissues, 50 mg/kg pentobarbital sodium is intraperitoneally injected after the behavioral test. The brain tissues are perfused with normal saline and fixed with PFA in the heart. Then, the mouse brain tissues are taken out, fixed in PFA overnight, dehydrated in a sucrose solution, and finally frozen sections are prepared. The staining steps for the sections are the same as those for the cells. Finally, fluorescent images are collected using an Olympus microscope, and positive cells are quantitatively analyzed using ImageJ software.

2.5. Animals

In this experiment, 6-week-old male C57BL/6 mice were housed with continuous access to food and water under controlled temperature and humidity conditions. The mice were acclimated to the laboratory environment for 1 week before the experiment. The animal care procedures have been reviewed and approved by the Animal Ethics Committee of Fourth Military Medical University (approval number: 20240078) and strictly adhere to ethical principles regarding animal welfare.

2.6. Development of an LPS-Induced Depression Model and Administration of ORI Treatment

To systematically analyze the intervention mechanism of orientin (ORI) pretreatment on lipopolysaccharide (LPS)-induced depression models, this study selected 6-week-old male C57BL/6 mice (body weight: 20–23 g), which were randomly and equally divided into three groups (n = 6 per group): (I) control group, (II) LPS model group, and (III) LPS + 50 mg/kg ORI intervention group. During the intervention period, mice in the ORI intervention group were intraperitoneally injected with the drug daily for 7 consecutive days, while mice in the LPS model group were intraperitoneally injected with an equal volume of normal saline as a control. On day 7 of the experiment, 30 min after the intraperitoneal injection, mice in the LPS model group and the LPS + ORI intervention group were intraperitoneally injected with a 10 mg/kg LPS solution, and mice in the control group were simultaneously injected with an equal volume of PBS buffer. One hour after LPS injection, a series of behavioral detection procedures were immediately initiated, and all evaluation items were completed in an orderly manner within 30 h.

2.7. Establishment and Treatment of a Chronic Unpredictable Mild Stress (CUMS) Depression Mouse Model

This long-term protocol involves applying a series of unpredictable stressors over 6 weeks, with each stressor randomly administered daily. The stressors included: (1) exposure to ice water at 4 °C for 5 min; (2) exposure to 85 dB noise for 5 h; (3) physical restraint for 4 h; (4) placement in wet bedding for 12 h; (5) exposure to intermittent flashing light for 12 h; (6) tail clipping for 5 min, followed by 2 consecutive days without stimulation. Tail clipping is a type of noxious stimulation, and the setting of the interval period increases the unpredictability of the stress. During the modeling process, orientin was administered intraperitoneally at a concentration of 50 mg/kg.

2.8. Sucrose Preference Test (SPT)

On the day of the experiment, 50 mL drinking bottles containing either sugar or regular water were placed in the animal cage, allowing the mice to choose freely. The positions of the bottles were switched every 6 h. Consumption of both liquids was recorded over 24 h.

2.9. Open Field Test (OFT)

The test was conducted in an open arena under bright indoor lighting to evaluate the mice’s locomotor and exploratory behaviors. Mice were placed in the center of the arena and given a 2-min acclimation period. Following acclimation, the distance traveled, time spent in the central area, and frequency of entries into the central area were recorded over 15 min. The arena was cleaned with 75% alcohol between trials to eliminate any residual scents.

2.10. Tail Suspension Test (TST)

The mice were gently held and suspended by their tails using adhesive tape, positioned approximately 1–2 cm from the tip. Their behaviors, including struggling, swinging, and periods of immobility, were carefully monitored and recorded. The duration of each test was 6 min.

2.11. Forced Swimming Test (FST)

The mice were introduced into a pool, where their water behavior was carefully observed. The pool’s depth prevented the mice from standing, which forced them to swim. Immobility was characterized by the mouse floating with minimal movement required to keep its head above water. After a 2-min acclimation period, immobility was recorded for 4 min.

2.12. Western Blotting

Cell and tissue samples were collected, and proteins were extracted and quantified using the BCA protein assay. The proteins were separated by electrophoresis, transferred onto membranes, and blocked. Membranes were incubated overnight with primary antibodies against TNF-α, IL-6, IL-1β, iNOS, Arg-1, and β-actin. The ratios and item numbers are as follows: (11948S, 1:1000, CST), (12912S, 1:1000, CST), (12242, 1:1000, CST), (ab178945, 1:1000, Abcam), (16001–1-AP, 1:500, Thermo), and (A5316, 1:1000, Sigma). After a thorough wash with TBST, the membranes were incubated with horseradish peroxidase-conjugated secondary antibodies (1:5000, goat antirabbit or goat antimouse). Images were captured using the Clinx 6600 Plus imager with an ECL detection solution, and band intensities were quantified using ImageJ software (NIH).

2.13. Enzyme-Linked Immunosorbent Assay (ELISA)

Supernatants obtained from animal blood and cell samples were collected, followed by the quantification of inflammatory factors using specific ELISA kits targeting IL-1β (88-7013, Thermo Fisher), TNF-α (88-7324, Thermo Fisher), IL-6 (88-7064, Thermo Fisher), and IL-10 (88-7105, Thermo Fisher).

