Skip to main content
STAR Protocols logoLink to STAR Protocols
. 2025 Jul 4;6(3):103928. doi: 10.1016/j.xpro.2025.103928

Protocol for high-efficiency generation of iPSCs stably expressing Cas9-EGFP using the selection by essential gene exon knockin method

Yao Zhang 1,2,6, Hao Yang 1,3, Yuan Yang 1,4, Zijun Lu 1,5, Lokyu Cheng 1, Hongmei Tan 2, Joe Z Zhang 1,7,
PMCID: PMC12272859  PMID: 40618370

Summary

CRISPR-Cas9 is widely used for genome editing. However, Cas9 silencing occurs during the directed differentiation of induced pluripotent stem cells (iPSCs), even when it is inserted into the safe harbor locus. Here, we generate iPSC-Cas9-EGFP using selection by essential gene exon knockin technology. We describe steps for inserting the Cas9-EGFP into exon 9 of GAPDH, bypassing Cas9 silencing. We then detail procedures for Cas9 function validation.

For complete details on the use and execution of this protocol, please refer to Zhang et al.1

Subject areas: Cell Biology, CRISPR, Molecular Biology, Stem Cells

Graphical abstract

graphic file with name fx1.jpg

Highlights

  • Generation of stable Cas9-EGFP knockin iPSCs with high efficiency

  • Steps for constructing Cas9-EGFP plasmids with SLEEK backbone

  • Guidance on iPSC-Cas9-EGFP cell line generation and Cas9 validation


Publisher’s note: Undertaking any experimental protocol requires adherence to local institutional guidelines for laboratory safety and ethics.


CRISPR-Cas9 is widely used for genome editing. However, Cas9 silencing occurs during the directed differentiation of induced pluripotent stem cells (iPSCs), even when it is inserted into the safe harbor locus. Here, we generate iPSC-Cas9-EGFP using selection by essential gene exon knockin technology. We describe steps for inserting the Cas9-EGFP into exon 9 of GAPDH, bypassing Cas9 silencing. We then detail procedures for Cas9 function validation.

Before you begin

AAVS1 is a well-characterized safe harbor locus for the insertion of exogenous genes, allowing stable and constitutive transgene expression without interfering with endogenous gene function. However, silencing of the inserted genes such as Cas9, whether driven by inducible or constitutive promotors, has been frequently reported when integrated into the safe harbor locus, such as AAVS1 and hROSA26.2 Emerging studies indicate that epigenetic modifications such as DNA methylation and histone modifications, contribute to the silencing or loss of Cas9 expression during directed differentiation of iPSCs, therefore limiting its iPSC-based applications.2,3 Editas Medicine developed SLEEK, a technology that enables highly efficient insertion of transgenes into exon 9 of the GAPDH gene, effectively overcoming gene silencing. This approach has achieved over 90% knock-in (KI) efficiency in three cell types, without affecting cell viability or proliferation.4

In this study, we leveraged the SLEEK technology to insert Cas9-EGFP into exon 9 of the GAPDH gene, where an asparagine (N316) residue critical for GAPDH protein function is located.5 A recoded exon 9 was designed in the donor template without changing the GAPDH amino acid sequence. Only genome-edited cells undergo homology directed repair (HDR) induced by CRISPR-Cas9-mediated double-strand breaks to restore the last exon will survive, whereas cells that repair through non-homologous end joining (NHEJ) will undergo negative selection due to disruption of GAPDH. The endogenous GAPDH promoter drives robust and sustained Cas9-EGFP expression, while the edited iPSC-Cas9-EGFP cells maintain typical iPSC pluripotency and a normal karyotype. This approach ensures stable Cas9-EGFP expression without compromising cell fitness and is broadly applicable to other cell types and KI gene constructs.

Institutional permissions (if applicable)

Users will require institutional permission to use human pluripotent stem cells and conduct genome editing. The hiPSC-related experiments in this study met the medical ethics review requirements of Shenzhen Bay Laboratory and have passed the ethics review application.

Primer design

Inline graphicTiming: 2 days

The following steps outline the process for designing primers for seamless cloning of Cas9-EGFP SLEEK plasmids and subsequent KI validation. These steps apply to both “Plasmid construction” and “Cas9-EGFP Expressing iPSC Generation.”

Note: For the original SLEEK KI plasmid, you can obtain the basic elements based on your lab materials. In this study, we used and modified the PX458M plasmids (PX458 from Addgene can be an alternative), and synthesized the homology region of GAPDH. For more details, please refer to the previous publication.4

  • 1.
    Design primers with appropriate overlaps.
    Note: We generate the Cas9-EGFP SLEEK plasmid using the Gibson Assembly method,6 which leverages overlapping regions at the ends of DNA fragments. By designing overlapping primers for PCR, we introduce the overlap regions to the linearized vector and insert segments, facilitating their seamless incorporation.
    • a.
      Open the SnapGene (or alternative software: Geneious Prime/Vector NTI/ApE/etc.) and combine the Cas9-EGFP segment (from PX458M plasmid, 4,977 bp) and SLEEK KI vector (4,500 bp) together, and save as a new plasmid map.
    • b.
      Design primers of 50 bp from the adjacent segments in the final plasmid as shown in Figure 1 (25 bp from the end of the vector and 25 bp from the end of the insert) with complementary sequences (A – Vector and A – Insert; B – Vector and B – Insert).
    • c.
      Synthesize two pairs of primers (all provided by Sangon Biotech; the same applies to the following primers) containing the overlaps as shown in Figure 1, as follows (details are also available in the key resources table):

    A- Vector: TACCGACCTTCCGCTTCTTCTTTGGTGGACCAGGGTTTTCTTCAACATCA.

    B-Vector: TCTCGGCATGGACGAGCTGTACAAGTGAGCGGCCGCGTCGAGTCTAGAGG.

    A-Insert: TGATGTTGAAGAAAACCCTGGTCCACCAAAGAAGAAGCGGAAGGTCGGTA.

    B-Insert: CCTCTAGACTCGACGCGGCCGCTCACTTGTACAGCTCGTCCATGCCGAGA.

Figure 1.

Figure 1

Schematic diagram of Gibson Assembly for constructing the Cas9-EGFP SLEEK plasmid

Primers design schematic: primers were designed with complementary overlapping regions between the vector and insert. Red and yellow rectangles indicate complementary overlapping regions used for seamless assembly. Add 1-5 primers were used for Cas9 sequencing.

Note: To ensure efficient assembly of the segments, a 15–25 bp overlap is recommended with the primers' melting temperature (Tm) ideally above 48°C.

  • 2.
    Design primers for Gibson Assembly product validation.
    Note: The insert segment (Cas9-EGFP) is 4,977 bp. To ensure complete coverage of the insert sequence, we utilized the same primers from the Gibson Assembly PCR (Step 1b) and designed five additional primers specific to the Cas9 region for Sanger sequencing.
    Inline graphicCRITICAL: This multi-primer approach provides thorough verification of the entire insert, reducing the risk of undesired mutations or assembly errors.
    • a.
      Select the whole sequence of Cas9 (4,101 bp), and divide it into 6 parts (roughly 650 bp each part).
      Note: The starting and ending parts can be sequenced using Gibson Assembly primers, so the designed primers are used for sequencing the middle part of Cas9.
    • b.
      Select appropriate positions within 100 bp at the beginning of each part to design primers.
    • c.
      Label the primers as Add-1 to Add-5 (Figure 1).
    • d.
      Synthesize five primers as follows:

    Add-1: AGAACCTGTCCGACGCCATCCTGCT.

    Add-2: CCGAGGGAATGAGAAAGCCCGCCTT.

    Add-3: GACAGAAGAACAGCCGCGAGAGAAT.

    Add-4: ACAAGGTGTACGACGTGCGGAAGAT.

    Add-5: CCGAGGATAATGAGCAGAAACAGCT.

  • 3.
    Design primers for KI validation.
    Note: Cas9-EGFP is integrated into the iPSCs at the GAPDH exon 9 locus by HDR (Figure 2). We design PCR primers located outside both the 5′ and 3′ homology arms to validate successful HDR events.
    • a.
      Download the homo sapiens GAPDH (GRCh38.p14) sequence from NCBI database (Chromosome 12 - NC_000012.12).
    • b.
      Insert the Cas9-EGFP segment into the corresponding locus (identify it by the sequences of the 5′ and 3′ arm homology arms) in exon 9 of the GAPDH gene in SnapGene.
    • c.
      Select a 150 bp region upstream of the 5′ homology arm extending to the T2A sequence. Use this sequence as input in Primer 3 (other similar websites and software such as NCBI Primer-BLAST could be alternatives) to design primers, and obtain the sequences for outside 5′ arm F1 (p1 in Figure 2), outside 5′ arm F2 primers (p2 in Figure 2), and Reverse-1 (p3 in Figure 2).
    • d.
      Select a region of EGFP extending 150 bp downstream of the 3′ homology arm. Use this sequence as input in Primer 3 to design primers, and obtain the sequences for Poly A F (p4 in Figure 2) and outside 3′ arm R1 primers (p5 in Figure 2).
    • e.
      Synthesize the primers for KI validation as follows (also available in the key resources table):

    p1-Outside 5′ arm F1: GCCTCACTCCTTTTGCAGAC.

    p2-Outside 5′ arm F2: GAGGTAGAGGGGTGATGTGG.

    p3-Reverse-1: GTACTTCTTGTCGGCTGCTG.

    p4-Poly A F: CACTCCCACTGTCCTTTCCT.

    p5-Outside 3′ arm R1: GGCCACGATGTCCTCAGATA.

Figure 2.

Figure 2

Primer design for KI validation

The homologous recombination loci of the GAPDH-exon9 and Cas9-EGFP. The p1-p5 were used for KI validation.

Prepare iPSCs for electroporation

Inline graphicTiming: 3 days

Here is an overview of iPSC culture. For more details, refer to the previous protocol.7 The following example illustrates iPSC culture in one well of a six-well plate.

  • 4.
    Matrigel-coated plate preparation.
    • a.
      Thaw Matrigel at 4°C for 12 h.
    • b.
      Dilute 100 μL of Matrigel into 40 mL of cold basic DMEM medium to achieve a 1:400 dilution (final protein concentration should be around 25.8–26.5 μg/mL).
      Note: To mimic the natural extracellular matrix and maintain the culture of iPSCs, Matrigel coating is necessary. Lot-to-lot variations in Matrigel may require slight adjustments for dilution. For dilution purpose, other basic media can also be used.
      Inline graphicCRITICAL: It is critical to keep Matrigel or diluted Matrigel coating medium on ice at all times.
    • c.
      Add 2 mL of the coating medium to each well of a 6-well plate.
    • d.
      Place it at 4°C for 12 h.
      Note: Do not remove the coating solution before plating iPSCs. The coated plate should be stored at 4°C and used within 7 days. Alternatively, plates can also be coated directly in a 37°C incubator for 30 min.
  • 5.
    iPSC thawing.
    • a.
      Thaw one vial of iPSCs in one well of a 6-well plate. Prepare a 15 mL sterile Falcon tube with 1 mL of cold Stemflex medium supplemented with Y-27632·2HCl (10 μM) for each vial.
      Note: In our protocol, one cryovial contains cells harvested from half of a well of a 6-well plate with 90% confluence (typically 1.0 × 106 cells/vial).
    • b.
      Keep the cryovial in a 37°C water bath to thaw the cells until only a small ice fragment remains (usually less than 1 min).
    • c.
      Transfer the cells into the prepared sterile Falcon tube. Rinse the vial once with 500 μL of Stemflex medium and transfer the medium to the same sterile Falcon tube.
    • d.
      Centrifuge at 20°C for 3 min at 300x g.
    • e.
      Aspirate Matrigel coating medium from the pre-coated plates and add 1 mL of Stemflex supplemented with Y-27632·2HCl (10 μM) into each well.
    • f.
      Aspirate the supernatant in the Falcon tube and gently resuspend the cell pellet with 1 mL of Stemflex supplemented with Y-27632·2HCl (10 μM).
    • g.
      Transfer the resuspended cells to one well of the pre-coated 6-well plate.
    • h.
      Replace with fresh Stemflex after 24 h.
    • i.
      Culture the iPSCs until they reach 70%–80% confluence before passaging.
  • 6.
    iPSC passage.
    • a.
      When iPSCs reach 70%–80% confluence, remove the supernatant and wash the cells with 1 mL of 1× DPBS (without Ca2+ and Mg2+, and applicable to the full text) for each well.
    • b.
      Aspirate DPBS and add 1 mL of 0.5 mM EDTA.
      Note: We recommend to passage cells as small clusters. Accutase can also be used for dissociation.
    • c.
      Incubate for 5–10 min at 37°C in an incubator.
    • d.
      Remove the EDTA and add 1 mL of Stemflex supplemented with Y-27632·2HCl (10 μM).
    • e.
      Gently pipette the cells up and down several times to dissociate the cells.
    • f.
      Collect the cell suspension in a 15 mL sterile Falcon tube.
    • g.
      Centrifuge at 300× g for 3 min at 20°C.
    • h.
      Aspirate the supernatant and add 1 mL of Stemflex supplemented with Y-27632·2HCl (10 μM) to resuspend the cell pellets.
    • i.
      Add 2 mL of Stemflex supplemented with Y-27632·2HCl (10 μM) in a new well of Matrigel-coated 6-well plate.
      Note: Stemflex supplemented with Y-27632·2HCl (10 μM) is used in every passage to improve the cell viability.
    • j.
      Replate 100 μL of resuspended cells from Step 6h into a well (at a passage ratio of 1:10).
    • k.
      Replace the culture medium with fresh Stemflex after 24 h and change medium regularly every other day until cells reach 70%–80% confluence for the next passage.
    • l.
      As the cells reach 70%–80% confluence, they could be used for electroporation in the “iPSC-Cas9-EGFP generation” section.
  • 7.
    iPSC cryopreservation.
    • a.
      When iPSCs reach 90% confluence in one well of a 6-well plate, they can be frozen into two cryovials. Dissociate iPSCs as described in Step 6a-g.
    • b.
      Aspirate the supernatant, add 1 mL of cold Bambanker freezing solution to resuspend the cell pellets.
    • c.
      Transfer the resuspended cells (500 μL) into a labeled cryovial.
    • d.
      Quickly transfer the cryovials into a freezing container. Keep the container at −80°C for 24 h, then transfer the cells to liquid nitrogen for long-term storage.