2.14. Whole-Cell Patch-Clamp Recordings

Prefrontal cortex coronal sections (300 μm) were prepared with oxygenated ACSF (pH 7.2–7.4) from animals euthanized by cervical dislocation. Brain slices were incubated in ACSF at room temperature for 1 h before whole-cell patch-clamp recordings. Spontaneous excitatory postsynaptic currents (sEPSCs) were recorded from prefrontal cortex neurons using whole-cell voltage clamp (V h = −70 mV) with 100 μM picrotoxin. Data were excluded if series resistance changed by over 15% or resting membrane potential depolarized past – 60 mV. Voltage-clamp data were analyzed offline for sEPSC using Minianalysis software (v6.0.7).

2.15. Network Pharmacology

Potential ORI targets, depression-related targets, protein–protein interaction (PPI) network, and pathway enrichment analysis were performed as described previously.

2.16. Statistical Analysis

Data were presented as mean ± standard error of the mean (SEM) from three different experiments. Statistical differences between groups were assessed utilizing one-way ANOVA followed by Tukey’s post hoc test, with significance defined as a P-value below 0.05.

3. Results

3.1. ORI Pretreatment Downregulated the Level of LPS-Induced Inflammation in BV2 Cells

Microglia, the brain’s immune cells similar to macrophages, play a crucial role in the immune response by releasing cytokines and chemokines. These cells are highly responsive to injury and stress, contributing to sustained neuroinflammation and mental disorders. LPS, an endotoxin from the outer membrane of Gram-negative bacteria, triggers a substantial inflammatory response. To investigate whether ORI could protect microglia from LPS-induced toxicity, BV2 mouse microglial cells were treated with various concentrations of ORI, and cell viability was measured using the CCK-8 assay. The results showed that ORI did not affect BV2 cell viability within the tested dosage range (Figure B). Pro-inflammatory cytokines are pivotal in the inflammatory process. Real-time PCR (Figure D–G) showed that pretreatment with ORI (2, 8, or 32 μM) significantly reduced mRNA levels of LPS-induced inflammatory factors, TNF-α (p = 0.0017, p = 0.0082, and p = 0.0008), IL-1β (p < 0.01, p < 0.01, and p < 0.01), and IL-6 (p < 0.01, p < 0.01, and p < 0.01). Additionally, ORI at 8 μM increased the mRNA level of the anti-inflammatory factor IL-10 (p = 0.0105). Cytokine levels in BV2 cells were further analyzed by ELISA and Western blotting. ELISA results revealed a significant increase in pro-inflammatory cytokines, such as TNF-α, IL-1β, and IL-6, in the LPS-treated group compared to the control group, while IL-10 levels were notably decreased (p < 0.0001, p = 0.0020, p < 0.0001, p = 0.0033, Figure H–K). Western blotting results were consistent with the ELISA findings, showing significant reductions in pro-inflammatory factors following ORI treatment (p = 0.0315, p = 0.0194, p = 0.0054, Figure L,M). These results indicate that ORI effectively inhibits the inflammatory response in microglia, reducing the levels of pro-inflammatory cytokines.

1.

1

Open in a new tab

ORI pretreatment downregulates LPS-evoked proinflammatory cytokine levels in BV2 microglial cells.

(A) Depict the chemical structure of orientin; (B) BV2 microglia were treated with various concentrations of ORI (ranging from 0 to 256 μM), and a CCK-8 assay was conducted to evaluate cell viability (with n = 11–12 per group); (C) outline the detailed procedures for cell processing; (D–G) present the real-time fluorescence quantitative PCR analyses of the mRNA levels of inflammatory factors; (H–K) demonstrate the use of an ELISA kit to measure the levels of inflammatory factors in BV2 cells; and (L, M) illustrate the detection of inflammatory factor protein expression by Western blotting. *p < 0.05, **p < 0.01 compared to the control group. # p < 0.05, ## p < 0.01 compared to the LPS group.

3.2. ORI Pretreatment Restored the Upregulation of Arg-1 Protein Expression (M2 Marker) and Downregulation of iNOS Protein Expression (M1 Marker) in LPS-Induced BV2 Microglial Cells

Compared to peripheral macrophages, microglia exhibit both similar and distinct characteristics in terms of phenotypic polarization, contributing to their innate immune function. Upon LPS stimulation, microglia predominantly shift to the M1 phenotype, leading to upregulation of pro-inflammatory cytokines. In contrast, the M2 phenotype, which is associated with anti-inflammatory responses, is downregulated, thereby contributing to the overall inflammatory process. Immunofluorescence results showed an increase in iNOS expression in BV2 cells following LPS induction (p = 0.0024, Figure B), while ORI (2, 8, and 32 μM) (p = 0.9577, p = 0.0015, p = 0.0044, Figure C) treatment significantly decreased iNOS expression. In addition, Arg-1 expression was reduced in the LPS group (p < 0.0001, Figure D), while M2 microglia (Arg-1 positive) increased after treatment with ORI (2, 8, and 32 μM) (p < 0.0001, p < 0.0001, p = 0.0279, Figure E). Western blotting results corroborated the findings from immunofluorescence staining. The expression of iNOS was markedly reduced with ORI treatment (2, 8, and 32 μm) (p = 0.0034, p = 0.0083, and p = 0.0018, Figure F,G), while Arg-1 expression was significantly elevated (p = 0.1429, p < 0.0022, p = 0.0005, Figure F,G). These results indicated that ORI could effectively inhibit the polarization of microglia induced by LPS.

2.

2

Open in a new tab

Effect of ORI on LPS-induced M1/M2 phenotype changes in BV2 cells.