Prepare HEK 293T cells for lentivirus package

Inline graphicTiming: 3 days

  • 8.

    When HEK 293T cells growing in a 10 cm dish reach 80%–90% confluence, remove the supernatant and wash the cells with 3 mL of DPBS.

Note: HEK 293T cells are easily detached from the dish, so treat the cells gently.

  • 9.

    Aspirate DPBS and add 2 mL of 0.5 mM EDTA for 3–5 min at 20°C.

  • 10.

    Add 2 mL of DMEM supplemented with 10% FBS to the dish and pipette up and down to fully dissociate the cells.

  • 11.

    Collect the cell suspension into a 15 mL sterile Falcon tube.

  • 12.

    Centrifuge at 300× g for 3 min at 20°C.

  • 13.

    Aspirate the supernatant and resuspend the cells in 1 mL of DMEM supplemented with 10% FBS.

  • 14.

    Replate 200–300 μL of resuspended cells from Step 10 to passage the cells into a 10 cm dish (at a passage ratio of 1:3 to 1:5).

  • 15.

    Change the fresh medium every other day.

  • 16.

    As the cells reach 70%–80% confluence, they could be used for the lentivirus package in the “Cas9-EGFP expressing iPSC generation” section.

Note: HEK 293FT cell line could be an alternative. You can get the cells from the ATCC or other biobanks. For beginners in cell culture, adding 1% antibiotics (e.g., penicillin-streptomycin solution) to the culture medium is recommended to prevent contamination.

Key resources table

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies

Anti-rabbit IgG HRP-linked antibody (1:10,000) CST Cat#7074
Mouse HRP-conjugated β-Actin (1:10,000) ABclonal Cat#AC043
Rabbit polyclonal anti-Cas9 (1:1,000) GenCrispr Cat#A01885

Bacterial and virus strains

E. coli DH5α AlpalifeBio Cat#KTSMCC100

Chemicals, peptides, and recombinant proteins

2× StickTogether DNA ligase buffer NEB Cat#B0535S
4× SDS-PAGE loading buffer (with β-Mercaptoethanol) Solarbio Cat#P1016
4S Green Plus nucleic acid stain Sangon Biotech Cat#A616696-0500
50× TAE buffer Sangon Biotech Cat#B548101
Accutase cell detach medium Thermo Fisher Scientific Cat#00-4555-56
Agar Sangon Biotech Cat#A505255
Agarose Sangon Biotech Cat#A620014
Ampicillin (100 mg/mL, 1000X) Beyotime Cat#ST008
Bambanker cell freezing medium BAMBANKER Cat#302-14681
Bbsl-HF NEB Cat#R3539S
BsmBI-v2 NEB Cat#R0580
CloneR STEMCELL Technologies Cat#5888
ColorMixed Protein Marker 180 (10–180 kDa) Plus ABclonal Cat#RM19001P
CutSmart buffer NEB Cat#B7204
DL10000 DNA marker Takara Cat#3584B
DL2000 DNA marker Takara Cat#3427A
DMEM Gibco Cat#C11995500BT
DPBS Servicebio Cat#G4202
EDTA Invitrogen Cat#15575020
LB Broth powder Sangon Biotech Cat#A507002
Lipo8000 Beyotime Cat#C0533
Matrigel Corning Cat#354230
NEBuffer 3 NEB Cat#B7003s
NEBuilder HiFi DNA Assembly Master Mix NEB Cat#E2621S
Opti-MEM reduced serum medium Thermo Fisher Scientific Cat#31985070
PEG8000 Sigma Cat#89510-250G
Puromycin InvivoGen Cat#ant-pr-1
QuickExtract DNA extraction solution Lucigen Cat#QE09050
RIPA Solarbio Cat#R0010
Stemflex Gibco Cat#A3349401
T4 DNA ligase NEB Cat#M0202S
T7 DNA ligase NEB Cat#M0318S
Y-27632·2HCl MCE Cat#HY-10071

Critical commercial assays

8% SDS-PAGE Gel SuperQuick Preparation Kit Beyotime Cat#P0688
BCA Protein Assay Kit Beyotime Cat#P0012
EndoFree Plasmid Midi Kit CWBIO Cat#CW2105S
FastPure Gel DNA Extraction Mini Kit Vazyme Cat#DC301-01
P3 Primary Cell 4D X Kit S (32 RCT) Lonza Cat#V4XP-3032
Phanta Max Super-Fidelity DNA Polymerase Vazyme Cat#P505
SuperSignal SuperDura Extended Duration Substrate Kit YEASEN Cat#36223ES76

Experimental models: Cell lines

100-iPSC Stanford Cardiovascular Institute N/A
HEK 293T Shenzhen Bay Laboratory N/A

Oligonucleotides

cPPT: GAAAAGGGGGGATTGGGGGG This paper N/A
EGFP sgRNA1: GGGCGAGGAGCTGTTCACCG Shalem et al.8
EGFP sgRNA2: GGAGCGCACCATCTTCTTCA Shalem et al.8
For Gibson Assembly Insert-F: TGATGTTGAAGA
AAACCCTGGTCCACCAAAGAAGAAGCGGAA
GGTCGGTA
This paper N/A
For Gibson Assembly Insert-R: CCTCTAGAC
TCGACGCGGCCGCTCACTTGTACAGCTCG
TCCATGCCGAGA
This paper N/A
For Gibson Assembly Vector-F 5′-TCTCGG
CATGGACGAGCTGTACAAGTGAGCGGC
CGCGTCGAGTCTAGAGG-3′
This paper N/A
For Gibson Assembly Vector-R 5′-TACCGACC
TTCCGCTTCTTCTTTGGTGGACCAGGGTTTT
CTTCAACATCA-3′
This paper N/A
Primers for Cas9 sequencing
Add-1: AGAACCTGTCCGACGCCATCCTGCT
Add-2: CCGAGGGAATGAGAAAGCCCGCCTT
Add-3: GACAGAAGAACAGCCGCGAGAGAAT
Add-4: ACAAGGTGTACGACGTGCGGAAGAT
Add-5: CCGAGGATAATGAGCAGAAACAGCT
This paper
Primers for KI validation Zhang et al.1
U6 promoter: ATGGACTATCATATGCTTACCGTA This paper