(A) Provide a flowchart of the cell staining process; (B) display the immunofluorescence staining of iNOS in BV2 cells, where iNOS is shown in green and DAPI in blue; (C) present the relative fluorescence intensity of iNOS (expressed as a fold of the control vector); (D) show the immunofluorescence staining of Arg −1 in BV2 cells, with Arg −1 shown in green and DAPI shown in blue. The scale bar is set at 50 μm. (E) Illustrate the relative fluorescence intensity of Arg −1 (expressed as a fold of the control vector); (F) detect the expression of M1 and M2 markers in BV2 cells by Western blotting; and (G) quantitatively analyze the M1/M2 markers by Western blotting. The data are presented as means ± SD (n = 3). Statistical significance was denoted as *p < 0.05 and **p < 0.01 compared to the control group, and # p < 0.05 and ## p < 0.01 compared to the LPS group.

3.3. ORI Improved Depression-Like Behavior in the LPS-Induced Mouse Model

Pro-inflammatory cytokines are key contributors to depression-like behavior. Given ORI’s demonstrated ability to significantly inhibit LPS-induced inflammation in BV2 cells in vitro, we extended our investigation to animal models to further explore its effects. Initially, open-field behavior was assessed, showing no significant differences in central time and distance between the ORI-treated and control groups (p > 0.05, p > 0.05; Figure B,C), indicating no presence of anxiety-like behavior. Behavioral tests for depression-like symptoms revealed that LPS-treated mice had a significantly lower sucrose preference in the sucrose preference test (SPT) compared to the control group (p = 0.0015, Figure D,E). Immobility time and bouts of immobility were markedly increased in the forced swimming test (FST) (p = 0.0011, p = 0.0176, Figure F,G) and tail suspension test (TST) (p = 0.0002, p = 0.0226, Figure H,I), suggesting significant depression-like behavior in LPS-injected mice. Interestingly, mice treated with ORI (50 mg/kg) showed significant improvements in depression-like behaviors, as evidenced by improvements in SPT, FST, and TST (p = 0.0234, p = 0.0004, p = 0.0003, Figure D–I). These findings suggest that ORI can alleviate depression-like behaviors triggered by LPS in mice.

3.

3

Open in a new tab

ORI treatment reversed LPS-induced depression-like behavior in mice.

(A) Describe the animal handling and behavior testing procedures; (B) present the original track of the open-field behavior; (C) provide statistics on the total distance traveled, central time, and central distance in the open-field behavior; (D, E) conduct the sugar water preference experiment; (F) illustrate the schematic diagram of the forced swimming test; (G) report the time and number of immobility episodes in the forced swimming test; (H) present the schematic diagram of the tail suspension test; and (I) report the stationary time and the number of stationary periods in the tail suspension test. Statistical significance was indicated as *p < 0.05 or **p < 0.01 compared to the control group, and # p < 0.05 or ## p < 0.01 compared to the LPS group. DFH images were generated by the research team.

3.4. ORI Regulated LPS-Induced Excitatory Postsynaptic Currents (sEPSCs) in the PFC Region and Inhibited the Inflammatory Responses

To investigate whether LPS-induced inflammation affects neuronal excitability, we recorded sEPSC using whole-cell patch clamps (Figure A). Results show that, compared with the control group, LPS group sEPSC frequency increased significantly (p = 0.0131, Figure C,E). Notably, ORI treatment (50 mg/kg) significantly reversed the LPS-induced increase in sEPSC frequency (p = 0.0019). However, neither LPS nor ORI (50 mg/kg) influenced the amplitude of sEPSC (p = 0.9960, p = 0.9568, Figure B,D). These results suggest that ORI effectively restores the response of excitatory postsynaptic currents to LPS in the prefrontal cortex. To assess the impact of ORI on these cytokines, we used ELISA to analyze serum samples and Western blotting to evaluate PFC tissue. ELISA results indicated an increase in pro-inflammatory cytokines, specifically TNF-α, IL-1β, and IL-6, in the LPS-treated group compared to the control group (p = 0.0008, p < 0.0001, p = 0.0060, Figure F). These findings were confirmed by Western blotting analysis (p = 0.0480, p = 0.0145, p = 0.0005, Figure G,H). Pretreatment with ORI significantly reduced the expression of these pro-inflammatory factors, indicating its potential effectiveness in mitigating the release of inflammatory cytokines in the PFC induced by LPS.

4.

4

Open in a new tab

ORI regulates LPS-induced excitatory postsynaptic currents (sEPSCs) in the PFC of mice and inhibits the inflammatory response in this brain region.

(A) Record the sEPSCs of mouse prefrontal cortex neurons at a holding potential of −70 mV; (B, C) present the histogram of the amplitude (left) and cumulative frequency (right) of mouse neuron sEPSCs; (D, E) summarize the sEPSCs amplitude (left) and frequency (right) of mouse neurons (with n = 8 neurons from 3 mice); (F) detect the expression of pro-inflammatory factors in the serum of each group using ELISA; (G) determine the expression of pro-inflammatory factors in hippocampal tissue by Western blotting; (H) Quantify the pro-inflammatory factors detected by Western blotting. Values are presented as means ± SD (n = 3). Statistical significance was denoted as *p < 0.05 or **p < 0.01 compared to the control group, and # p < 0.05 or ## p < 0.01 compared to the LPS group.