Recombinant DNA

GAPDH sgRNA (5′-TCTAGGTATGACAACGAATT-3′) Zhang et al.1 N/A
LentiCrispr v.2 EGFP sgRNA1 (5′-GGGCGAGGAGCTGTTCACCG-3′) This paper N/A
LentiCrispr v.2 EGFP sgRNA2 (5′-GGAGCGCACCATCTTCTTCA-3′) This paper N/A
Modified Cas9-EGFP SLEEK KI vector This paper (available on request) N/A
pMD2.G MiaoLing Plasmid P0262
psPAX2 MiaoLing Plasmid P0261
PX458M MiaoLing Plasmid #P4204

Software and algorithms

CytExpert/CytExpert SRT Beckman https://www.mybeckman.cn/flow-cytometry/research-flow-cytometers/cytoflex/software
Primer 3 web version 4.1.0 Primer 3 https://primer3.ut.ee/
SnapGene v.7.1.2 SnapGene https://www.snapgene.com/
FlowJo v.10.8.1 B&D https://www.flowjo.com/

Other

ChemiDoc MP Imaging System Bio-Rad
CytoFLEX LX/SRT Beckman
Millex Millipore Cat#SLHVR33RB

Step-by-step method details

Plasmid construction

Inline graphicTiming: 3 days

Inline graphicTiming: 1.5 days (for step 1)

Inline graphicTiming: 1.5 days (for step 2)

Here, we insert the Cas9-EGFP segment from the PX458M plasmid into the SLEEK KI plasmid to generate the Cas9-EGFP SLEEK donor plasmid. Both the Cas9-EGFP insert and the linearized plasmid backbone are obtained by PCR. The generation of SLEEK KI plasmids and GAPDH sgRNA can be carried out simultaneously.

  • 1.
    Generate the Cas9-EGFP SLEEK donor plasmid.
    Note: We link the linearized vector and insert using Gibson Assembly. We use the SLEEK KI plasmid as the template for the vector and PX458M for the Cas9-EGFP insert, and conduct PCR to introduce the overlaps.
    • a.
      Prepare the PX458M plasmid and SLEEK KI plasmid as the PCR templates, respectively.
    • b.
      Prepare the designed primers (Pre-Step 1c of “Primer design” section).
    • c.
      Mix the following reagents in two PCR tubes as follows, respectively.
      PCR reaction master mix
      Reagent Amount
      SLEEK KI plasmid or PX458M 30 ng
      DNA Polymerase 1 μL
      A – Vector or B – Insert primer (10 μM) 2 μL
      B – Vector or A – Insert primer (10 μM) 2 μL
      2× Phanta Max Buffer 25 μL
      dNTP Mix 1 μL
      ddH2O up to 50 μL
      Note: Use the corresponding PCR templates and primers for PCR.
    • d.
      Mix and centrifuge the PCR tubes and set up the following PCR program:
      PCR cycling conditions
      Steps Temperature Time Cycles
      Initial Denaturation 95°C 3 min 1
      Denaturation 95°C 15 sec 35
      Annealing 66°C 15 sec
      Extension 72°C 5 min
      Final extension 72°C 5 min 1
      Hold 4°C Infinite
    • e.
      Run agarose gel to confirm PCR products.
      • i.
        Prepare 30 mL of 1% agarose gel (add 0.3 g of agarose into 30 mL of 1× TAE).
      • ii.
        Use a microwave to dissolve agarose powder and add 3 μL of 4S Green Plus Nucleic Acid Stain into the agarose liquid.
      • iii.
        Pour the agarose liquid into the nucleic acid gel-cast and wait for 30 min to allow solidification.
      • iv.
        Load 5 μL of 10,000 bp DNA ladder to the first lane.
      • v.
        Mix 1 μL of 10× Loading dye with 9 μL of PCR products and load the mixture into the other lanes.
      • vi.
        Observe the gel in the ChemiDoc MP Imaging System.
      • vii.
        Purify PCR products using the FastPure Gel DNA Extraction Mini Kit according to the manufacturer’s protocol (https://bio.vazyme.com/product/18.html).
        Note: If there are multiple unexpected bands, it is highly recommended to do a gel extraction to purify the PCR products.
      • viii.
        Use the purified PCR products for Gibson Assembly.
    • f.
      Ligate the insert into the vector.
      • i.
        Prepare the following ligation mixture in a PCR tube.
        Reagent Amount
        NEBuilder HiFi DNA assembly master mix 10 μL
        Cas9-EGFP segment 100 ng
        Linearized SLEEK plasmid 50 ng
        H2O up to 20 μL
      • ii.
        Mix and centrifuge the PCR tube and incubate the mixture at 50°C for 15 min.
    • g.
      Run the mixture (20 μL) in a 1% agarose gel to confirm the size of the Gibson Assembly products (should be 9,477 bp) and purify the products by the same way as Step 1e.vii.
    • h.
      Transform chemically competent E. coli cells with the Gibson Assembly products.
      • i.
        Thaw 50 μL of DH5α E. coli cells on ice.
      • ii.
        Mix 2 μL of purified products with the E. coli cells.
      • iii.
        Place the mixture on ice for 30 min, and then in a 42°C water bath for 40 sec, followed by leaving on ice for 2 min.
      • iv.
        Add 900 μL of LB medium into the tube and incubate in a shaker at 37°C for 1 h.
      • v.
        Spread 100 μL of E. coli containing LB medium on an Amp selection LB agar plate evenly and incubate the plate at 37°C for 16 h.
      • vi.
        Pick three individual colonies using 10 μL tips and inoculate each clone in a 1.5 mL sterile Eppendorf tube or 5 mL bacteria culture tube containing 1 mL of LB medium with 100 μg/mL Amp.
      • vii.
        Incubate them in a shaker at 37°C for 12–16 h.
    • i.
      Store 500 μL of E. coli containing LB medium at 4°C and send 500 μL for the Sanger sequencing to confirm the correct construct.
      Note: The primers used for introducing the overlapping regions in the PCR process could be used for the Sanger sequencing first. Once it is confirmed the successful Gibson Assembly, use additional primers to sequence the rest part of the insert fragment by Add 1–5 primers.
    • j.
      Expand the correct clones and extract the plasmids using the EndoFree Plasmid Midi Kit according to the manufacturer’s protocol (https://www.cwbio.com/product/detail/id/10305).
  • 2.
    Construct GAPDH sgRNA plasmid.
    • a.
      Annealing the GAPDH sgRNA oligos.
      • i.
        Prepare the following mix in a PCR tube:
        Reagent Amount
        GAPDH gRNA forward oligo (100 μM) 4.5 μL
        GAPDH gRNA reverse oligo (100 μM) 4.5 μL
        NEBuffer 3 1 μL
        Total 10 μL
      • ii.
        Set up the following PCR procedure to anneal the oligos:
        Steps Temperature Time
        1 95°C 5 min
        2 95°C–85°C at −2°C/sec
        3 85°C–25°C at −0.1°C/sec
        4 4°C Infinite
    • b.
      Digest the PX458M plasmid by Bbsl-HF enzyme to linearize the vector.
      • i.
        Prepare the digest mix in a PCR tube:
        Reagent Amount
        Purified linearized vector 3 μg
        Bbsl-HF 1.5 μL
        Cut Smart Buffer 5 μL
        ddH20 up to 50 μL
        Total 50 μL
      • ii.
        Set up the PCR program: 37°C for 3–4 h and following 65°C for 20 min inactivation.
        Inline graphicPause point: The products could be stored at −20°C for the next day.
    • c.
      Run a 1% agarose gel to confirm the linearized vector size.
    • d.
      Purify the vector using the FastPure Gel DNA Extraction Mini Kit.
      Note: If there is a single expected band, the purified column could be used directly to purify the PCR products; otherwise, you need to perform the gel extraction to purify the products.
    • e.
      Prepare the ligation mixture to ligate the GAPDH sgRNA and PX458M vector:
      Reagent Amount
      Purified linearized vector 25 ng
      Annealed oligo products 2 μL
      T4 DNA ligase 1 μL
      10× buffer 1 μL
      ddH2O up to 10 μL
      Total 10 μL
    • f.
      Incubate the mixture in a PCR machine at 16°C for at least 1 h.
    • g.
      Transform E. coli cells with ligated products as described in Step 1h.
    • h.
      Pick up three clones to expand.
    • i.
      Use the U6 promoter primers for the Sanger sequencing.
    • j.
      Expand the correct clones and extract the plasmids using the EndoFree Plasmid Midi Kit.
      Inline graphicPause point: The plasmids could be stored at −20°C.

Cas9-EGFP-expressing iPSC generation

Inline graphicTiming: 40 days

This section focuses on iPSC genome editing. After the genome editing, at least 14 days are needed to ensure the successful KI of the Cas9-EGFP into the GAPDH locus by HDR.

iPSC-Cas9-EGFP electroporation

Inline graphicTiming: 2 days

  • 3.

    When iPSCs reach 70%–80% confluence, wash the iPSCs with 1 mL of DPBS.

  • 4.

    Aspirate the DPBS and digest the iPSCs with 1 mL of Accutase for 5 min at 37°C.

Note: To guarantee the electroporation efficiency, it is recommended to use Accutase to dissociate iPSCs into single cells.

  • 5.

    Prepare the electroporation mixture:

Reagent Amount
P3 Primary Cell Nucleofector Solution 20 μL
Supplement 1 4 μL
PX458M (with GAPDH sgRNA) 1.25 μg
Cas9-EGFP SLEEK KI plasmid 1.25 μg
Total volume 24–26.4 μL

Note: The volume of added plasmids cannot exceed 10% of the total volume of electroporation. Otherwise, it will compromise the transfection efficiency. The total volume should be maintained at 24–26.4 μL.

  • 6.

    Add 1 mL of Stemflex to stop the digestion.

  • 7.

    Centrifuge the iPSCs at 300× g for 3 min at 20°C.

  • 8.

    Aspirate the supernatant and resuspend the iPSCs with 1 mL of Stemflex supplemented with Y-27632·2HCl (10 μM).

  • 9.

    Count cell numbers using an automatic cell counter.

  • 10.

    Transfer one million cells to a new 15 mL sterile Falcon tube and centrifuge to remove the supernatant.

  • 11.

    Resuspend the cell pellets gently with the electroporation mixture.

  • 12.

    Transfer the resuspended mixture into one well of Nucleocuvette Strips.

Inline graphicCRITICAL: Avoid bubbles in Step 11–12. Other electroporation systems (e.g., Neon NxT Electroporation System) could be alternatives.

  • 13.

    Select CA 137 program on 4D-Nucleofector.

  • 14.

    Add 2 mL of Stemflex supplemented with Y-27632·2HCl (10 μM) to one well of a Matrigel-coated 6-well plate.

  • 15.

    Transfer the electroporated cells into the well.

  • 16.

    After culturing for 24 h, sort out the EGFP-positive cells using fluorescence-activated cell sorting (FACS) in CytoFLEX SRT (Figures 3A–3E).

Inline graphicCRITICAL: If the cell density is too low, sorting could be conducted 48 h after the electroporation. The parental iPSCs can be used as the negative control.

  • 17.

    Maintain the sorted cells in Stemflex supplemented with Y-27632·2HCl (10 μM).

  • 18.

    Change fresh Stemflex after 48 h, and change the medium every other day.

Figure 3.

Figure 3

Flow cytometry gating strategy for sorting EGFP-positive cells

(A) Gate live cells.

(B and C) Sequential gating to exclude doublets.

(D) Gate EGFP-negative control using parental cells.

(E) Gate and sort EGFP-positive cells.

(F and G) Gating strategy for sorting EGFP-positive single-cell clones 14 days post-electroporation.

Isolate single-cell clones with Cas9-EGFP

Inline graphicTiming: 20 days

Inline graphicCRITICAL: The single-cell clones could be sorted out 14 days post-electroporation.

  • 19.

    On day 14 post-electroporation, sort 96 single EGFP-positive cells (P5 gate in Figure 3G) into one Matrigel-coated 96-well plate with 100 μL of Stemflex supplemented with Y-27632·2HCl (10 μM) or 5% CloneR in each well (Figures 3F and 3G).

Note: Two sorting steps are necessary here. The first-round sorting is to obtain the cells that undergo successful electroporation. The second-round sorting aims to obtain the single-cell clones that successfully undergo HDR and express Cas9-EGFP.

Inline graphicCRITICAL: In the second-round sorting, do not sort out the cells with the strongest EGFP (cells in P6 gate and on the right of P6 gate in Figure 3G). Based on our experience, these cells could lose Cas9. You would expect to obtain 6.25% correct clones overall.

  • 20.

    Maintain the cells with Stemflex supplemented with Y-27632·2HCl (10 μM) or 5% CloneR for 6 days without changing the medium.

Note: 30–50 μL of Stemflex supplemented with Y-27632·2HCl (10 μM) or 5% CloneR could be added at day 3 after sorting in case of medium evaporation.

  • 21.

    After 6 days, clones reach one-fifth of the total area and remove the supernatant.

  • 22.

    Wash cells with 50 μL of DPBS and add 40 μL of 0.5 mM EDTA to dissociate the clones.

  • 23.

    Passage the clone at a 1:3 ratio (13 μL) into one well of a Matrigel-coated 48-well plate with 500 μL of Stemflex supplemented with Y-27632·2HCl (10 μM).

  • 24.

    Take 15 μL of each clone cell suspension into a PCR tube, separately.

Note: Given the limited cell quantity, centrifugation is not recommended in Step 23–24.

  • 25.

    Add 30 μL of QuickExtract DNA Extraction Solution into the PCR tubes to extract DNA.

  • 26.

    Incubate the PCR tubes at 65°C for 6 min, and then at 98°C for 2 min.

Inline graphicPause point: DNA extraction could be stored at −20°C up to 1 week, or at −80°C for longer storage.

  • 27.
    Amplify the DNA with 5′ arm KI locus validation primers.
    • a.
      Prepare the following PCR mixture:
      Reagent Amount
      2× Phanta Max Buffer 25 μL
      dNTP Mix (10 mM each) 1 μL
      Outside 5′ arm F1 or F2 (10 μM) 2 μL
      Reverse-1 (10 μM) 2 μL
      Phanta Max Super-Fidelity DNA Polymerase 1 μL
      Template DNA 1.5 μL
      ddH2O 17.5 μL
      Total volume 50 μL
    • b.
      Set up the procedures as in Step 1d, except the annealing temperature is 60°C and the extension time is 45 sec.
  • 28.