3.5. Exploration of Pathways for the Potential Antidepressant Effects of ORI: ORI Regulates the PI3K/AKT Signaling Pathway in LPS-Induced Mice

A total of 113 potential targets related to ORI compounds were identified from the Swiss Target Prediction and TCMSP databases after removing duplicates. Additionally, 2371 targets associated with depression were obtained from the DisGeNet and GeneCards databases. Details of these targets are provided in the Supporting Information. A Venn diagram (Figure A) illustrates the overlap between these sources, revealing 67 potential targets linked to both ORI and depression. These shared targets were used to construct PPI networks (Figure B) utilizing the STRING database, enabling a more thorough examination of their roles via GO and KEGG pathway enrichment analyses. Figure C displays the top 10 enhanced outcomes for biological processes, cellular components, and molecular functions. KEGG pathway analysis identified 147 significant signaling pathways, with the top 20 highlighted in Figure D, emphasizing the strong association with the PI3K/AKT signaling pathway and implying ORI’s involvement in the mechanism of depression. Abnormalities in both the functional and structural aspects of the PFC have been demonstrated in individuals with major depression and those susceptible to the condition. The PFC is one of the most commonly affected brain regions in depression. Therefore, we investigated the effect of ORI on critical proteins in the PI3K/AKT signaling pathway within the PFC tissues of mice with LPS-induced depression. As illustrated in Figure E, phosphorylation levels of PI3K and AKT in the PFC of LPS-treated mice were significantly elevated compared to the control group (p = 0.0429, p = 0.0154, Figure E,F). Conversely, the phosphorylation levels of GSK3β decreased (p = 0.0011, Figure F), although the total protein levels remained constant. Treatment with ORI significantly restored the phosphorylation of PI3K, AKT, and GSK3β levels (Figure E,F). These observations indicate that ORI alleviates depression-like symptoms in LPS-treated mice by modulating the PI3K/AKT signaling pathway.

5.

5

Open in a new tab

Network pharmacology analyses and ORI restore the PI3K/AKT/GSK3β signaling pathway in the PFC region.

(A) The Venn diagram shows the overlapping targets between ORI and depression; (B) the protein–protein interaction network was constructed using 67 cross–targets, with each node representing a different protein; (C) the Gene Ontology enrichment analysis includes biological process, cellular component, and molecular function; (D) the Kyoto Encyclopedia of Genes and Genomes pathway enrichment analysis was performed; (E) illustrate the phosphorylation and total levels of the PI3K/AKT/GSK3β proteins; and (F) present the results of the Western blot analysis. The values are presented as means ± SD (n = 3). Statistical significance was denoted as *p < 0.05 or **p < 0.01 compared to the control group, and # p < 0.05 or ## p < 0.01 compared to the LPS group.

3.6. ORI Pretreatment Reversed Depression-Like Behavior in CUMS Mouse Model

CUMS represents one of the most comprehensive and potent rodent models for exploring depression. To evaluate the therapeutic efficacy of ORI in vivo, we established a model of depression based on the CUMS paradigm. The outcomes from the SPT, OFT, TST, and FST provide compelling evidence for the ability of ORI to alleviate depression-like behavior induced by CUMS (Figure ). Specifically, ORI markedly restored the decline in sucrose intake observed in the CUMS-inflicted SPT (p = 0.0008, Figure D), suggesting a significant improvement in anhedonia. Furthermore, ORI reduced the duration of immobility recorded in both the TST and FST, indicating a decrease in feelings of despair (p = 0.0121, p = 0.0069, Figure B,C). Additionally, ORI enhanced exploratory behavior and alleviated anxiety-related symptoms, as demonstrated by an increase in the distance moved in the center area and the time spent there (p = 0.0034, p = 0.0016), both of which were negatively impacted by CUMS (Figure E). Collectively, these findings suggest that ORI exhibits an antidepressant effect in models of depression induced by both CUMS and LPS.

6.

6

Open in a new tab

ORI treatment reversed depression-like behavior in CUMS mice. (A) Describe the animal handling and behavior testing procedures; (B) report the stationary time and the number of stationary periods in the tail suspension test; (C) provide the time and amount of immobility in the forced swimming test; (D) conduct the sugar water preference experiment; and (E) provide statistics on the total distance traveled, central time, and central distance in the open field behavior. Statistical significance was indicated as *p < 0.05 or **p < 0.01 compared to the control group, and # p < 0.05 or ## p < 0.01 compared to the CUMS group.

3.7. ORI Promoted the Transformation of PFC Microglia from M1to M2 Type in the CUMS Model

ORI promotes the transformation of prefrontal cortical microglia from the M1 type to the M2 type in a CUMS model of depression in mice. To further explore whether the antidepressant effects of ORI in the CUMS model are mediated through a reduction in inflammatory responses, we performed immunofluorescence staining of the PFC. Our findings revealed that CUMS led to a decrease in the expression of arginase-1 (Arg-1) and a reduction in the proportion of anti-inflammatory (Arg-1-IBa1) cells in the PFC, accompanied by an increase in the proportion of inducible nitric oxide synthase (iNOS) and proinflammatory (iNOS-IBa1) microglia (Figure A–D). Notably, these alterations were reversed following the administration of 50 mg/kg of ORI (Figure A–D). These results indicate that ORI induces a phenotypic shift in activated microglia in the PFC from a pro-inflammatory (iNOS) state to a neuroprotective (Arg-1) state. Collectively, these findings suggest that ORI reduces the activation of microglia and the expression of inflammatory cytokines, which may represent a key mechanism underlying ORI’s antidepressant effects.