    Prepare a 1% agarose gel as described above.

  • 29.

    Load 5 μL 2000 bp DNA ladder into one lane and load the 5′ arm KI validation PCR products of each clone into the other lanes, respectively.

Note: The expected results should show no bands at 722 bp or 760 bp in parental cells. The KI cells should display bands at either 722 bp or 760 bp, depending on the primer pairs used, as shown in Figure 4.

Figure 4.

Figure 4

Genotyping of iPSC-Cas9-EGFP KI clones

(A) Three primer pairs were designed based on Tm values calculated using the Thermo Tm calculator.

(B) PCR products from gradient annealing temperatures are shown. Arrows indicate bands of the expected size for successful KI at the 5′ and 3′ loci.

  • 30.

    Record the clones with the correct 5′ arm locus KI and detect their 3′ arm KI locus.

  • 31.

    Use Poly A F and outside 3′ arm R1 primers to conduct PCR, and the reagents are the same as in Step 27.

Note: Same PCR conditions as in Step 27.

  • 32.

    Run a 1% agarose gel to confirm the 3′ arm KI locus (Figure 4).

  • 33.

    Send the PCR products of both 5′ arm and 3′ arm to sequence using the same primers in PCR (Step 27 and 31).

  • 34.

    Maintain 3–6 clones with correct both 5′ arm and 3′ arm KI loci and passage the cells to a 6-well plate as described above.

Cas9 functional validation

Inline graphicTiming: 18 days

In the following section, we assess Cas9 expression in generated iPSCs by western blot and evaluate its functional activity by infecting two types of EGFP sgRNA lentivirus (LentiCrispr v.2 EGFP sgRNA1 and LentiCrispr v.2 EGFP sgRNA2, both with puromycin resistance), as described in previous studies.8 Both parental and genome-edited iPSCs should be prepared for comparison of the Cas9 activity.

Cas9 protein-level detection

Inline graphicTiming: 2 days

  • 35.

    Culture the mixed iPSC-Cas9-EGFP cells and iPSC-Cas9-EGFP single cell clones.

  • 36.

    As iPSCs reach 70%–80% confluence, passage the cells into one well of a 6-well plate at a passage ratio of 1:10.

  • 37.
    Harvest the leftover cells from passage (900 μL, about 2.0 × 106 cells) and extract proteins for western blot.
    • a.
      Collect the cells in a 1.5 mL Eppendorf tube and centrifuge at 300× g for 3 min at 20°C.
    • b.
      Remove the supernatant and wash the cell pellet once with 1 mL of cold DPBS without disturbing the pellet.
    • c.
      Aspirate the liquid and add 80 μL of RIPA buffer to the tube to fully resuspend the cells by pipetting repeatedly.
    • d.
      Vortex the cell suspension for 15 sec and incubate on ice for 30 min, and centrifuge at 13,400x g for 15 min at 4°C.
    • e.
      Quantify the protein concentration using the BCA Protein Assay Kit according to the manufacturer’s protocol (https://www.beyotime.com/product/P0012.htm).
    • f.
      Prepare the protein loading mixture with 4× SDS-PAGE loading buffer (with β-Mercaptoethanol) and ddH2O to the final protein concentration of 1 μg/μL.
    • g.
      Heat the protein loading mixture for 10 min at 99°C to denature proteins.
  • 38.

    Load 10 μL of ColorMixed Protein Marker (10–180 kDa) and 10 μL of the denatured protein loading mixture in 8% SDS-PAGE lanes to detect the expression of Cas9 (Figure 5A), and select two iPSC-Cas9-EGFP clones with the expected Cas9 band for further use.

Note: Steps 37–38 are the common western blot experiment to confirm the expression level of Cas9 in genome-edited iPSC single cell clones. For more details could refer to Liu.9

Figure 5.

Figure 5

Verification of Cas9 expression and function in iPSC-Cas9-EGFP clones

(A) Western blot analysis comparing Cas9 protein expression level in mixed iPSC-Cas9-EGFP cells and iPSC-Cas9-EGFP clones. The 180 kDa band corresponds to the Cas9-EGFP fusion protein, and the 160 kDa corresponds to native Cas9.

(B) Cas9 function was assessed by loss or reduction of EGFP signal following infection with LentiCrispr v.2 EGFP sgRNAs lentivirus.

(C) Flow cytometry analysis showing reduced EGFP fluorescence intensity in infected cells compared to controls (Y-axis was normalized to the mode, and displayed in Modal mode).

EGFP sgRNA plasmid generation

Inline graphicTiming: 2 days

  • 39.
    Generate EGFP sgRNA plasmid
    • a.
      Digest LentiCrispr v.2 vector by preparing the following mixture.
      Reagent Amount
      LentiCrispr v.2 1 μg
      BsmBI-V2 1 μL (10 units)
      10× NEB buffer 5 μL
      ddH2O up to 50 μL
      Total 50 μL
    • b.
      Incubate the mixture at 55°C for 1 h and then at 80°C for 20 min to inactivate the enzyme.
    • c.
      Run a 1% agarose gel to determine the digestion products.
    • d.
      Extract the linearized LentiCrispr v.2 vector (8,749 bp) product by FastPure Gel DNA Extraction Mini Kit.
    • e.
      Annealing the EGFP sgRNA oligos:
      Reagent Amount
      Oligo1 Positive-sense strand (100 μM) 2.5 μL
      Oligo2 Inverse complementary chain (100 μM) 2.5 μL
      10× NEB Buffer 3 5 μL
      ddH20 40 μL
      Total 50 μL
      Note: Use the corresponding oligos to generate LentiCrispr v.2 EGFP sgRNA1 and sgRNA2.
    • f.
      Set up the PCR program: 95°C for 5 min, and then ramp down to 25°C at 1.5°C/min.
    • g.
      Dilute annealed oligos in a 1:200 ratio in ddH2O.
    • h.
      Prepare a mixture of linearized vector and annealed oligos following 20°C incubation for 10 min to obtain LentiCrispr v.2 EGFP sgRNA plasmids.
      Reagent Amount
      LentiCrispr v.2 50 ng
      Diluted annealed oligos 1 μL
      T7 DNA ligase 1 μL
      2× Stick together buffer 10 μL
      ddH2O up to 20 μL
      Total 20 μL
    • i.
      Mix 9 μL of ligated products with 1 μL of 10× loading dye and run a 1% agarose gel to confirm the ligated products as described in Step 1e.
    • j.
      Transform chemically competent E. coli cells with the ligated products and sequence as described above.
    • k.
      Pick up three clones to expand as described above.
    • l.
      Use the cPPT element primers for the Sanger sequencing.
    • m.
      Expand the correct clones and extract the plasmids using the EndoFree Plasmid Midi Kit.
      Inline graphicPause point: The plasmids could be stored at −20°C until packaging the lentivirus.

EGFP sgRNA lentivirus package

Inline graphicTiming: 8 days

  • 40.
    Package the EGFP sgRNA lentivirus.
    • a.
      Change fresh medium when HEK 293T cells reach 70%–80% confluence.
    • b.
      Prepare the following mixture in a 1.5 mL Eppendorf tube:
      Reagent Amount
      Opti-MEM 750 μL
      LentiCrispr v.2 EGFP sgRNA plasmid 8 μg
      psPAX2 6 μg
      pMD2.G 2 μg
      Lipo8000 25.6 μL
      Note: psPAX2 (2nd generation packaging plasmid for producing viral particles) and pMD2.G (envelope plasmid for producing viral particles) are 2nd generation system. Other lentiviral packaging systems and plasmids could be alternatives.
    • c.
      Add the mixture to the dish.
    • d.
      Change medium 12 h after transfection.
    • e.
      Collect supernatant at 48 and 72 h post-transfection.
    • f.
      Filter the supernatant with a 0.45 μM filter.
    • g.
      Concentrate viral particles.
      • i.
        Add PEG8000 to the viral supernatant at a 1:4 ratio.
      • ii.
        Incubate the mixture on a rotating mixer shaker at 4°C for 12–18 h.
        Note: Do not incubate over 24 h.
      • iii.
        Centrifuge the mixture at 4°C, 4,000x g for 30 min.
      • iv.
        Remove the supernatant and resuspend the virus in 1 mL of DPBS.
      • v.
        Aliquot 200 μL per 1.5 mL Eppendorf tube and store at −80°C.
        Note: Wear protective goggles when you work with lentivirus. Additionally, rinse all disposable consumables that have contact with lentivirus using bleach before discarding.
  • 41.

    Detect the titer of the lentivirus according to the Lentivirus qPCR Titration Kit (https://store.sangon.com/productDetail?productInfo.code=B605115).

Inline graphicPause point: Lentivirus could be stored at −80°C up to 6 months.

Note: Avoid freeze-thaw cycles of lentivirus.

Cas9 activity test

Inline graphicTiming: 6 days

  • 42.

    Seed four wells of iPSC-Cas9-EGFP single clone cells and one well of parental iPSCs at 30% density in a 12-well plate, respectively. For four wells of iPSC-Cas9-EGFP, there are two wells for viral infection (sgRNA1 and sgRNA2), one for EGFP signal control, and one for puromycin selection control.

Note: The parental iPSCs are used for negative control.

  • 43.

    After 24 h, replace the medium to 1 mL of fresh Stemflex medium into each well.

  • 44.

    Add LentiCrispr v.2 EGFP sgRNA1 lentivirus to one infection well, and LentiCrispr v.2 EGFP sgRNA2 lentivirus to the other at an MOI of 10.

  • 45.

    Replace the medium with 1 mL of fresh Stemflex 24 h post-infection.

  • 46.

    Begin selection by adding puromycin (2 μg/mL) to the two infected wells and the puromycin selection control well.

Note: We used two concentrations of puromycin (1 μg/mL and 2 μg/mL) to test and finally determined 2 μg/mL, which is the minimal concentration required to kill all the uninfected cells in 48 h. The sensitivity of iPSCs from different origins may vary. It is recommended to optimize the puromycin concentration for each iPSC line.

  • 47.

    Replace the fresh Stemflex with puromycin every other day until all the uninfected cells in the selection control well are eliminated.

  • 48.

    On day 6 post-infection, wash both infected and control wells with 1 mL of DPBS per well.

  • 49.

    Add 0.5 mL of Accutase to each well and incubate for 5 min to dissociate cells.

Note: For the following FACS analysis, we recommend using Accutase to dissociate iPSCs into single cells.

  • 50.

    Add 1 mL of Stemflex to neutralize Accutase, then centrifuge at 300× g for 3 min.

  • 51.

    Discard the supernatant and resuspend the cell pellet in 300 μL of DPBS.

  • 52.

    Immediately analyze the EGFP expression in all samples (parental cells, iPSC-Cas9-EGFP, iPSC-Cas9-EGFP+sgRNA1, iPSC-Cas9-EGFP+sgRNA2) by FACS (CytoFLEX LX) (Figures 5B and 5C).

Note: Knockout efficiency depends on the lentiviral titer and the duration of post-infection culture. If EGFP knockout is not evident, the amount of lentivirus used in Step 44 should be increased, and the culture period before FACS analysis should be extended (5–10 days is typically sufficient).10

  • 53.

    Expand and cryopreserve the iPSC-Cas9-EGFP clones with functional Cas9.

Expected outcomes

This protocol describes the generation of iPSCs expressing Cas9-EGFP, from plasmid construction to validation of Cas9 expression and functional activity. By using a GAPDH exon9 targeting sgRNA and a Cas9-EGFP SLEEK donor plasmid, iPSCs undergo the HDR and survive, while cells undergoing NHEJ are eliminated due to disruption of the essential GAPDH gene. Compared with other gene-editing technologies, the SLEEK method demonstrates superior KI efficiency, exceeding 90%, as reported by Editas Medicine.4 Applying SLEEK to generate iPSC-Cas9-EGFP effectively addresses several critical challenges. First, the inherent difficulty of gene editing in iPSCs. Second, the possibility of cells losing exogenous genes during passaging. Third, Cas9 silencing during differentiation. Compared to safe harbor locus KI cell lines or antibiotic selection-based systems, this GAPDH locus-integrated cell line offers significantly practical advantages. Upon successful generation, the generated cells undergo a natural selection process due to the stable integration at the constitutively active GAPDH locus, eliminating the need for continuous antibiotic pressure or additional selection markers. Consequently, these cells are not only easy to maintain but also reduce experimental variability associated with prolonged selection regimes, making them a robust and convenient model for studies. Importantly, the SLEEK method preserves the pluripotency and differentiation capacity of iPSC-Cas9-EGFP, as demonstrated by their robust potential to differentiate into all three germ layers.1 Spontaneous differentiation of iPSCs in this study after editing is negligible. The generated iPSC-Cas9-EGFP can be broadly used for genome-editing and related applications.

Limitations

At the technical implementation level, special attention must be given to potential false positives resulting from the T2A-mediated co-expression system linking Cas9 and EGFP. Specifically, cell populations with high EGFP expression may lack Cas9 protein expression (the "EGFP+/Cas9-" false positive phenotype), which can significantly compromise the reliability of subsequent experimental results. Therefore, a rigorous quality control system is essential during cell line generation. This includes: verification of precise KI via PCR at the integration loci; confirmation of Cas9 protein expression by western blot; functional validation of Cas9 activity by editing efficiency assay. This multi-layered verification strategy is essential to ensure the selection of monoclonal cell lines with authentic co-expression of both Cas9 and EGFP.