7.

7

Open in a new tab

ORI transforms the activated microglia in the PFC of CUMS mice from a pro-inflammatory phenotype to an anti-inflammatory phenotype. (A) Present the immunofluorescence staining results of iNOS and Iba1 in the PFC brain region of CUMS mice, with iNOS in green and Iba1 in red; (B) report the relative fluorescence intensity of iNOS-positive cells (in mm2); (C) present the immunofluorescence staining results of Arg 1 and Iba1 in the PFC brain region of CUMS mice, with Arg 1 in green and Iba1 in red; and (D) report the relative fluorescence intensity of Arg 1-positive cells (in mm2).

4. Discussion

As a flavonoid monomer with multiple bioactive properties, ,− ORI has demonstrated translational potential in inflammation modulation and neuroprotection, − particularly given its structural features (e.g., C2–C3 double bond and catechol moiety) that enhance blood–brain barrier permeability. In this study, an acute LPS-induced model and a chronic unpredictable mild stress (CUMS) model were constructed and combined with an in vitro BV2 microglial cell inflammation model to systematically explore the antidepressant effect of ORI and its underlying mechanisms.

In the in vitro experiments (Figures and ), LPS stimulation significantly induced polarization of BV2 microglia into the M1 type, which was manifested by the upregulation of inducible nitric oxide synthase (iNOS) expression and the massive release of pro-inflammatory cytokines such as interleukin-1β (IL-1β), tumor necrosis factor-α (TNF-α), and interleukin-6 (IL-6). This result is consistent with the conclusions of previous studies that LPS triggers neuroinflammation through activating the Toll-like receptor 4 (TLR4) signaling pathway. , It is worth noting that pretreatment with ORI could significantly inhibit the expression of M1 polarization markers and promote the transformation of microglia into the M2 type with anti-inflammatory properties (Figure ). This is similar to the findings of previous reports that curcumin alleviates neuroinflammation by regulating microglial polarization, indicating that ORI may exert its anti-inflammatory and neuroprotective effects by reshaping the function of microglia.

In the in vivo experiment induced by acute lipopolysaccharide (LPS) (Figure ), the mice showed significant behavioral despair in the forced swimming test and the tail suspension test and exhibited anhedonia in the sucrose preference test. These typical depression-like behaviors highly matched the characteristics of the LPS model reported in the literature. , After intervention with ORI, the duration of behavioral despair of the mice was significantly shortened, and the sucrose preference significantly recovered (Figure E), indicating that ORI could effectively improve the depression-like symptoms induced by acute inflammation. Further analysis of the prefrontal cortex (PFC) (Figure ) showed that LPS injection significantly activated the microglia in the PFC region, upregulated the expression of pro-inflammatory factors, and abnormally increased the frequency of excitatory postsynaptic currents, suggesting that the PFC brain region was abnormally activated. This finding was consistent with the enhanced inflammatory activity observed in specific brain regions of depression patients. However, treatment with ORI could reverse these abnormal changes, reconfirming its regulatory effect on microglial polarization. This was similar to research findings showing that quercetin could improve depressive symptoms by inhibiting the inflammatory response in the PFC region, indicating that targeting inflammation in the PFC region might be a key mechanism through which ORI exerts its antidepressant effect.

To deeply analyze the mechanism of action of ORI, this study utilized network pharmacology to predict that ORI is closely related to the phosphatidylinositol 3-kinase (PI3K)-protein kinase B (AKT) signaling pathway. Western blot experiments confirmed (Figure ) that ORI can significantly upregulate the phosphorylation of PI3K and AKT, as well as their downstream anti-inflammatory mediators, suggesting that this pathway plays a core role in regulating microglial polarization and inflammatory responses. This finding aligns with research results showing that ORI alleviates liver injury through the PI3K-AKT pathway, indicating that this pathway may be a common mechanism through which ORI exerts its protective effects on multiple organs.

In the chronic depression model (Figures and ), treatment with CUMS led to persistent depression-like behaviors in mice, including reduced activity, anhedonia, and anxiety-like manifestations, which were highly similar to the clinical characteristics of human depression. , After long-term intervention with ORI, the behavioral indices of the mice were significantly improved, suggesting that ORI has a sustained therapeutic effect on depression induced by chronic stress. Compared with studies on natural products such as ginsenoside Rg1 in the CUMS model, ORI exhibited similar antidepressant efficacy. However, its unique mechanism involving the regulation of microglial polarization and the PI3K-AKT pathway provides new targets for the treatment of depression.

This study still has certain limitations. First, although the antidepressant effect of ORI has been verified in the LPS and CUMS models, its effects in other models, such as the chronic restraint stress model and the olfactory bulbectomy model, still need to be further explored. Second, although the PI3K-AKT pathway has shown a crucial role in this study, whether ORI coordinately regulates the inflammatory response through other signaling pathways, such as NF-κB and MAPK, remains to be further investigated. In addition, considering the important role of microglia in neuroinflammatory diseases such as autism and Alzheimer’s disease, the potential applications of ORI in these diseases are worthy of further exploration.

In conclusion, this study systematically reveals for the first time the molecular mechanism by which ORI alleviates neuroinflammation and improves depression-like behaviors by regulating the M1/M2 polarization of microglia and activating the PI3K-AKT pathway, providing a new theoretical basis and potential drug options for the anti-inflammatory treatment of depression. Future research can further expand its applications in different disease models and deeply analyze its multitarget action mechanisms.

5. Conclusion

In conclusion, ORI demonstrates a significant protective effect against depression in both in vitro and in vivo models. The underlying mechanism may involve ORI’s capacity to facilitate the transformation of microglia from the M1 proinflammatory phenotype to the M2 anti-inflammatory phenotype through modulation of the PI3K/Akt signaling pathway. This modulation subsequently inhibits neuroinflammation in the PFC and alleviates depression-like symptoms associated with neuroinflammation (Figure ). These findings offer a robust theoretical foundation and support ORI as a promising therapeutic candidate for the treatment of depression.

8.

8

Open in a new tab

Schematic diagram of the mechanism of action of orientin (ORI) in the treatment of depression by reducing the inflammatory response of microglia.

-ORI inhibits M1 polarization in BV2 cells, reduces the release of inflammatory substances, and alleviates the inflammatory response. After 1 week of ORI treatment, mice exhibited reduced depressionlike behavior induced by LPS, potentially through the modulation of the PI3K/AKT signaling pathway. It was also found that ORI could improve depression-like behavior in CUMS mice. Immunofluorescence staining of the PFC brain region showed that the M1 proinflammatory phenotype of microglia in the PFC brain region of CUMS mice was decreased after ORI administration, while the M2 -anti-inflammatory phenotype was increased. Overall, our study suggests that ORI alleviates microglial inflammatory responses in the prefrontal cortex, thereby improving depressionlike behavior in LPS and CUMS models.

Supplementary Material

ao5c02585_si_001.pdf (124.2KB, pdf)

Acknowledgments

The study received funding partly from the Yinfeng Project of Tangdu Hospital (Lanxin Luo, 2022YFJH006).

The authors confirm that the data supporting the findings of this study are available within the article and its Supporting Information.

The Supporting Information is available free of charge at https://pubs.acs.org/doi/10.1021/acsomega.5c02585.

  • Detailed information on the targets collected in the network pharmacology study is provided in the supplementary document (PDF)

#.

Y.D. and J.Y. contributed equally to this work and are considered joint first authors. Y.D.: writing–original draft, validation, methodology, and data curation. J.Y.: Data curation and formal analysis. F.L.: visualization, validation, and data curation. L.W.: validation and data curation. Y.T.: visualization and software. L.Y.: writing–review and editing, supervision, and project administration. L.L.: writing–review and editing, supervision, writing–original draft, project administration, and funding acquisition.

All the authors agree to publish this article.

The animal care procedures have been reviewed and approved by the Animal Ethics Committee of the Fourth Military Medical University (approval number: 20240078) and strictly adhere to ethical principles regarding animal welfare.

The authors declare no competing financial interest.