The iPSC-Cas9-EGFP SLEEK cells achieve stable Cas9 expression without the need for antibiotic selection. However, the constitutive expression lacks spatiotemporal control, and sustained Cas9 activity may increase cellular toxicity or off-target effects. In this study, we did not observe significant impairment in proliferation or abnormal cell death. Nevertheless, if the goal is to establish gene knockout cell lines for subsequent experiments or long-term culture, additional validation of stability and safety is advised. While this method is well-suited for CRISPR-Cas9-based screening, careful optimization may be required for experiments such as dynamic regulation studies or sensitive cell models. In such a context, integration with inducible expression systems may be considered to balance expression stability with experimental flexibility.

Troubleshooting

Problem 1

The PCR product size of the vector or insert is not correct.

Potential solution

  • Use high-fidelity enzymes and set up enough extension time for PCR.

Problem 2

The failure of ligation of sgRNA with PX458M or LentiCrispr v.2 vector.

Potential solution

  • Use the correct digest enzyme for each vector, the Bbsl-HF for PX458M and the BsmBI-V2 for the LentiCrispr v.2 vector.

  • The ligation of the vector (PX458M or LentiCrispr v.2) and sgRNA is based on enzymes. To ensure that the same viscous ends are used for ligation, additional bases of homologous sequences must be added to the sgRNA separately. Make sure to synthesize the oligos in the following format: 5′-CACCGNNNNNNNNNNNNNNNNNNN-3′, 5′-AAACNNNNNNNNNNNNNNNNNNNC-3′.

Problem 3

Low electroporation efficiency.

Potential solution

  • Make sure the plasmids are correct.

  • Use a high concentration of plasmids, and keep the plasmid volume below 10% of the total electroporation volume.

  • Avoid introducing bubbles when resuspending iPSCs in the electroporation mixture or when transferring cells into the Nucleocuvette Strips (or other alternative electroporation systems).

Problem 4

Unsuccessful PCR amplification of the 5′ arm or 3′ arm KI locus.

Potential solution

  • The sorted iPSC-Cas9-EGFP clones may not have undergone successful KI. Ensure that a sufficient number of clones are collected for genotyping.

  • Allow adequate time (at least 14 Days) post-electroporation before sorting. During sorting, select cells with moderate fluorescence intensity, as high EGFP signals may be associated with Cas9 loss.

Problem 5

The EGFP signal is visible, but the Cas9 protein is undetectable or of incorrect size on western blot.

Potential solution

  • The issue is similar to Problem 4 and may be caused by Cas9 loss. Ensure that a sufficient number of clones are collected for genotyping and subsequent validation.

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Joe Z. Zhang (joezhang@szbl.ac.cn).

Technical contact

Technical questions on executing this protocol should be directed to and will be answered by the technical contact, Yao Zhang (onezhangyao11@163.com).

Materials availability

This study did not generate new unique reagents.

Data and code availability

Original data for figures in the paper are available.

Acknowledgments

The LentiCrispr v.2 plasmid was a gift from Dr. Chen Yu from the Institute of Cancer Research, Shenzhen Bay Laboratory. This study was funded by the National Natural Science Foundation of China Research Fund for International Scientists (grant #W2432052), the National Natural Science Foundation of China General Program (grant #82370311), and the Guangdong Province International Science and Technology Cooperation Research Project (grant #2023A0505050088). The graphical abstract for this publication was created with BioRender.com.

Author contributions

Y.Z. conducted most of the experiments and wrote the manuscript. H.Y., Y.Y., Z.L., and L.C. conducted the experiments, analyzed the data, and edited the manuscript. H.T. supervised the project and wrote the manuscript. J.Z.Z. supervised the project, wrote the manuscript, and provided the funding.

Declaration of interests

The authors declare no competing interests.

References

  • 1.Zhang Y., Lu Z., Yang H., Cheng L., Zaklyazminskaya E., Sokolova O., Tan H., Zhang J.Z. Generation of stable Cas9-EGFP expressing human induced pluripotent stem cell lines based on SeLection by essential-gene exon knock-in technology. Stem Cell Res. 2025;85 doi: 10.1016/j.scr.2025.103710. [DOI] [PubMed] [Google Scholar]
  • 2.Karbassi E., Padgett R., Bertero A., Reinecke H., Klaiman J.M., Yang X., Hauschka S.D., Murry C.E. Targeted CRISPR activation is functional in engineered human pluripotent stem cells but undergoes silencing after differentiation into cardiomyocytes and endothelium. Cell. Mol. Life Sci. 2024;81:95. doi: 10.1007/s00018-023-05101-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Cabrera A., Edelstein H.I., Glykofrydis F., Love K.S., Palacios S., Tycko J., Zhang M., Lensch S., Shields C.E., Livingston M., et al. The sound of silence: Transgene silencing in mammalian cell engineering. Cell Syst. 2022;13:950–973. doi: 10.1016/j.cels.2022.11.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Allen A.G., Khan S.Q., Margulies C.M., Viswanathan R., Lele S., Blaha L., Scott S.N., Izzo K.M., Gerew A., Pattali R., et al. A highly efficient transgene knock-in technology in clinically relevant cell types. Nat. Biotechnol. 2024;42:458–469. doi: 10.1038/s41587-023-01779-8. [DOI] [PubMed] [Google Scholar]
  • 5.Park J.B., Park H., Son J., Ha S.-J., Cho H.-S. Structural study of monomethyl fumarate-bound human GAPDH. Mol. Cells. 2019;42:597–603. doi: 10.14348/molcells.2019.0114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Gibson D.G., Young L., Chuang R.-Y., Venter J.C., Hutchison C.A., Smith H.O. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods. 2009;6:343–345. doi: 10.1038/nmeth.1318. [DOI] [PubMed] [Google Scholar]
  • 7.Zhang J.Z., Termglinchan V., Shao N.-Y., Itzhaki I., Liu C., Ma N., Tian L., Wang V.Y., Chang A.C.Y., Guo H., et al. A human iPSC double-reporter system enables purification of cardiac lineage subpopulations with distinct function and drug response profiles. Cell Stem Cell. 2019;24:802–811.e5. doi: 10.1016/j.stem.2019.02.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Shalem O., Sanjana N.E., Hartenian E., Shi X., Scott D.A., Mikkelson T., Heckl D., Ebert B.L., Root D.E., Doench J.G., Zhang F. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 2014;343:84–87. doi: 10.1126/science.1247005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Liu C., Shen M., Liu Y., Manhas A., Zhao S.R., Zhang M., Belbachir N., Ren L., Zhang J.Z., Caudal A., et al. CRISPRi/a screens in human iPSC-cardiomyocytes identify glycolytic activation as a druggable target for doxorubicin-induced cardiotoxicity. Cell Stem Cell. 2024;31:1760–1776.e9. doi: 10.1016/j.stem.2024.10.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Yuen G., Khan F.J., Gao S., Stommel J.M., Batchelor E., Wu X., Luo J. CRISPR/Cas9-mediated gene knockout is insensitive to target copy number but is dependent on guide RNA potency and Cas9/sgRNA threshold expression level. Nucleic Acids Res. 2017;45:12039–12053. doi: 10.1093/nar/gkx843. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Original data for figures in the paper are available.


Articles from STAR Protocols are provided here courtesy of Elsevier

RESOURCES