References

  1. Setiawan E., Wilson A. A., Mizrahi R., Rusjan P. M., Miler L., Rajkowska G., Suridjan I., Kennedy J. L., Rekkas P. V., Houle S., Meyer J. H.. Role of translocator protein density, a marker of neuroinflammation, in the brain during major depressive episodes. JAMA Psychiatry. 2015;72(3):268–275. doi: 10.1001/jamapsychiatry.2014.2427. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Steiner J., Walter M., Gos T., Guillemin G. J., Bernstein H. G., Sarnyai Z., Mawrin C., Brisch R., Bielau H., Zu Schwabedissen L. M.. et al. Severe depression is associated with increased microglial quinolinic acid in subregions of the anterior cingulate gyrus: evidence for an immune-modulated glutamatergic neurotransmission? J. Neuroinflammation. 2011;8:94. doi: 10.1186/1742-2094-8-94. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Cheng Y., Pardo M., Armini R. S., Martinez A., Mouhsine H., Zagury J. F., Jope R. S., Beurel E.. Stress-induced neuroinflammation is mediated by GSK3-dependent TLR4 signaling that promotes susceptibility to depression-like behavior. Brain, Behav., Immun. 2016;53:207–222. doi: 10.1016/j.bbi.2015.12.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Wohleb E. S., Terwilliger R., Duman C. H., Duman R. S.. Stress-Induced Neuronal Colony Stimulating Factor 1 Provokes Microglia-Mediated Neuronal Remodeling and Depressive-like Behavior. Biol. Psychiatry. 2018;83(1):38–49. doi: 10.1016/j.biopsych.2017.05.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Wang J., Lai S., Li G., Zhou T., Wang B., Cao F., Chen T., Zhang X., Chen Y.. Microglial activation contributes to depressive-like behavior in dopamine D3 receptor knockout mice. Brain, Behav., Immun. 2020;83:226–238. doi: 10.1016/j.bbi.2019.10.016. [DOI] [PubMed] [Google Scholar]
  6. Locatelli G., Theodorou D., Kendirli A., Jordao M. J. C., Staszewski O., Phulphagar K., Cantuti-Castelvetri L., Dagkalis A., Bessis A., Simons M., Meissner F., Prinz M., Kerschensteiner M.. Mononuclear phagocytes locally specify and adapt their phenotype in a multiple sclerosis model. Nat. Neurosci. 2018;21(9):1196–1208. doi: 10.1038/s41593-018-0212-3. [DOI] [PubMed] [Google Scholar]
  7. Dantas-Medeiros R., Furtado A. A., Zanatta A. C., Torres-Rego M., Guimaraes Lourenco E. M., Ferreira Alves J. S., Galinari É., Alexandre de Oliveira Rocha H., Bernardo Guerra G. C., Vilegas W.. et al. Mass spectrometry characterization of Commiphora leptophloeos leaf extract and preclinical evaluation of toxicity and anti-inflammatory potential effect. J. Ethnopharmacol. 2021;264:113229. doi: 10.1016/j.jep.2020.113229. [DOI] [PubMed] [Google Scholar]
  8. Dhakal H., Lee S., Choi J. K., Kwon T. K., Khang D., Kim S. H.. Inhibitory effects of orientin in mast cell-mediated allergic inflammation. Pharmacol. Rep. 2020;72(4):1002–1010. doi: 10.1007/s43440-019-00048-3. [DOI] [PubMed] [Google Scholar]
  9. Xiao Q., Cui Y., Zhao Y., Liu L., Wang H., Yang L.. Orientin relieves lipopolysaccharide-induced acute lung injury in mice: The involvement of its anti-inflammatory and anti-oxidant properties. Int. Immunopharmacol. 2021;90:107189. doi: 10.1016/j.intimp.2020.107189. [DOI] [PubMed] [Google Scholar]
  10. Vasudevan Sajini D., Thaggikuppe Krishnamurthy P., Chakkittukandiyil A., Mudavath R. N.. Orientin Modulates Nrf2-ARE, PI3K/Akt, JNK-ERK1/2, and TLR4/NF-kB Pathways to Produce Neuroprotective Benefits in Parkinson’s Disease. Neurochem. Res. 2024;49:1577. doi: 10.1007/s11064-024-04099-8. [DOI] [PubMed] [Google Scholar]
  11. Du Y. Y., Sun T., Yang Q., Liu Q. Q., Li J. M., Yang L., Luo L. X.. Therapeutic Potential of Kaempferol against Sleep Deprivation-Induced Cognitive Impairment: Modulation of Neuroinflammation and Synaptic Plasticity Disruption in Mice. ACS Pharmacol. Transl. Sci. 2023;6(12):1934–1944. doi: 10.1021/acsptsci.3c00226. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Han X., Cheng X., Xu J., Liu Y., Zhou J., Jiang L., Gu X., Xia T.. Activation of TREM2 attenuates neuroinflammation via PI3K/Akt signaling pathway to improve postoperative cognitive dysfunction in mice. Neuropharmacology. 2022;219:109231. doi: 10.1016/j.neuropharm.2022.109231. [DOI] [PubMed] [Google Scholar]
  13. Skrzypczak-Wiercioch A., Salat K.. Lipopolysaccharide-Induced Model of Neuroinflammation: Mechanisms of Action, Research Application and Future Directions for Its Use. Molecules. 2022;27(17):5481. doi: 10.3390/molecules27175481. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Wang G., Li X., Li N., Wang X., He S., Li W., Fan W., Li R., Liu J., Hou S.. Icariin alleviates uveitis by targeting peroxiredoxin 3 to modulate retinal microglia M1/M2 phenotypic polarization. Redox Biol. 2022;52:102297. doi: 10.1016/j.redox.2022.102297. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Orihuela R., McPherson C. A., Harry G. J.. Microglial M1/M2 polarization and metabolic states. Br. J. Pharmacol. 2016;173(4):649–665. doi: 10.1111/bph.13139. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Adeleke P. A., Ajayi A. M., Ben-Azu B., Umukoro S.. Involvement of oxidative stress and pro-inflammatory cytokines in copper sulfate-induced depression-like disorders and abnormal neuronal morphology in mice. Naunyn Schmiedebergs Arch. Pharmacol. 2023;396(11):3123–3133. doi: 10.1007/s00210-023-02519-0. [DOI] [PubMed] [Google Scholar]
  17. Pizzagalli D. A., Roberts A. C.. Prefrontal cortex and depression. Neuropsychopharmacology. 2022;47(1):225–246. doi: 10.1038/s41386-021-01101-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Zhang Z., Wu J., Teng C., Wang J., Yu J., Jin C., Wang L., Wu L., Lin Z., Yu Z., Lin Z.. Orientin downregulating oxidative stress-mediated endoplasmic reticulum stress and mitochondrial dysfunction through AMPK/SIRT1 pathway in rat nucleus pulposus cells in vitro and attenuated intervertebral disc degeneration in vivo. Apoptosis. 2022;27(11–12):1031–1048. doi: 10.1007/s10495-022-01770-9. [DOI] [PubMed] [Google Scholar]
  19. Wang L., Jing S., Qu H., Wang K., Jin Y., Ding Y., Yang L., Yu H., Shi Y., Li Q., Wang D.. Orientin mediates protection against MRSA-induced pneumonia by inhibiting Sortase A. Virulence. 2021;12(1):2149–2161. doi: 10.1080/21505594.2021.1962138. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Thangaraj K., Balasubramanian B., Park S., Natesan K., Liu W., Manju V.. Orientin Induces G0/G1 Cell Cycle Arrest and Mitochondria Mediated Intrinsic Apoptosis in Human Colorectal Carcinoma HT29 Cells. Biomolecules. 2019;9(9):418. doi: 10.3390/biom9090418. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Li F., Zong J., Zhang H., Zhang P., Xu L., Liang K., Yang L., Yong H., Qian W.. Orientin Reduces Myocardial Infarction Size via eNOS/NO Signaling and Thus Mitigates Adverse Cardiac Remodeling. Front. Pharmacol. 2017;8:926. doi: 10.3389/fphar.2017.00926. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Jing S. Q., Wang S. S., Zhong R. M., Zhang J. Y., Wu J. Z., Tu Y. X., Pu Y., Yan L. J.. Neuroprotection of Cyperus esculentus L. orientin against cerebral ischemia/reperfusion induced brain injury. Neural Regener. Res. 2020;15(3):548–556. doi: 10.4103/1673-5374.266063. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Guo D., Hu X., Zhang H., Lu C., Cui G., Luo X.. Orientin and neuropathic pain in rats with spinal nerve ligation. Int. Immunopharmacol. 2018;58:72–79. doi: 10.1016/j.intimp.2018.03.013. [DOI] [PubMed] [Google Scholar]
  24. Beurel E., Toups M., Nemeroff C. B.. The Bidirectional Relationship of Depression and Inflammation: Double Trouble. Neuron. 2020;107(2):234–256. doi: 10.1016/j.neuron.2020.06.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Motaghinejad M., Motevalian M., Fatima S., Faraji F., Mozaffari S.. The Neuroprotective Effect of Curcumin Against Nicotine-Induced Neurotoxicity is Mediated by CREB-BDNF Signaling Pathway. Neurochem. Res. 2017;42(10):2921–2932. doi: 10.1007/s11064-017-2323-8. [DOI] [PubMed] [Google Scholar]
  26. Duan Z., Zhou W., He S., Wang W., Huang H., Yi L., Zhang R., Chen J., Zan X., You C., Gao X.. Intranasal Delivery of Curcumin Nanoparticles Improves Neuroinflammation and Neurological Deficits in Mice with Intracerebral Hemorrhage. Small Methods. 2024;8(12):e2400304. doi: 10.1002/smtd.202400304. [DOI] [PubMed] [Google Scholar]
  27. Nettis M. A., Pariante C. M.. Is there neuroinflammation in depression? Understanding the link between the brain and the peripheral immune system in depression. Int. Rev. Neurobiol. 2020;152:23–40. doi: 10.1016/bs.irn.2019.12.004. [DOI] [PubMed] [Google Scholar]
  28. Ali T., Rahman S. U., Hao Q., Li W., Liu Z., Ali Shah F., Murtaza I., Zhang Z., Yang X., Liu G., Li S.. Melatonin prevents neuroinflammation and relieves depression by attenuating autophagy impairment through FOXO3a regulation. J. Pineal Res. 2020;69(2):e12667. doi: 10.1111/jpi.12667. [DOI] [PubMed] [Google Scholar]
  29. Ifuku M., Katafuchi T., Mawatari S., Noda M., Miake K., Sugiyama M., Fujino T.. Anti-inflammatory/anti-amyloidogenic effects of plasmalogens in lipopolysaccharide-induced neuroinflammation in adult mice. J. Neuroinflammation. 2012;9:197. doi: 10.1186/1742-2094-9-197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Fang K., Li H. R., Chen X. X., Gao X. R., Huang L. L., Du A. Q., Jiang C., Li H., Ge J. F.. Quercetin Alleviates LPS-Induced Depression-Like Behavior in Rats via Regulating BDNF-Related Imbalance of Copine 6 and TREM1/2 in the Hippocampus and PFC. Front. Pharmacol. 2020;10:1544. doi: 10.3389/fphar.2019.01544. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Li F., Liao X., Jiang L., Zhao J., Wu S., Ming J.. Orientin Attenuated d-GalN/LPS-Induced Liver Injury through the Inhibition of Oxidative Stress via Nrf2/Keap1 Pathway. J. Agric. Food Chem. 2022;70(26):7953–7967. doi: 10.1021/acs.jafc.2c02015. [DOI] [PubMed] [Google Scholar]
  32. Katz R. J., Roth K. A., Carroll B. J.. Acute and chronic stress effects on open field activity in the rat: implications for a model of depression. Neurosci. Biobehav. Rev. 1981;5(2):247–251. doi: 10.1016/0149-7634(81)90005-1. [DOI] [PubMed] [Google Scholar]
  33. Antoniuk S., Bijata M., Ponimaskin E., Wlodarczyk J.. Chronic unpredictable mild stress for modeling depression in rodents: Meta-analysis of model reliability. Neurosci. Biobehav. Rev. 2019;99:101–116. doi: 10.1016/j.neubiorev.2018.12.002. [DOI] [PubMed] [Google Scholar]
  34. Wang H.-Q., Zheng R.-F., Ai Q.-D., Yang S.-W., Yang X.-Y., Chen A.-P., Yan Q., Yan X., Zhang Z., Xing J.-G.. et al. Ginsenoside Rg1 alleviates chronic stress-induced depression in rats by targeting Cx43-YAP axis. Acta Pharmacol. Sin. 2025:1–15. doi: 10.1038/s41401-025-01515-9. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

ao5c02585_si_001.pdf (124.2KB, pdf)

Data Availability Statement

The authors confirm that the data supporting the findings of this study are available within the article and its Supporting Information.

Articles from ACS Omega are provided here courtesy of American Chemical Society

RESOURCES